Iron bioavailability in larvae yellow snapper (Lutjanus argentiventris): Cloning and expression analysis of ferritin-H

Fish & Shellfish Immunology 37 (2014) 248e255

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Iron bioavailability in larvae yellow snapper (Lutjanus argentiventris): Cloning and expression analysis of ferritin-H Martha Reyes-Becerril a, Carlos Angulo-Valadez a, Ma Esther Macias b, Miriam Angulo a, Felipe Ascencio-Valle a, * a b

Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Mar Bermejo 195, Col. Playa Palo de Santa Rita, La Paz, B.C.S. 23090, Mexico Centro Universitario de Ciencias Exactas e Ingenierías, Universidad de Guadalajara, 44430 Guadalajara, Jalisco, Mexico

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 November 2013 Received in revised form 5 February 2014 Accepted 12 February 2014 Available online 20 February 2014

Ferritin is a major intracellular iron storage protein in higher vertebrates and plays an important role in iron metabolism. In this study, ferritin H subunit was cloned from the larvae of yellow snapper, Lutjanus argentiventris, by rapid amplification of cDNA ends (RACE) following in silico transcriptome analysis. The full-length cDNAs of the LaFeH was 1231 bp in length encoding 177 amino acids with a predicted molecular mass (MW) about 20.82 kDa and theoretical isoelectric point (pI) of 5.79. Amino acid alignment revealed that LaFeH shared high similarity with other known ferritins. It shared high degree identity to the ferritin H subunits of Lates calcarifer (99%), Takifugu rubripes (97%) and Dicentrarchus labrax (97%), and low identity to that of human (82%) and mouse (84%). By real-time PCR assays, the mRNA transcripts of LaFeH was found to be higher expressed in head-kidney, eye, heart and brain. Moreover, mRNA expression levels of LaFeH was measured by real-time PCR in larvae exposed with graded levels of iron (6.8 mg/ml and 13.6 mg/ml (Fe2x and Fe4x, respectively) and an iron chelation assay. Results showed that the expression of the LaFeH mRNA increased gradually with Fe2x in water. The LaFeH gene expression declined with increasing iron exposure levels at Fe4x. Finally, we can observe a high expression of LaFeH gene in larvae exposed to iron chelation therapy at 2 h; however this increase was gradually decreasing over time. In summary, the LaFeH gene expression for larvae yellow snapper showed a dose-depend increase following the iron treatment. These data indicated that iron bioavailability regulates LaFeH at transcriptional level in larvae yellow snapper. Further studies are necessary to ascertain their role in the immune response in teleost fish. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Ferritin-H Iron Larvae Yellow snapper RT-PCR

1. Introduction Intensively cultured fish are vulnerable to stressing conditions, especially during larval stage. The yolk-sac larvae may be considered the most vulnerable stage of the life cycle of the fish and the microbial diseases induced by opportunistic pathogens may cause high losses [1]. At larval and juvenile stages the fish has not developed a specific immune defense and cannot be vaccinated. In order to resist the pathogens, larvae and juvenile fish depend on nonspecific mechanisms consisting of a protective microflora in the gut and a well functioning nonspecific immune system [2]. Iron withholding, as an important innate defense mechanism, has received much attention from immunologists in * Corresponding author. Tel.: þ52 6121238484. E-mail addresses: [email protected], [email protected] (F. AscencioValle). http://dx.doi.org/10.1016/j.fsi.2014.02.011 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.

recent years [3,4]. It functions by retaining iron within host cells, thereby leading to a decrease in plasma iron, which is critical for bacterial growth [5]. The availability of iron has been shown to be a critical factor in the pathogenicity of microorganisms invading living hosts [5]. The amount of free iron available to the invading pathogen within the host is extremely low [6]. Consequently, pathogens must possess effective iron acquisition systems in order to sequester the iron bound to proteins such as transferrin or lactoferrin present in the serum and mucosal secretions or included in molecules such hemoglobin, ferritin, hemosiderin and free heme [7]. As an important iron-binding protein, ferritin plays a crucial role in the iron-withholding defense system [8]. Ferritin, a ubiquitous and highly conserved protein has been studied in a variety of species including bacteria, fungi, plants and animals. It is usually a 450 kDa protein which consists of a central hydrous ferric-oxide phosphate core surrounded by an outer hollow sphere protein

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

shell called apoferritin [9]. In vertebrates the cytosolic ferritins are composed of Heavy (H) and Light (L) subunit types which have different molecular weights ranging between 18 and 28 kDa, encoded by two distinct genes [10]. They exhibit a high degree of complementation in their functional roles. The H subunit is thought to be responsible for the rapid detoxification of iron, which has highly conserved amino acid residues at the ferroxidase center. The L subunit, which contains specific carboxylic groups to provide efficient micelle nucleation sites for iron accumulation, plays a role in iron nucleation, mineralization and long-term storage [11]. Ferritin expression is regulated transcriptionally, as well as at post transcriptional level, dependent on intracellular iron levels, which interacts with a region called iron responsive element (IRE) and iron regulatory proteins (IRPs) [12]. In addition, previous studies suggest that the expression of ferritin is subject to other factors such as oxidative stress [13], hormones and inflammatory cytokines (Ong et al., 2006) and heavy metals [14]. It has also been described that ferritin is regulated by pathogen associated molecular pattern (PAMP) induction, employing the sequestration of iron to control the ROS production and pathogen proliferation [3,15]. Concentration and form of iron vary at different anatomical locations in a host and it is possible that bacterial pathogens sense these differences and regulate gene expression in response to iron sources [16]. Herein, we characterized a teleostean counterpart of the ferritin H subunit (LaFeH) from larvae yellow snapper (Lutjanus argentiventris) an important fishery resource in the Gulf of California (México), and analyzed its transcriptional modulation upon different graded levels of iron in the water. 2. Materials and methods 2.1. Fish and experimental design Larvae of yellow snapper (L. argentiventris) were obtained from a captive broodstock held in the marine finfish hatchery of the Centro de Investigaciones Biologicas del Noroeste (CIBNOR, La Paz BCS, México). Larvae were distributed into twelve conical fiberglass tanks (35 l) at 2 dph (days post hatching), with initial stocking density of 100 larvae l1. They were reared according to Geay et al. [17] supplied with running seawater, which had been filtered through a sand filter, then passed successively through a tungsten heater and degassing column packed with plastic rings. Water temperature was maintained at 24  2  C, dissolved oxygen at 4.3e Table 1 Primers used for Ferritin H gene and expression analysis. Primer

Sequence (50 -30 )

Purpose used

FerrHF

GCCCTGCAGCTGGAGAAGAG

FerrHR FeH-F

CATTTTGCGCAGGTTGGTCAC AGCGTGAACCAGTCCCTGCTG

FeH-R

GCGCAGGTTGGTCACCCAGT

EF-1-F

GCTGTAAGGGGGCTCGGTGG

EF-1-R

CCCTGCTGGCCTTCACCCTC

FerrH

GTCACCCAGTCTGCCAGCTCTT

FerrH

AGCAGAGCTTGTGCAAGTCCA

FerrH

AGAAGAGCGTGAACCAGTCCCT

FerrH

CTGGACTTGCACAAGCTCTGCT

Degenerate primers SP1 (RACE) Degenerate primers Quantitative Real-Time and RT-PCR Quantitative Real-Time and RT-PCR Quantitative Real-Time and RT-PCR Quantitative Real-Time and RT-PCR RACE-50 SP2 Nested-50 SP3 RACE-30 SP5 Nested-30

PCR

249

Table 2 Identity matrix of Lutjanus argentiventris Ferritin H. Species and accession numbers. Lutjanus argentiventris

Lates calcarifer Takifugu rubripes Dicentrarchus labrax Larimichthys crocea Epinephelus coioides Oplegnathus fasciatus Oreochromis niloticus Anoplopoma fimbria Haplochromis burtoni Maylandia zebra Osmerus mordax Salmo salar Parachaenichthys charcoti Chionodraco rastrospinosus Scophthalmus maximus Notothenia coriiceps Ictalurus punctatus Chaenocephalus aceratus Oncorhynchus masou formosanus Xiphophorus maculatus Caligus clemensi Trematomus bernacchii Oncorhynchus mykiss Oryzias latipes Trematomus hansoni Danio rerio Oncorhynchus nerka Homo sapiens Mus musculus

Query cover (%)

Identity (%)

Accession

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 98 100 100 100 97 100 100 100 96 97 96

99 97 97 96 97 97 95 97 95 95 95 93 93 93 94 93 92 93 93 92 92 92 92 91 90 90 91 82 84

ADU87113.1 XP_003969725.1 ACN80998.1 ACY75475.1 AEW43728.1 BAM37461.1 XP_003445743.1 ACQ59065.1 XP_005937262.1 XP_004543325.1 ACO09727.1 NP_001117129.1 CAR66076.1 CAL92185.1 ADI24353.1 CAR66080.1 NP_001187267.1 CAR66075.1 ABY21333.1 XP_005812594.1 ACO15170.1 CAR66078.1 NP_001153993.1 XP_004067092.1 CAR66079.1 NP_571660.1 AAK08117.1 NP_002023.2 NP_034369.1

6.9 mg l1 and pH at 7.7e8.1. Total ammonia and nitrite concentration remained below 0.02 mg l1. From 6 dph onwards, the larvae were exposed to the different treatments (each treatment was replicated three times) where the iron was added as FeCl3$6H2O at 2x and 4x (where 1x is based on the normal concentration of sea water). The treatments were dissolved in water to various concentrations. Four treatments were studied: 1. control (marine water); 2. Exjade DeferasiroxÒ for iron chelation, 125 mg l1 (ICL670, Novartis Pharma AG, Basel, Switzerland); 3. FeCl3$6H2O (Fe2x), 6.8 mg/ml; 4. FeCl3$6H2O (Fe4x), 13.6 mg/ml. 2.2. Fe Determination by atomic absorption spectrophotometry The concentrations of Fe in water samples (time 0 posttreatment) and larvae (48 h post-treatment) were analyzed using an atomic absorption spectrometer (AVANTA; GBC Scientific Equipment, Dandenong, Australia) with an air-acetylene flame. Certified standard reference material TORT-2 (National Research Council of Canada, Ottawa) was used to check the accuracy of the instrument; the analytical values were within the range of certified values.

PCR PCR PCR

Table 3 Larvae and water samples exposed to different concentration of waterborne iron analyzed (mean  S.D.) by atomic absorption spectrophotometry. Treatments

Larvae (mg/g wet weight)a

Control Fe2x Fe4x ExjadeÒ Deferasirox

1.69 2.93 3.49 1.27

ND: Not detected. a Sampling: 48 h post-treatment. b Sampling: 0 h post-treatment.

   

0.07 0.03 0.05 0.03

Water (mg/ml)b ND 1.35  0.04 1.88  0.05 ND

250

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

2.3. Larvae sample collection Yellow snapper larvae (8 dph, 2.76  0.10 mm length) were randomly sampled from the rearing tanks using a 200 mm dip net. We measured bioaccumulation in fish larvae removed after 2, 12, 24 and 48 h. Pool of larvae of around 450 mg wet weight (w8522 total larvae/treatment) were used for gene expression. Larvae for RNA extraction were frozen stored at 80  C until determination. For RNA extraction, larvae were further homogenized by sonication on ice, using tapered microtip (3 mm), ultra high intensity and 20% amplitude, with pulse ON set for 1 s and pulse OFF for 1 s for a total

of 59 s (Sonics Vibra cell 750 W model, Sonics & Material Inc.). Triplicate samples from each treatment replicate at each sampling time were taken for further analysis (n ¼ 9 samples/treatment/ time). The studies presented in this manuscript were approved by the Bioethical Committee of the CIBNOR. 2.4. Cloning of LaFeH full-length cDNA With the homologous alignment of different cDNA of ferritin H subunit in other fish, the partial sequence of LaFeH in yellow snapper was obtained by RT-PCR. The primers used are shown in

Fig. 1. Amino acid sequence alignment of known fish, human and mouse Ferritin H. Accession numbers are as in Table 2. Asterisk denotes identity.

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

251

Fig. 1. (continued).

Table 1. To isolate the full-length cDNA of LaFeH, RACE PCR was carried out using a second generation 50 /30 RACE kit (Roche Diagnostics, Indianapolis, IN). Gene-specific primers (LaFeH-F and LaFeH-R) were designed according to the known EST sequences of LaFeH. Briefly, total RNA was extracted from fish larvae using Trizol Reagent (Invitrogen, USA) and first strand cDNA was synthesized using the protocol recommended by the second generation 50 / 30 RACE kit. Then, 50 strand was amplified using specific LaFeH-F1 (SP2) and oligo dT-Anchor primers, followed by a nested PCR using specific (SP3) and PCR Anchor primers. For 30 strand, cDNA was amplified by specific (SP5) and PCR Anchor primer. The generated

PCR products were purified (Promega, #Cat. A9281), cloned into pGEMÒ-T Easy Vector (Promega, #Cat. A1360) and subsequently sequenced (GENEWIZ, Inc.). Finally, the products of LaFeH gene were confirmed by RT-PCR and the cDNA sequences were confirmed. 2.5. DNA sequence and structure analysis DNA sequences were analyzed for identity with other known sequences using the BLAST program. Putative amino acid sequence alignment was performed using the ClustalW program.

252

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

control value at the same sampling time. Values higher than 0 in a parameter express an increase while values lower than 0 express a decrease in a parameter. All data were analyzed with the Statistical Package for Social Science (SPSS for Windows, version 17.0; SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Accumulation of waterborne iron Table 3 shows the Fe concentration in larvae and water. These data do not represent the metal toxicity, no mortality was observed during the experiment. Fe was not detected in water and ExjadeÒ treatments. The values obtained are consistent with analyzed treatments. 3.2. Sequence characterization and phylogenetic analysis of RpFeH

Fig. 2. Predicted 3D structural model of LaFeH. Five a helixes were found. Four helixes were arranged as a bundle which contains five amino acid residues to form the predicted metal binding site (Glu-24, Glu-59, His-62, Glu-104, Gln-138).

Phylogenetic tree was constructed by MEGA5.0 software using neighbor-joining method. Identification of conserved regions was performed by the PROSITE program (http://prosite.expasy.org/) and the secondary structure-3D model by the Phyre2.0 program (http:// www.sbg.bio.ic.ac.uk/phyre2). Iron Responsive Elements was analyzed by Rfam 11.0 program (http://rfam.sanger.ac.uk/). 2.6. Expression analysis of LaFeH by real-time PCR Various tissues, including skin, muscle, liver, intestine, heart, brain, spleen, eye, gill and head-kidney, were collected from three normal juvenile yellow snapper (15 g) and total RNA was extracted to detect the expression level of ferritin H in these tissues. First strand cDNA was synthesized from 1 mg of each total RNA and used as template for real-time PCR. EVA green 20X real-time PCR (Invitrogen, USA) was used for PCRs. EF-1a was used as internal reference control. Each PCR was carried out on a 12.0 ml volume containing 0.75 ml Eva green 20X, 6.28 ml water grade molecular biology, 1.5 ml Buffer 10X, 0.75 ml MgCl2 50 mM, 0.25 ml dNTP’s 10 mM, 20 pM each of forward primers and reverse primers, 0.07 ml taq platinum (Invitrogen) and 1 ml diluted cDNA sample. Reactions’ conditions consisted of the steps: 94  C for 4 min; 95  C for 15 s, 56  C for 30 s, and 72  C for 30 s, 30 cycles. Sample was compared to a standard curve obtained with 100e105% of amplification efficiency for both the EF-1a and for LaFeH gene, respectively. All reactions were performed by triplicate and including a negative control. The 2DDCt method was used to calculate the changes in transcription of the genes of interest [18].

The cDNA of LaFeH was deposited in GenBank (Number accession: KF873611) from L. argentiventris by RACE PCR (Fig. 1). The determined full-length cDNA of LaFeH was 1231 bp long, containing a 534 bp open reading frame (ORF). The deduced amino-acid sequence of the ferritin heavy chain was consisted of 177 residues with a calculated molecular mass of 20.82 kDa and the isoelectric point (pI) of 5.79. The deduced protein sequence showed very high identity with all the known fish, ranging from 90 to 99%, human (82%), and mouse (84%) FHC (Table 2). The complete iron-responsive element I (IREs) was found in the 117-AGGTTACCTGCTTCAACAGTGCTTGAACGGCAACCT- 152 UTR of LaFeH cDNA using Rfam program. The deduced amino acid sequence of the LaFeH contained two putative iron-binding region signatures: Ferritin iron-binding regions signature 1 (58EEREHAEKLMKLQNQRGGR-76) and Ferritin iron-binding regions signature 2 (123-DPHLCDFIETHYLDEQVKSIK-143) as determined by the PROSITE program. LaFeH was highly similar to fish ferritin H subunit. It shared high degree identity to the ferritin H subunits of Lates calcarifer (99%), Takifugu rubripes (97%) and Dicentrarchus labrax (97%), and low identity to that of human (82%) and mouse (84%). Secondary-structure prediction revealed the presence of five helices in the regions corresponding to LaFeH subunit positions 11e40, 45e72, 93e120, 124e154 and 159e172; while 97% of residues of LaFeH were modelled at >90% confidence as determined by Phyre2 program (Fig. 2). A phylogenetic tree was further constructed based on the ferritin subunit amino acid sequences from various fish and mammals. LaFeH was genetically closest to ferritin H subunit from L. calcarifer, then to other fish and mammal H subunit (Fig. 3). 3.3. Yellow snapper ferritin H are constitutively expressed and widely distributed LaFeH was detected in all the tissues assayed in naïve yellow snapper (Fig. 4). The higher expression was detected in the headkidney followed by the eye, heart and brain whilst the lowest expression was detected in the skin and intestine.

2.7. Statistical analysis

3.4. Iron treatment up-regulated FeH expression in larvae yellow snapper

Data were statistically analyzed by one-way analysis of variance (ANOVA) and Tukey comparison of means when necessary. Differences were considered statistically significant when P  0.05. Data for RT-PCR are expressed as fold increase (mean  standard deviation, SD), obtained by dividing each sample value by the mean

The relative expression levels of the LaFeH in response to different concentration of iron are presented in Fig. 5. A clear dosedependent expression patterns were observed. Iron chelating assay showed that LaFeH exhibited clear iron-binding activity. In this treatment we can observe a significant decrease of LaFeH gene with

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

253

Fig. 3. Phylogenetic analysis of the yellow snapper ferritin H subunit. The tree is based on an alignment corresponding to the full length of the ferritin amino acid sequences, using ClustalW and MEGA with a cut off less than 20 using 10,000 bootstraping. Genetic distances were calculated based on protein differences (p-distance). Accession numbers are indicated.

the time at 2 and 24 h of exposition with a maximum and minimum expression (about 5.3-fold and 0.73-fold of LaFeH) at 2 and 48 h of treatment, respectively. Larvae exposed to Fe2x treatment showed a significant enhance where LaFeH was gradually increased with time reached a higher peak at 48 h (about 1.8-fold). Finally, the mRNA levels of LaFeH in larvae exposed to Fe4x treatment were upregulated and reached their peak levels (about 4.3-fold) at 2 h of treatment, followed by a decrease at 12 h (about 0.2-fold), followed by increase at 24 h and 48 h (3.10 and 2.05-fold, respectively). 4. Discussion Ferritin is the most common and ancient molecule of iron homeostasis, essentially ubiquitous and expressed in most eubacteria, archea, plants and animals [19]. Iron (Fe) is an essential nutrient on account of its indispensable function in many fundamental cellular

processes. However, in the presence of oxygen, iron can catalyze the production of reactive oxygen species (ROS) that cause cellular damage by oxidative stress [20]. However, due to its capacity to retain iron, the Ferritin gene is a potential candidate gene involved in host defense, restricting the bioavailability of iron for the invasion of pathogenic microorganisms [21]. Consequently, the identification and characterization of Ferritin in marine vertebrates of commercial importance takes on added significance due to the scarce existing information. In this study, we have identified one ferritin subunit full-length cDNAs from the larvae of Yellow snapper, and further categorized them as LaFeH based upon sequence characterization and identity alignment with other known ferritin subunit. Studies regarding ferritin subunits identified in marine vertebrates, demonstrate that it is constituted by a sequence between 170 and 180 amino acid residues. Our results showed that LaFeH has

254

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

Fig. 4. The expression pattern of LaFeH in yellow snapper different tissues was detected by the quantitative RT-PCR. LaFeH mRNA was expressed in all tissues detected with higher expression levels in the head-kidney (HK). The EF1-a gene was used as an internal control to calibrate the cDNA template for all the samples. All values represent the mean  SD (n ¼ 3).

an open reading frame of 534 nucleotides that encode a protein of 177 amino acid residues. These results coincides with previous report for large yellow croaker (Pseudosciaena crocea) [9] confirming a conservative orthology with respect to other Ferritin-likes

Fig. 5. Expression of LaFeH determined by real-time PCR in larvae of yellow snapper exposed to different treatment of iron. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a gene  SD. Asterisks denote significant differences between control and treated groups (P < 0.05).

subunits. The deduced protein sequence showed very high identity with all the known fish, ranging from 90 to 99%. It shared high degree identity to the ferritin H subunits of L. calcarifer (99%), T. rubripes (97%) and D. labrax (97%), and low identity to that of human (82%) and mouse (84%). The phylogenetic analysis of ferritin H subunit described for vertebrates confirms the idea that LaFeH corresponds to subunit H-like, since LaFeH was genetically closest to ferritin H subunit from L. calcarifer, then to other fish and mammal H subunit. Since the cDNA sequence of ferritin subunit has been identified in few species of teleosts, there is little research on the tissue expression profile of the fish ferritin subunit. In the present study, the LaFeH mRNA could be detected by real-time quantitative PCR assays in all the detected tissues (principally in head-kidney, eye, brain and heart), which was in agreement with the expression levels of ferritins from other aquatic vertebrates [22,9]. Most eukaryotes have two major ferritin genes that encode subunits with different properties, generally named H (heavy) and L (light) that co-assemble to form heteropolymers [19]. Thus, L-rich copolymers predominate in spleen and liver, whereas H-rich ferritins are found in other tissues, such as heart and kidney [19]. Ferritin H-chain and L-chain from different tissues assemble in different ratios to form heteropolymers to improve the flexibility and functionality of the molecule [23]. It has been reported that the ferritins enriched with H-chain predominate in the heart and brain contributing to oxidize and sequester the iron actively, while the ferritins rich in L-chain are abundant in the spleen and liver responsible for storing iron stably [24]. In order to better understand the role of the ferritin H subunit in larvae of yellow snapper availability, the transcriptional expression level of LaFeH was analyzed by real-time PCR. In our study, we found that the ferritin H gene was transcriptionally up-regulated in larvae after stimulated with Fe2x treatment and reached their peak values at 48 h post-induction. Mammalian ferritin levels increased in order to allow iron storage and availability for use when needed, as well as protection from iron mediated oxidative stress [25,26]. It has been shown that ferritin level markedly increased with high levels of dietary iron in fruit fly [27] and mosquito [28]. In our study, we found that the LaFeH gene was transcriptionally up-regulated in larvae after exposition with Fe4x and reached their peak values at 2 h; however this expression was diminished at time until 48 h. The M subunit has the ferroxidase activity which can contribute to the sequestering of free iron like H subunit [9]. This might be the reason that the ferritin H subunit gene was up-regulated in larvae yellow snapper. Finally, the iron chelation therapy was used to remove iron from the body and water using Deferasirox (4-[3,5bis(2-hydroxyphenyl)-1,2,4-triazol-1-yl]-benzoic acid, a tridentate chelator with high selectivity for Fe3þ, and its NO2 donation arises from one triazole nitrogen and two phenolate oxygen donors [29]. We can observe that chelation assay had a significant effect on the LaFeH gene expression. This result showed that ferritin H gene declined gradually. Andersen [30] observed that the iron levels of the developing brown trout embryo and the yolk-sac larvae did not seem to be influenced by ambient iron. Hence, the mechanism for iron transport is apparently established at the time of hatching, but the iron storage capacity of ferritin may be too low in order to protect the developing fish against iron exposure. In conclusion, we have obtained the sequence for the yellow snapper ferritin H gene which is constitutively and widely distributed in their tissues and early developmental stages. Moreover, the results of the present study clearly demonstrate that iron bioavailability in water significantly affected the LaFeH gene expression of larvae yellow snapper. However, in order to investigate the function of yellow snapper ferritin, it is necessary to carry out further analysis of other related subunits important in forming

M. Reyes-Becerril et al. / Fish & Shellfish Immunology 37 (2014) 248e255

the complete protein, which will direct in identification of its dynamic roles in yellow snapper physiology and immunity. Furthermore, future studies will be performed to understand the role in the immune system response following pathogens challenges. Acknowledgments The larvae yellow snapper Lutjanus argentiventris used in this study was generously provided by Dr. Juan Carlos Perez Urbiola. The authors would like to thank Ms Julio Antonio Hernandez Gonzalez for helpful in RACE technique and Baudilio Acosta and Griselda Peña for helpful with the Atomic Absorption Spectrometer analysis. The project was funded under SEP-CONACYT grant CB-2010/ 155381. References [1] Westernhagen HV. Sublethal effects of pollutants on fish eggs and larvae. part A. In: Hoar WS, Randall DJ, editors. Fish physiologyvol. XI. New York: Academic Press; 1988. pp. 177e252. [2] Vadstein O, Bergh Ø, Gatesoupe FJ, Galindo-Villegas J, Mulero V, Picchietti S, et al. Microbiology and immunology of fish larvae. Rev Aquacult 2013;5:S1e 25. [3] Ong S, Ho J, Ho B, Ding J. Iron-withholding strategy in innate immunity. Immunobiology 2006;211:295e314. [4] Weinberg E, Miklossy J. Iron withholding: a defense against disease. J Alzheimers Dis 2008;13:451e63. [5] Bullen JJ. The significance of iron in infection. Clin Infect Dis 1981;3:1127e38. [6] Magariños B, Romalde JL, Lemos M, Barja JL, Toranzo AE. Iron uptake by Pasteurella piscicida and its role in pathogenicity for fish. Appl Environ Microbiol 1994;60:2990e8. [7] Otto BR, Verweij-Van Vught AMJJ, Maclareus DM. Transferrins and hemecompounds as iron sources for pathogenic bacteria. Crit Rev Microbiol 1992;18:217e33. [8] Kong P, Wang L, Zhang H, Zhou Z, Qiu L, Gai Y, et al. Two novel secreted ferritins involved in immune defense of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2010;28:604e12. [9] Zhang X, Wei W, Wu H, Xu H, Chang K, Zhang Y. Gene cloning and characterization of ferritin H and M subunitsn from large yellow croaker (Pseudosciaena crocea). Fish Shellfish Immunol 2010;28:735e42. [10] Orino K, Eguchi K, Nakayama T, Yamamoto S, Watanabe K. Sequencing of cDNA clones that encode bovine ferritin H and L chains. Comparative Biochem Physiol Part B. Biochem Mol Biol 1997;118:667e73. [11] Rucker P, Torti FM, Torti SV. Role of H and L subunits in mouse ferritin. J Biol Chem 1996;271:33352e7. [12] Torti FM, Torti SV. Regulation of ferritin genes and protein. Am Soc Hematol 2002;99:3505e16. [13] Zheng W-j, Hu Y-h, Sun L. Identification and analysis of a Scophthalmus maximus ferritin that is regulated at transcription level by oxidative stress and

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24] [25] [26] [27]

[28] [29]

[30]

255

bacterial infection. Comp Biochem Physiol Part B Biochem Mol Biol 2010;156: 222e8. Wu C, Zhang W, Mai K, Xu W, Wang X, Ma H, et al. Transcriptional upregulation of a novel ferritin homolog in abalone Haliotis discus hannai Ino by dietary iron. Comp Biochem Physiol Part C Toxicol Pharmacol 2010;152:424e 32. Recalcati S, Invernizzi P, Arosio P, Cairo G. New functions for an iron storage protein: the role of ferritin in immunity and autoimmunity. J Autoimmun 2008;30:84e9. Gupta R, Shah P, Swiatlo E. Differential gene expression in Streptococcus pneumoniae in response to various iron sources. Microb Pathog 2009;47:101e 9. Geay F, Darias MJ, Santigosa E, Desbruyeres E, Quazuguel P, ZamboninoInfante JL, et al. Cloning of endothelin-1 (ET-1) from European sea bass (Dicentrarchus labrax) and its gene expression analysis in larvae with retinoic acid-induced malformations. Aquaculture 2009;287:169e73. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001;25: 402e8. Scudiero R, Esposito MG, Trinchella F. Middle ferritin genes from the icefish Chionodraco rastrospinosus: comparative analysis and evolution of fish ferritins. Comptes Rendus Biol 2013;336:134e41. Bou-Abdallah F, Papaefthymiou GC, Scheswohl DM, Stanga SD, Arosio P, Chasteen ND. mu-1, 2-Peroxobridged di-iron (III) dimer formation in human H-chain ferritin. J Biochem 2002;364:57e63. Chávez-Mardones J, Valenzuela MV, Núñez AG, Maldonado AW, Gallardo EC. Concholepas concholepas Ferritin H-like subunit (CcFer): molecular characterization and single nucleotide polymorphism associated to innate immune response. Fish Shellfish Immunol 2013;35:910e7. Andersen O, Pantopoulos K, Kao HT, Muckenthaler M, Youson JH, Pieribone V. Regulation of iron metabolism in the sanguivore lamprey Lampetra fluviatilis. Molecular cloning of two ferritin subunits and two iron-regulatory proteins (IRP) reveals evolutionary conservation of the iron-regulatory element (IRE)/ IRP regulatory system. Eur J Biochem 1998;254:223e9. Harrison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1996;1275:161e 203. Arosio P, Ingrassia R, Cavadini P. Ferritins: a family of molecules for iron storage, antioxidation and more. Biochim Biophys Acta 2009;1790:589e99. Hentze MW, Muckenthaler MU, Andrews NC. Balancing acts: molecular control of mammalian iron metabolism. Cell 2004;117:285e97. Liu X, Theil EC. Ferritins: dynamic management of biological iron and oxygen chemistry. Acc Chem Res 2005;123:3863e71. Georgieva T, Dunkov BC, Dimov S, Ralchev K, Law JH. Drosophila melanogaster ferritin: cDNA encoding a light chain homologue, temporal and tissue specific expression of both subunit types. Insect Biochem Mol Biol 2002;32:295e302. Geiser DL, Zhang D, Winzerling JJ. Secreted ferritin: mosquito defense against iron overload? Insect Biochem Mol Biol 2006;36:177e87. Steinhauser S, Heinz U, Bartholomä M, Weyhermüller T, Nick H, Hegetschweiler K. Complex formation of ICL670 and related ligands with FeIII and FeII. Eur J Inorg Chem; 2004:4177e92. Andersen O. Accumulation of waterborne iron and expression of ferritin and transferrin in early developmental stages of brown trout (Salmo trutta). Fish Physiol Biochem 1997;16:223e31.