Cloning and transcription factor-binding sites of the human c-rel proto-oncogene promoter

Gene, 170 (1996) 271-276 © 1996 Elsevier Science B.V. All rights reserved. 0378-1119/96/$15.00

271

GENE 09476

Cloning and transcription factor-binding sites of the human c-rel proto-oncogene promoter (DNA sequencing; functional analysis; DNase I footprinting; NF-KB; Ap2; Spl)

M a n i c k a m V i s w a n a t h a n * ' * * , M i n Yu*, L e o b a r d o M e n d o z a * a n d J o r g e J. Y u n i s Cancer Biology Division, Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA 19107-6799, USA

Receivedby J.W. Messing:14 June 1995;Revised/Accepted:28 August/7September 1995;Receivedat publishers:23 October 1995

SUMMARY We report here the cloning, sequencing, functional analysis and DNase I footprinting of the human c-tel promoter region. The results revealed an 824-bp B s a A I - S t u I minimal promoter region with a large number of NF-KB, Ap2 and Spl-binding sites, some of them variants of known consensus sequences. This is the first promoter in the Rel/NF-~:B/I~:B family to be subjected to a detailed footprinting analysis for the binding of transcription activator proteins. Our finding of 14 Ap2-binding sites may indicate why the human c-rel promoter, unlike the chicken c-rel promoter, has a strong function and is highly responsive to phorbol esters. The presence of five NF-~:B and six Spl-binding sites in turn adds to growing evidence that, in mammals, the promoter of the Rel/NF-KB/IKB family may utilize multiple NF-KB- and Spl-binding sites for their interactive regulation. Furthermore, there are putative binding sites for the PU.1 and Oct 1/2 transcription activator proteins, also present in the mouse c-rel promoter, which may help explain the preferential transcription of the c-tel gene in B- and T-lymphoid cells.

INTRODUCTION c-Rel is a proto-oncogene that belongs to the growing family of transcription factor-binding proteins known as Rel/NF-nB. This class includes v-Rel, the oncogene of the retrovirus Rev-T (reticuloendotheliosis virus strain T) that causes lymphoma in birds, of which c-Rel is the cellular homologue. Other members of this family are Correspondence to: Dr. J.J. Yunis,Room 224, Cancer BiologyDivision, Department of Pathology, Anatomy and Cell Biology, Thomas JeffersonUniversity,1020 Locust Street, Philadelphia,PA 19107-6799, USA. Tel. (1-215) 955-1770; Fax (I-215) 923-0441. *These authors made equal contributionsto this paper. **Present address: Enzon, Inc., 20 Kingsbridge Road, Piscataway, NJ 08854, USA. Tel. (1-908) 980-4757.

Abbreviations:bp, base pair(s); ds, double strand; I~B, inhibitor of NF-KB;kb, kilobase(s)or 1000bp; xB, NF-KB-bindingsite; LTR, long terminal repeat(s); Luc, luciferase;NF-KB,nuclear factor kappa B; nt, nucleotide(s);Oct 1/2, octamer-bindingprotein 1/2;oligo,oligodeoxyribonucleotide; PU.1, purine box binding protein 1; re-, recombinant; Rel, oncogen protein of the reticuloendotheliosisvirus strain T; RSV, Rous sarcoma virus; TPA, 12-O-tetradecanoylphorbol-13-acetate;tsp, transcription start point(s). SSDI 0378-1119(95)00773-3

NF-•B1 or p50, NF-~:B2 or Lyt-10, Rel A or p65, Rel B, Dorsal and X-Rel 1 (reviewed by Kabrun and Enrietto, 1994). In our laboratory, it was found that the c-rel gene is amplified in follicular cell lymphomas, and a c-rel fusion gene was isolated from a RC-K8 cell line derived from a pre-B diffuse large cell lymphoma (Lu et al., 1991). Since this first observation associating human c-rel and lymphoma, several observations from other laboratories have been made linking members of Rel/NF-KB family and lymphoma in human (Neri et al., 1991) and mouse tumors (Perez et al., 1994). Growing evidence suggests that members of the Rel/NF-KB gene family are preferentially transcribed in lymphoid cells (Lu et al., 1991; Carrasco et al., 1994) and can self-regulate and inter-regulate themselves through transcription factor binding sites present in their promoters (Ten et al., 1992; Cogswell et al., 1993; Grumont et al., 1993; Cheng et al., 1994). To learn about the structure and regulation of the human c-rel proto-oncogene, we cloned the human c-tel promoter and DNase I footprinting showed numerous binding sites for the transcription factors NF-~:B, Ap2 and Spl. It has been recently observed

272 RC-K8 cell line was screened using as a probe a pBrel-9 c-rel eDNA clone, that contains exons 0 and 1 to 5 (Lu et al., 1991). Three positive re-clones were isolated and one of them, a 17-kb Sall fragment, was confirmed to contain the first exon (exon 0) of the human c-rel gene by rehybridization with a 32p-labeled exon-0-specific oligo synthesized from the nt sequence immediately upstream from the ATG start codon (Olirel oligo, 5'-AAGGTGCGGGGAGCGGAGCC). This 17-kb clone (Fig. 1A) was characterized by restriction mapping, and a Sail-Sad (2.37 kb) DNA sub-fragment was then subcloned into a pT7T3 19U vector and sequenced (GenBank accession No. L41414), using an automated facility with the cycle sequencing technique (Applied Biosystems model 373). The 2.37-kb sequence was compared to sequences in the GenBank by the FASTA program available in the GCG package (Genetics Computer Group, 1994) and a smaller 951-bp BsaAI-NcoI downstream fragment was found to exhibit maximum homology with the mouse c-rel promoter region, having an overall 60% identity, including >85% identity in the highly conserved regions denoted in bold in Fig. lB.

that members of the Rel/NF-~:B gene family regulate their own promoter and are rich in NF-zB binding sites or ~B sites (Grumont et al., 1993; Cheng et al., 1994). In this work we have found that the human c-rel promoter contains five rB sites. These findings together suggest that the promoter region of genes of the NF-~B/Rel/IzB family may have as a unique feature, a high number of NF-~Bbinding sites that could assist in their self and inter family regulation. We have also found that the human c-tel promoter is intensely responsive to TPA and has a large number of Ap2-binding sites. These are important targets for TPA signals (for review, see Faisst and Meyer, 1992). In addition, we tested for Spl sites because c-rel and v-rel proteins interact with Spl (Sif and Gilmore, 1994), raising the possibility that c-Rel may regulate other genes and be autoregulated through Spl-binding sites.

EXPERIMENTAL AND DISCUSSION

(a) Cloning and sequencing of the h u m a n c-rel promoter

To clone the promoter, a human genomic library from A.

Sa

F

B

Hf

t

I

I

I

•

s

S~ NcjSpH f I

I

•

R

K

I

I

Sa

/j

~

I

| 500kf, |

js s

B

•

HfNa

l

T

II

l

SII

Sm

St

Nc "~l

I

I

I

IT

t

,'*~,

B.

B TAAAGT TCACAGTAC C C TCGCAATT T A G A ~ T C A G

TCG G G ~ ~ F E A T ~ . A / M k T A C A G G A A T T A C A G A A G A A G A C A G G A C C C

PU • 1

CCGCC GCAGCAC CAC TT 1514

UCt-l/2 -Ke,~ ~

H

CCCCCTACAGGGCGC~CGTCCCGCCGCT~IC~C~B~O~~COTO£-t~--%~-TC~p

C'£~O~uMukCCCCG~TCGTCGCCCTCCCAG~C~

Na

-3 9 4

~B~

KB4

GTCGGCCCCGCGCGCCCCCAAAAGCTCCCCAGCGGCAGCCCTCTCTaCGt CATCCGCACCCTCCCGC.CCGCTCCT G A A C T T T A A A C C A C A C T C ( ~ t A G A A C a a C ~ ~ 1

Nh ,I,

2

1

-274

T,

~1,

TT~T(~M~%~cCA~c~cCTTcTCAc~GCT~GCCGTCACCTCC~GGCTCCCGCCGTTCCCTGCGCTCCCGAAGCCCACCC~AAGCTCCCGCT~CC~CGACCCCCTCCCAAGCCAGCCG

- 15 4

CCGCAGCAGCGCCGGGGGCGTATGCGTGGGGGCCGGC~GCGTGCGCGGGACAGGCAG~.. C~..C~.o. C ~ C G C T G G G C ~ . . . G G T C G C g C ~ ~ C G C g A ~ t C ~ C C ~ C ~ C ~ C T

-34

Tsp,

3~ I Kss

"

4

CCGGGtG~GGGT~CTGCGTCGGGCCTACG~A~CC~t~OCTCCCGCCAGGCTGCZCCGCt 8 .~ 9 ,o T

C

C

C

G

T

~

C

~

C

~

C

~

C

~

T

~

T

~

=

~

=

~

~

=

=

,,

s

e

,v

""~.......

CZCGGCTGGGC~¢ACTCg~ccceG~c~ccccT~CCCT~ 11 ,2 ~ .~ 13 ~

~

-

-

~

C

~

C

~

~

~

Z

~

86 ,4

m

206 Nc

~T~a~GCC

C C g C C g ~ % ~ % ~ C C C ~ C T C C T ( M t ~ 2 ~ m - - - E TGAC TGCGGC C GC CTC CGGC CAGGACGC TGGGAGC TGCC T G C G G G R A ~ T ~

~

3 21 t~c-rel

protein

Fig. 1. Cloning and sequencing of the human c-rel promoter. (A) Restriction map of the cloned 17-kb c-tel gcnomic DNA. The enlarged 951-bp BsaAI-Sac I fragment contains the first exon of c-rel (Exon - 1, exon 0, marked with a black box), the ATG start codon at the NcoI (Nc) site and tsp near the SacII. B, BseAI; F, FspI; H, Hinfl; K, Kpn I; Na, NaeI; Nc, NcoI; Nh, NheI; SI, SacI; SII, SacII; Sa, SalI; Sm, Sinai; St, StuI; T, TaqI. (B) 951-bp BsaAI-NcoI sequence upstream from the human c-rel gene, including the promoter region and exon - 1 (+ 1 to 327 bp), including tsp (Tsp, + 1 bp) and the ATG start codon of the c-rel protein. Based on footprint analysis, the human c-rel promoter has five KB sites, boxed as KB1, ~cB2, ~cB3, KB4 and xB5, 14 Ap2-binding sites underlined with thick lines and numbered 1-14 and six Spl-binding sites underlined with broken lines and numbered I-VI. Lower-case letters in ~cB3 and in several Ap2-binding sites indicate differences from known consensus sequences. A putative PU.1 site (-601 to - 5 9 6 bp) and an Oct 1/2 site ( - 5 6 6 to - 5 6 0 bp) were also found in the 5' region. Highly conserved segments between mouse and human (>85% identity) arc shown in bold letters.

273

(b) Functional assay of the e-tel promoter To map tsp in exon - 1 , we utilized poly(A)÷mRNA from the Daudi B-cell line for primer extension, making use of the aforementioned Olirel oligo. A tsp was found 319 bp upstream from the ATG start codon, as illustrated in Fig. 1 (mapping data not shown). To demonstrate that the cloned genomic sequences near and upstream from the start codon contain all the rel promoter sequences, we selected three subfragments of the 2.37-kb SalI-SacI genomic sequence, using the StuI (+ 191 bp) restriction enzyme site rather than the NcoI site (+ 318 bp) as the 3' end point. These fragments were chosen to eliminate the region adjacent to the start codon (Fig. 1) interfering with the transfection assays. Thus, tested subfragments consisted of a 2.1-kb SalI-StuI DNA fragment, as well as the smaller 1.3-kb FspI-StuI and 824-bp BsaAI-StuI fragments (Fig. 1A), which were subcloned in a pGL2-Basic vector (Promega, WI, USA). These 2.1-, 1.3-kb and 824-bp fragments were analyzed on a transient transfection Luc assay, using Jurkat T-cells and RC-K8 B-cells as recipients (Lu et al., 1991). Fig. 2 shows that the three fragments yielded comparable Luc activity. Thus, the smaller 824-bp BsaAIStuI fragment was considered to contain maximun c-rel promoter activity. In addition, Jurkat cells after 8 h TPA stimulation and Jurkat cells after 24 h without TPA stimulation yielded the strongest activity. In turn, such activity was higher than that found when using the strong SV40 promoter-enhancer as a positive control. RC-K8 cells yielded a more moderate activity (Fig. 2). A deletional analysis of the 824-bp BsaAI-StuI minimal promoter fragment was also carried out. This revealed that the smaller - 1 3 3 to +191-bp TaqI-StuI and - 6 to +191-bp Sac II-StuI subfragments (Fig. 1) displayed little if any functional activity (data not shown).

(c) Footprint analysis of transcription factors-binding sites Computer analysis of the 824-bp BsaAI-StuI minimum promoter region revealed a high G C content (69.3%) and absence of TATA and CCAAT boxes, as previously found in the chicken (Capobianco and Gilmore, 1991) and mouse (Grumont et al., 1993) c-tel promoters. Unlike the chicken c-tel promoter, which was reported to have one xB, Spl- and Ap2-binding site each and a weak function, the human c-rel promoter showed a large number of putative binding sites (Signalscan program; Prestige, 1991) that helps explain why it is a strong promoter and highly responsive to TPA (Fig. 2). To confirm the presence of xB, Ap2- and Spl-binding sites, a detailed footprint analysis was carried out. To facilitate such a study, the 824-bp BsaAI-StuI DNA fragment was cleaved into smaller and some partially overlapping fragments, which in a 5' to 3' direction are as follows: BsaAI-NaeI (277 bp), Hinfl-TaqI (219 bp), TaqI-SmaI (295 bp) and SmaI-StuI

10

A

B

C 4

2 3 -

8

3

A

26

m

4 m

1

¢J -I

m

4

234

i

8

_

24

i

24 hours

Fig. 2. Luc activity (Fulton and Van Ness, 1993)of Jurkat and RC-K8 cells transfected with 9.8 nM of supercoiled DNA/10× 106 cells by electroporationat 320 V and 960 IxF (Lu et al., 1991). Columns under B and C representthe results of unstimulated Jurkat (B) and RC-K8 cells (C) 24 h after transfection. Panel A represents the results of transfectedJurkat cells exposedto 3 x i0 -s M TPA and tested 8 h after stimulation. Columns 2 to 4 under A-C represent Luc levelsusing the pGL2-Basic vector (Promega) to which we have inserted either the 824-bp BsaAI-StuI (2), the 1.3-kb FspI-StuI (3), or 2.1-kb SalI-StuI DNA segment (4) of the c-rel promoter region. Column 1 is a pGL2-Control vector that contains the SV40 promoter and enhancer (Promega). The results in each column represent the average of Luc activity of four differentexperiments.The end points of 8 h after TPA stimulation and 24 h without TPA stimulation, shown in this figure, yielded higher activitythan when other time end points were used. For example, samples tested at 8 h, without TPA, showed minimal activity (data not shown). (71 bp) (Fig. 1). These fragments were cloned into the pBluescript or pGL2 vectors and subsequently the DNA was end-labeled using polynucleotide kinase and [y-32p]ATP and digested with an end-specific restriction enzyme, to remove the label from one of the ends. The 32p-label was present at the NaeI end in case of BsaAINaeI, at the TaqI end in the case Hinfl-TaqI, at the SmaI end in the case of TaqI-SmaI and at the Sinai end in the case of SmaI-StuI (Fig. 1). DNase I footprinting with NF-KB, Ap2 and Spl was carried out at 4°C, following the protocol suggested by Promega (Madison, Wl, USA), unless indicated otherwise in the figure legends. The footprinted regions found are bracketed in Figs. 3 and 4. Using a purified human NF-KB p50 protein, footprinting analysis of the above-mentioned fragments of the BsaAI-StuI DNA segment revealed five xB sites. Of

274 the five xB consensus sites found and marked as KB1 to xB5 in Figs. 1B and 3, xB1 (-578 to - 5 7 0 b p ) , xB2 (-442 to - 4 3 3 bp) and xB4 ( - 2 7 8 to - 2 6 9 bp) are identical to three of the four xB sites described in the mouse c-tel promoter (Grumont et al., 1993) (Fig. 1B). Two of the mouse xB motifs, those identical to KB2 and xB4 motifs in the human c-rel promoter, were found to be required for promoter activity in murine B cells (Grumont et al., 1993). On the other hand, the ~cB5 (+6 to + 15 bp) site is identical to a single xB site described in the chicken c-rel promoter (Capobianco and Gilmore, 1991) and also found in the promoter region of the 13-interferon-encoding gene (Lenardo et al., 1989). The remaining xB site, namely ~B3 ( - 2 9 8 to - 2 8 9 bp) has

two nt differences (underlined) from a known NF-~zB motif (GAAGAACAAC vs. GAAGAACCCC). Because the p50 NF-~:B purified re-protein (Promega) used in our footprinting assay was over-expressed in E. coli, and may contain E. coli protein impurities that could potentially bind to DNA, we developed a competition assay in which a 100-fold excess of a d s 22-mer N F - x B consensus DNA sequence (5'-AGTTGAGGGGACTTTCCCAGGC for the sense-strand; Promega) was used as a specific competitor to prevent NF-~:B protein binding to putative xB sites in the tel promoter sequence. Fig. 3C,D show that any possible E. coli protein impurity did not bind to the tel promoter, while there was NF-KB p50 protein binding when a ds 22-mer AP2 consensus DNA sequence

NF-K:B I

NF-~B ~'

o.) ~ (

'-~ + 2 ~ ~

~ +

NF-I
--

+ '

~

G

o

o

, - -"

~

G

I

-

+

-

+

+

NF-KB I-

r - - I + -+ +

(,.)

118

~B1

100

82

66 123

A

~B2

D NF-~:Boligo Ap2oligo

+

+

- -

-

-

+

-

1234 Fig. 3. DNase I footprinting of five xB motifs. (A) Illustration of NF-•B p50 protein protection of the xB5 motif found in the NaeI-SmaI ( - 120 to + 120bp) DNA fragment of the c-rel promoter (Fig. 1). Lanes 2 and 3 are DNA digested in the absence and presence of NF-KB p50 protein, respectively. (B and C) Results of titration of NF-~B p50 protein (B) and oligo competition footprinting assay (C) performed to show the specificity of NF-KB-binding to the xB3 and xB4 motifs in the HinfI-TaqI ( - 3 9 4 to - 1 7 7 bp) DNA fragment. Lane 3 represents the DNA digested in the absence of p50 protein, whereas lanes 4 and 5 represent DNA digested in the presence of 0.64 Ixg and 1.29 ~tg of protein, respectively. In C, lanes 3 and 4 contain DNA digested in the absence or presence of p50 protein (0.64 ~tg), respectively. Lane 5, DNA mixed with 17.5 pmol ds 22-mer NF-xB consensus DNA sequence to serve as control. In lane 6, DNA was mixed with NF-xB consensus oligo, then mixed with p50 protein and digested. As a negative non-specific competitor, lane 7 shows the results of DNA mixed with 17.5 pmol of a d s 22-mer Ap2 consensus DNA sequence prior to p50 addition and digestion. In B and C, lane 2 is A + G-specific reaction (Sambrook et al., 1989) and in A to C, lane 1 is a ~bX174 DNA/HinfI marker. (D) Specificity of NF-KB p50-binding to the -KB1 and - K B 2 motifs located in the BsaAI-NaeI (-633 to - 3 5 8 bp) DNA fragment. Competition footprinting assay was performed using the p50 protein and the competitor oligo. In lanes 1 and 2, DNA was mixed with 17.5 pmol of the NF-KB consensus oligo and then digested in the absence and presence of 0.67 pg of p50, respectively. In lane 3, DNA was mixed with 17.5 pmol of Ap2 consensus oligo followed by addition of p50. Lane 4 represents a C + T-specific reaction carried out as described under the 'quick' method (Sambrook et al., 1989).

275 (5'-G A T C G A A C T G A C CGCCCGCGGCCCGT for the sense-strand; Promega) was used as non-specific competitor. ap2 footprinting analysis of the c-tel promoter revealed 14 Ap2-binding sites, indicated with thick lines in Fig. 1B and numbered 1-15 in Figs. 1B and 4A,B. Nine of the 14 sites, numbered as Ap2 1, 3-5, 8, 10, 11, 13-15 (-389 to - 3 8 2 b p ; -121 to - 1 1 4 b p ; - 8 6 to - 7 7 b p ; - 4 6 to - 3 6 bp; +2 to + 9 b p ; +14 to +21bp; +40 to +47bp; +74 to +81 bp; and +80 to +87 bp), are known consensus sequence motifs. Of the five remaining motifs, four are variants with one nt difference, indicated in lower case letters (Ap2 sites numbered 6,7,9,12 and located at - 7 3 to - 6 4 b p ; - 5 7 to - 4 8 bp; - 3 1 to - 2 2 bp; and +34 to +43 bp, respectively) and one motif has two base differences (Ap2 site No. 2 at - 347 to - 338 bp). We used recombinant, affinity purified pure human Ap2 protein (Promega) which was found to bind to all the computer

$ Ap2 A + ~ _,~----~, G

predicted motifs, as well as the five variant Ap2 motifs. Such binding was not affected by changes in Ap2 protein, DNase I or KC1 concentration (data not shown). The presence of a large number of Ap2-binding sites in the human c-rel promoter helps explain why human c-tel is readily inducible by TPA (Wang et al., 1993). This contrasts with the chicken c-tel promoter which has only one Ap2-binding site and is poorly responsive to TPA (Capobianco and Gilmore, 1991). Additional footprinting of the c-rel promoter, using recombinant affinity purified human Spl re-protein (Promega), indicated the presence of six Sp 1-binding sites (-449 to - 4 4 4 b p ; - 9 4 to - 8 5 bp; - 7 9 to - 7 4 b p ; - 4 6 to - 4 1 b p ; - 4 2 to - 3 3 bp; and +70 to +77 bp) (Figs. 1B and 4C,D) which are shown in broken lines in Fig. 1B and numbered I-VI in Figs. 1B and 4C,D. A seventh computer-predicted Spl-binding motif (CCCGCC, located from + 19 to + 24 bp) did not bind

Spl

$ Ap2 ... :~. ~+-

A+

~ spl c 4. .+ +TC

r-

il lit

200

IV V

9 10

151

2 3

140

C

11 12

118

Vl

13 14

100

A

B 1 2

34

1 23

[ 12345

Fig. 4. DNase I footprinting of Ap2 (A and B) and Spl-binding sites (C and D). Ap2-binding sites are illustrated on (A) Hinfl-TaqI (-394 to -- 176 bp) fragment; (ll) TaqI-SmaI (-175 to + 120 bp) fragment. 30 ng of c-tel promoter DNA fragment (0.75 x 106 cpm) was incubated with 60 ng of the affinity purified human Ap2 protein and footprinted. Lane 1 on A and B, ~bX174 DNA/Hinfl marker. Lanes 2 and 3 in A, DNA digested in the absence or presence of Ap2 protein, respectively, whereas in B they represent DNA digested in the presence or absence of Ap2 protein, respectively. Lane 4 in A is A + G marker. Ap2-binding sites were numbered 1 to 14. Spl-binding sites are illustrated on C: HinfI-TaqI and D: TaqI-SmaI DNA fragments. DNA (1.12 x 106 cpm) was interacted with 0.45 pg of affinity purified human Spl protein and footprinted. For C, lanes 1 and 2 are DNA digested in the absence or presence of Spl protein, respectively. Lane 3 is an A + G-specific cleavage reaction. For D, lanes 2 and 3 are DNA digestod in the absence or presence of Spl protein, respectively. Lanes 4 and 5 are C + T- and C-specific cleavage reactions. Lane 1 is ~bX174 DNA/Hinfl DNA marker. Spl-binding sites are numbered I to VI.

276 to Spl under the conditions tested. It is of interest to note that five of the six Spl-binding sites, found by footprinting, overlap with Ap2 sites (Fig. 1B) and such an overlap is believed to facilitate the productive interaction between Spl and Ap2 (Descheemaeker et al., 1992). In addition to the xB, Ap2 and Spl-binding sites determined by footprinting, we found by computer search the presence of a PU.1 box (GAGGAA, -601 to - 5 9 6 bp) and Oct 1/2 site (ATGCAAAT, - 5 6 6 to - 5 5 9 bp), not only in the human c-rel promoter but also the mouse c-rel promoter (Grumont et al., 1993) and the promoter region of the human NF-~cB p50/p105 encoding gene (Cogswell et al., 1993). Interestingly, the PU.1 box and Oct 1/2 sites are preferentially active in T- and B-lymphocytes and macrophages and their presence may help explain why human c-rel is preferentially transcribed in lymphoid cells.

(d) Conclusions (1) We have determined the sequence of a 2.37-kb genomic DNA fragment containing the human c-rel promoter and other regulatory elements (GenBank accession No. L41414) and report here the sequence of a 951-bp BsaAINcoI fragment upstream from the ATG start codon. (2) Comparison of the 951-bp DNA sequence against the sequences available in GenBank, showed maximum homology between the human and mouse (accession No. X70690) c-rel promoter region. (3) Transfection analysis revealed a 824-bp BsaAI- StuI subfragment of the 951-bp BsaAI -NcoI sequence as the minimal promoter region. (4) Footprinting of the minimal promoter fragment revealed the presence of five xB, 14 Ap2 and six Spl-binding sites. Computer analysis of this fragment also showed a putative PU.1 and an Oct 1/2 site sequences, which might be involved in c-rel expression in lymphoid cells.

ACKNOWLEDGEMENTS

This research was supported by grant CA 33314 from the National Cancer Institute. The editorial assistance of Dr. Malvina T. Yunis is gratefully acknowledged.

REFERENCES Baeuerle, P.A.: The inducible transcription activator NF-KB: regulation by distinct protein subunits. Biochem. Biophys. Acta 1072 (1991) 63-80. Capobianco, A.J. and Gilmore, T.D.: Repression of the chicken c-rel promoter by v-Rel in chicken embryo fibroblasts is not mediated through a consensus NF-KB-binding site. Oncogene 6 (1991) 2203-2210.

Carrasco, D., Weih, F. and Bravo, R.: Developmental expression of the mouse c-rel proto-oncogene in hematopoietic organs. Development 120 (1994) 2991-3004. Cheng, Q., Cant, C.A., Moll, T., Hofer-Warbinek, R., Wagner, E., Birnstiel, M.L., Bach, F.H. and de Martin, R.: NF-KB subunitspecific regulation of the IKBa promoter. J. Biol. Chem. 269 (1994) 13551-13557. Cogswell, P.C., Scheinman, R.I., and Baldwin, A.S. Jr.: Promoter of the human NF-~Bp50/pl05 gene. Regulation by NF-KB subunits and by c-REL. J. Immunol. 150 (1993) 2794-2804. Descheemaeker, K.A., Wyns, S., Nelles, L., Auwerx, J., Ny, T. and Collen, D.: Interaction of AP-I-, AP-2-, and Spl-like proteins with two distinct sites in the upstream regulatory region of the plasminogen activator inhibitor-1 gene mediates the phorbol 12-myristate 13-acetate response. J. Biol. Chem. 267 (1992) 15086-15091. Faisst, S. and Meyer, S.: Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res. 20 (1992) 3-26. Fulton, R. and Van Ness, B.: Luminescent reporter gene assays for luciferase and [3-galactonidase using a liquid scintillation counter. Biotechniques 14 (1993) 762-763. Genetics Computer Group: Program Manual for the Wisconsin Package, Version 8. 575 Science Drive, Madison, WI 53711, USA, 1994. Grumont, R.J., Richardson, I.B., Gaff, C. and Gerondakis, S.: rel/NF-KB nuclear complexes that bind KB sites in the murine c-rel promoter are required for constitutive c-tel transcription in B-cells. Cell Growth Diff. 4 (1993) 731-743. Kabrun, N. and Enrietto P.J.: The Rel family of proteins in oncogenesis and differentiantion. Semin. Cancer Biol. 5(1994) 103 112. Lenardo, M.J., Fan, C.-M., Maniatis, T. and Baltimore, D.: The involvement of NF-~B in [3-interferongene regulation reveals its role as widely inducible mediator of signal transduction. Cell 57 (1989) 287-294. Lu, D., Thompson, J.D., Gorski, G.K., Rice, N.R., Mayer, M.G. and Yunis, J.J.: Alterations at the rel locus in human lymphoma. Oncogene 6 (1991) 1235-1241. Neff, A., Chang, C.C., Lombardi, L., Salina, M., Corradini, P., Maiolo, A.T., Chaganti, R.S. and Dalla-Favera, R.: B cell lymphomaassociated chromosomal translocation involves candidate oncogene lyt-lO, homologous to NF-KB p50. Cell 67 (1991) 1075-1087. Perez, J.R., Higgins-Sochaski, K.A., Maltese, J.-Y. and Narayanan, R.: Regulation of adhesion and growth fibrosarcoma cells by NF-~cB Rel A involves transforming growth factor 13. Mol. Cell. Biol. 14 (1994) 5326-5332. Prestidge, D.S: A computer program that scans DNA sequences for eukaryotic transcriptional elements. Comput. Appl. Biosci. 7 ( 1991 ) 203-206. Ruben, S.M., Dhillon, P.J., Schreck, R., Henkel, T., Chan, C.H., Maher, M., Baeuerle, P.A. and Rosen, C.A.: Isolation of rel-related human cDNA that potentially encodes the 65 kDa subunit of NF-kappa B. Science 251 (1991) 1490-1493. Ryseck, R.P., Bull, P., Takamiya, M., Bours, V., Siebenlist, U., Dobrzanski, P. and Bravo, R.: Rel B, a new tel family transcription activator that can interact with p50-NF-kappa B. Mol. Cell. Biol. 12 (1992) 674-684. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Sif, S. and Gilmore, T.D.: Interaction of the v-Rel oncoprotein with cellular transcription factor Spl. J. Virol. 68 (1994) 7131-7138. Ten, R.M., Paya, C.V., Israel, N., Bail, O.L., Mattei, M-G., Virelizier, J.-L., Kourilsky and Israel, A.: The characterization of the promoter of the gene encoding the p50 subunit of NF-rB indicates that it participates in its own regulation. EMBO J. 11 (1992) 195-203. Wang, Y.K., Liao, P.-C., Allison, J., Gage, D.A., Andrews, P.C., Lubman, D.M., Hanash, S.M. and Strahler, J.R.: Phorbol 12-myristate 13-acetate-induced phosphorylation of Op18 in Jurkat T cells. Identification of phosphorylation sites by matffx-associated laser desorption ionization mass spectrometry. J. Biol. Chem. 268 (1993) 14269-14277.