Cloning, expression and functional analysis of PKR from grass carp (Ctenopharyngodon idellus)

Fish & Shellfish Immunology 35 (2013) 1874e1881

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Cloning, expression and functional analysis of PKR from grass carp (Ctenopharyngodon idellus) You-Sheng Hu a, b,1, Wen Li a,1, Dong-Ming Li c, Yong Liu a, Li-Hua Fan a, Ze-Chang Rao c, Gang Lin a, Cheng-Yu Hu a, * a b c

Department of Bioscience, College of Life Science and Food Engineering, Nanchang University, Nanchang 330031, China Medical College, Jinggangshan University, Ji’an 343009, China Fuzhou Medical College, Nanchang University, Fuzhou 344000, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 June 2013 Received in revised form 12 September 2013 Accepted 16 September 2013 Available online 29 September 2013

The interferon-induced, dsRNA-activated protein kinase (PKR) is considered as an important component of innate immune system and as a representative effector protein of interferon system. In the present study, PKR gene (CiPKR, JX511974) from grass carp (Ctenopharyngodon idellus) was isolated and identified using homology-based PCR. CiPKR shares high sequence identity with the counterparts of goldfish (Crucian carp) and zebrafish (Danio rerio). The full-length cDNA of CiPKR was found to be 2436 bp, with an ORF of 2067 bp that encodes a polypeptide of 688 amino acids. The deduced polypeptide CiPKR contains three tandem dsRNA-binding motifs (dsRBMs) at the N-terminus and a conserved Ser/Thr kinase domain at the C-terminus. CiPKR was expressed ubiquitously at a low-level under normal conditions, but it could be up-regulated after intraperitoneal (ip) injection with grass carp haemorrhagic virus (GCHV). CiPKR was dramatically up-regulated at 6 h post-injection and then recovered rapidly to normal levels within 24 h; however, it was obviously up-regulated once again at 48 h or 72 h post-injection. It seemed that CiPKR could respond to GCHV infection in an IFN-independent as well as an IFN-dependent pathway. To further investigate its mechanism of biological actions, we constructed a series of recombinant plasmids including pcDNA3.1/PKR-wt, pcDNA3.1/PKR-K430R, pcDNA3.1/PKR-C (deletion of dsRBD sequence) and pcDNA3.1/PKR-C-K430R, and then each recombinant plasmid was transfected into CIK cells. In comparison with those of controls, a 79% and a 64% decrease of luciferase activities were detected in the tested cells transfected with CiPKR and CiPKR-C, respectively; however, luciferase activities were increased in those cells transfected with PKR-K430R and PKR-C-K430R, with a 160% and 115% up-regulation, respectively. Similarly, MTT colorimetric assay indicated that cell viabilities of CIK cells transfected with pcDNA3.1/PKR-wt, pcDNA3.1/PKR-K430R, pcDNA3.1/PKR-C and pcDNA3.1/PKR-CK430R were 49%, 90%, 54% and 100%, respectively. Our observations suggested that the expression of CiPKR could be up-regulated following viral infection, and then resulted in the inhibition of protein synthesis and the induction of potential apoptosis. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: CiPKR dsRNA Antiviral activity Interferon Grass carp

1. Introduction The double-stranded RNA (dsRNA) dependent protein kinase (PKR), responded mainly to virus infection, belongs to the eukaryotic initiation factor 2a (eIF2a) kinases family [1e3]. The other members include the pancreatic endoplasmic reticulum kinase (PERK/PEK) activated by the stress that impairs protein folding in the endoplasmic reticulum, the heme-regulated inhibitor (HRI) * Corresponding author. Tel.: þ86 791 8831 7270; fax: þ86 791 8396 9530. E-mail addresses: [email protected], [email protected] (C.-Y. Hu). 1 These authors contributed equally to this work. 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.09.024

activated by heme depletion in reticulocytes, the general control nonderepressible-2 (GCN2) activated by amino acids starvation [2], and the recently identified protein kinase containing Z-DNA binding domain (PKZ or PKR-like) activated by Z-DNA [4,5]. PKR is an integral component of innate immunity system and an important effector of interferon system. The expression level of tissue-specific PKR is low under normal conditions, but it can be dramatically increased after virus induction [6]. In vivo, binding of viral dsRNA to the regulatory domains of PKR promotes dimerization and autophosphorylation at multiple serine and threonine residues [3], then phosphorylate eIF2a and lead to a general inhibition of global protein synthesis, thus hamper virus replication [2].

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

The first PKR gene was cloned and characterized in human cells [7]. Up to now, many PKRs from mice (AH006194.1), rat (DQ115394), canine (AY906960), rabbit (XM_002710637.1), bovine (NM_178109.3), equine (AY850106), pig (NM_214319.1) have been cloned and identified successively [8], and mammalian PKRs have been well-studied since then. The expression of PKR is implicated in translational regulation and signal transduction. For example, PKR is involved in phosphorylating p53 by which to control cell growth, proliferation, apoptosis and tumor suppressor in mammalian cells [9,10]. Many researches indicated that PKR also controlled the gene transcription through the IkB/NF-kB and MAPK/STAT pathways and induced potential cell apoptosis [11,12]. Some recent studies showed that PKR could participate in the modulation of inflammasome activity and in the regulation of inflammatory immune response [13,14]; therefore, it is an attractive target for clinical manipulation of inflammasome-associated diseases, such as genetic obesity, diabetes mellitus and other chronic metabolic diseases. In the past few years enormous progress has been made in fish interferon system. Several fish PKR genes were cloned and identified, including DrPKR (NM_199569) from Zebrafish (Danio rerio), PoPKR (EU118259) from flounder (Paralichthys olivaceus), CaPKR (JN091442) from goldfish (Carassius auratus), TrPKR (NM_001032752) from fugu (Takifugu rubripes), OfPKR (FJ179396) from rock bream (Oplegnathus fasciatus), GaPKR (Gasterosteus aculeatus) and TnPKR (Tetraodon nigroviridis). In comparison with mammalian PKR, the structure characteristics of fish PKR still remain controversial [15e18]. Analysis of PKR domains from vertebrates indicates that the kinase domain (KD) is more evolutionarily conserved than the dsRNA-binding domain (dsRBD) [19,20]. The numbers of dsRBMs in fish PKR are variable (from one to three), while mammalian PKRs have constant two dsRBMs at the N-terminal; however, a strongly conserved IFNinduced antiviral response pathway is shared by piscine PKR and mammalian PKR [16]. For this reason, mammalian PKR is considered to be evolved from a common ancestral gene of teleost PKR [12,18]. Accordingly, further investigation is needed to confirm whether fish PKR possesses similar antiviral activity to that of mammalian PKR. Grass carp (Ctenopharyngodon idellus) is one of the most important economical freshwater fish species in China/Asian countries. However, grass carp farming in China has suffered badly from grass carp hemorrhage, an epidemic and fatal disease caused by the Grass Carp Haemorrhagic Virus (GCHV). In this paper, grass carp PKR gene, CiPKR (JX511974), was cloned and identified. The cDNA of CiPKR is 2436 bp in length with an open reading frame (ORF) of 2067 bp which encodes a polypeptide of 688 aa. Phylogenetic analysis revealed a close genetic relationship among CiPKR, CaPKR and DrPKR. A low-level constitutive expression of CiPKR was detected in liver, spleen, kidney, intestine, gill and heart tissues, but it was significantly up-regulated upon GCHV challenge. Transient co-transfection in CIK cells showed that CiPKR could potentially inhibit protein synthesis and induce cell apoptosis. 2. Materials and methods 2.1. Fish, vectors and cell line Grass carp, about 20 g in body weight, were obtained from Fisheries Research Institute of Jiangxi Province, China. Fishes were cultured for 2 weeks in an aerated freshwater tank at room temperature under natural light conditions before the start of experiments. pMD18-T, pcDNA3.1, and pGL3-promoter were purchased from TaKaRa, Invitrogen and Promega, respectively. CIK cell line that derived from C. idellus kidney tissue was kindly provided by Professor Pin Nie, Institute of Hydrobiology, Chinese Academy of Sciences. CIK cells were routinely maintained in M199 supplemented

1875

with 10% fetal bovine serum (Sijiqing, Hangzhou, China) at 28  C. Grass carp hemorrhagic virus (GCHV) was propagated in CIK cells in our laboratory. 2.2. Cloning and sequence analysis of CiPKR After 2 weeks of acclimation, healthy grass carp were injected intraperitoneally with 100 ml (1 mg/ml) of Poly I:C (Sigma). Total RNA was isolated from spleen tissues at 72 h post-injection, using RNAsimple Total RNA Kit (Tiangen, China). SMART cDNA was prepared using SuperScript III reverse polymerase (Invitrogen). The ORF cDNA of CiPKR was cloned with primers PKR-ORF-F and PKRORF-R (designed according to CaPKR cDNA sequence). PCR was performed in a volume of 50 ml mixture containing 5 ml of 10  LA Buffer (plus Mg2þ), 2 ml of SMART cDNA, 1 ml of each primer (10 mmol/L), 2 ml of dNTP (10 mmol/L), 0.5 ml of LA Taq (TAKARA) (5 U/ml) and 38.5 ml of ddH2O. The full-length of CiPKR cDNA sequence was obtained by RACE-PCR. Primers PKR-5RACE2 and UPM (4 ml Long þ 20 ml Short þ 76 ml ddH2O) were used for the first step of 50 -RACE. Conditions of the PCR amplification were as follows: 1 cycle of 94  C/5 min; 25 cycles of 94  C/30 s, 57  C/30 s, 72  C/1 min; and 1 cycle of 72  C/10 min. Then the PCR product was used as the template for the second step of 50 -RACE with primers PKR-5RACE1 and NUP. The thermal cycling parameters were: 1 cycle of 94  C/5 min; 30 cycles of 94  C/30 s, 61  C/30 s, 72  C/1 min; and 1 cycle of 72  C/10 min. Primers PKR-3RACE1 and Smart-R were used to amplify the 30 -UTR of CiPKR. The PCR cycling conditions were: 1 cycle of 94  C/5 min; 30 cycles of 94  C/30 s, 58  C/30 s, 72  C/1 min; and 1 cycle of 72  C/10 min. Then the PCR product was used as the template for the second step of 30 -RACE with primers PKR-3RACE2 and Smart-R. The PCR cycling conditions were: 1 cycle of 94  C/5 min; 30 cycles of 94  C/30 s, 59  C/30 s, 72  C/1 min; and 1 cycle of 72  C/10 min. CiPKR cDNA was sequenced and inserted into pMD18-T vector (TaKaRa), and then transformed into Escherichia coli DH5a. After CiPKR cDNA sequence was confirmed, polypeptide was determined by online-software ORF finder. Multiple alignments of amino acid sequences from the reported PKRs were performed using Clustal X 1.8 and GeneDoc 2.6. Phylogenetic analyses were performed using the Neighbor-Joining distance method. The bootstrap confidence values were based on 1000 bootstrap replications. 2.3. Tissue-specific expression of CiPKR To determine the expression profile of CiPKR after injection with GCHV, healthy grass carps were injected intraperitoneally with 100 ml GCHV (1  104.5 TCID50 ml1) per fish (about 20 g in body weight). Fishes injected with an equal dose of PBS (pH 7.4) were used as controls. Total RNA was extracted from grass carp tissues using RNAsimple Total RNA Kit. First-strand cDNA was synthesized with PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa). Realtime PCR was employed to detect the CiPKR expression pattern using b-actin as an internal reference gene. PCR reactions were performed on MastercyclerÒ ep realplex2 Thermal Cyclers (Eppendorf). Amplification reactions were carried out in triplicate wells, each well with a final volume of 20 ml, that contained 2 ml DNA sample, 10 ml 2  SYBR premix Ex Taq (TaKaRa), 0.4 ml of each primer and 7.2 ml ddH2O. The cycling parameters were as follows: 1 cycle of 5 min at 95  C, followed by 40 cycles of 30 s at 94  C, 30 s at 55  C and 30 s at 72  C, the melting curve analysis was analyzed to determine the specificity of the PCR amplification for each run. All data were expressed as means  SE, and then subjected to Student’s t-test. Differences were considered as significant at p < 0.05, highly significant at p < 0.01.

1876

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

2.4. Analysis of the up-regulation of CiPKR blocked by Cycloheximide (CHX) in CIK cells The parallel batch of CIK cells were seeded at about 5  104 cells per flask (25 cm2) 2 days prior to analysis. The supernatant was removed and the cells were washed three times with FCSfree M199, and then treated with either 500 ml medium containing UV-inactivated GCHV (1  108 TCID50/ml exposed to UV irradiation). FCS-free M199 alone was used as control. After treatment at 28  C for 2 h, one group of cells were supplemented with appropriate FCS-free M199 to a total volume of 5 ml and further cultured at 28  C, and the other group of cells were treated as the first group of cells, the difference was the FCS-free M199 which was added with CHX (100 mg/ ml) to a final concentration of 10 mg/ml. CHX (Sigma, 10 mg/ml) was added into the medium to block protein synthesis. CIK cells were harvested at the indicated time points; total RNA extraction, cDNA prepared and real-time PCR analysis were the same as those described in Materials and methods 2.2 and 2.3. 2.5. Construction of CiPKR mutants Using pMD18-T/CiPKR (the full-length cDNA of CiPKR) as the template, wild-type PKR (amino acids from 1 to 688, PKR-wt) and the truncated C-terminus of PKR (amino acids from 286 to 688, PKR-C) were amplified by PCR and inserted into the eukaryotic expression vector pcDNA3.1 cleaved with EcoR I and Xho I. These recombinant plasmids were confirmed by sequencing (Sangon, China). Two catalytically inactive mutant plasmids, PKR-K430R and PKR-C-K430R, were obtained from plasmids PKR-wt and PKR-C by replacing lysine (K) with arginine (R), using the PrimeSTAR HS DNA Polymerase (TaKaRa). All of the mutant plasmids were constructed using the primers listed in Table 1. The PCR amplification system includes 5  Pd Buffer (plus Mg2þ) 10 ml, PKR-wt or PKR-C plasmid 2 ml, PKR-K430ReF (10 mmol/L) 1 ml, PKR-K430ReR (10 mmol/L) 1 ml, dNTP (10 mmol/L) 4 ml, PrimeSTAR HS DNA Polymerase 2.5 U with a total volume of 50 ml by adding ddH2O. Thermal cycling Table 1 Primer sequences and their applications in this study. Primer name

Primer sequence (50 / 30 )

Application

PKR-ORF-F PKR-ORF-R PKR-3RACE1 PKR-3RACE2 Smart-R Long

ATGGAGTCTGTGTCAGGGAAT TTCAGCCGAGGATGTCTCTA TTCAAGGCAAGACAAAAGCTGGAG TTCAAGGCAAGACAAAAGCTGGAG CAGAGTAC(T)16 CTAATACGACTCACTATAGGGCAA AGCAGTGGT ATCAACGCAGAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT CTCGTCCTCTGCATTTTGTGTTTTG TCTTTCCTTGTCCTTCGGGGTATT CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC TTCGTGAGGTCCGTGCTTTG TCTCAATCCAGGCACGCAGT CGGAATTCTATGGAGTCTGTGTCA GGGAAT CGCTCGAGTCAGAACGTCTTGATG TCTTTA CGGAATTCTATGACCACACAGAGT TCTGAAG CGCTCGAGTCAGAACGTCTTGATG TCTTTA AGAAATATTATGCTGTGAGGATG GTGAA GAGTACAGAAAAAG CTGTACTCTTCACCATCCTCACAG CATAA TATTTCTTCTCCA

CiPKR-ORF clone

Short NUP PKR-5RACE1 PKR-5RACE2 b-actin-F b-actin-R PKR-RT-F PKR-RT-R PKR-ORF-3.1-F PKR-ORF-3.1-R PKR-C-3.1-F PKR-C-3.1-R PKR-K430ReF

PKR-K430ReR

30 -RACE

50 -RACE

Real-time PCR

pcDNA3.1/PKR-wt construction

pcDNA3.1/PKR-C construction

pcDNA3.1/PKR-K430R and pcDNA3.1/PKR-CK430R construction

conditions are as follows: 1 cycle of 98  C/2 min; 20 cycles of 98  C/ 30 s, 68  C/8 min; and 1 cycle of 72  C/10 min. The constructed plasmids were confirmed by sequencing (Sangon Biotech, China). 2.6. Luciferase activity analysis We constructed a series of the recombinant plasmids, including pcDNA3.1/PKR-wt, pcDNA3.1/PKR-K430R, pcDNA3.1/PKR-C and pcDNA3.1/PKR-C-K430R. Each of pcDNA3.1/PKR recombinant plasmids (300 ng) was co-transfected with luciferase plasmid pGL3-promoter (300 ng) into CIK cells by means of FuGENE 6 Transfection Reagent (Promega). For each plasmid, triplicate transfections were performed. Luciferase activity was measured 48 h after transfection by using a Luciferase Detection Kit (Promega). Luciferase activities of total cell lysates were measured on Luminoskan Ascent (Thermo Scientific). 2.7. Cell viability assays CiPKR-induced cell viability was evaluated using a MTT reduction assay. This method is based on the reduction of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) by actively growing cells into a colored formazan product. Approximately 4  103 CIK cells were plated in each well of a 96-well plate and cultured at 28  C for 24 h. Wells containing cells with medium only served as negative controls, while wells containing no cells but just cell culture medium alone were used as blank controls. CIK cells were separately transfected with pcDNA3.1/PKR-wt, pcDNA3.1/PKRK430R, pcDNA3.1/PKR-C and pcDNA3.1/PKR-C-K430R. Those cells transfected with pcDNA3.1 were used as controls. After 48 h, each well was added with 20 ml of MTT (Solarbio) solution (5 mg/ml) and incubated for 4 h at 28  C. After termination of the reaction and removal of the solution, 150 ml DMSO (dimethyl sulfoxide) (Solarbio) was added to each well, and the plate was shaken gently for 10 min at 37  C to thoroughly dissolve the intracellular formazan crystals, and then measured spectrophotometrically in an ELISA reader (Rayto, Shenzhen, China) at a wavelength of 570 nm (test) and 690 nm (reference). The relative cell viability (%) related to the control wells was calculated by the following formula: Cell viability (%) ¼ (Treated group A570 nm  Blank control A570 nm)/(Negative control A570 nm  Blank control A570 nm)  100%. 3. Results 3.1. Sequence features of CiPKR In this study, the full-length cDNA of grass carp PKR (CiPKR) had been cloned. CiPKR consists of a 2067 bp ORF which encodes a putative polypeptide of 688 amino acids with three tandem dsRNA-binding motifs (dsRBMs) at the N-terminus regulatory region, 170 bp of 50 UTR and 199 bp of 30 -UTR. The C-terminus of CiPKR includes the 11 conserved Ser/Thr kinase domains (Fig. 1). A phylogenetic tree was constructed by Clustal X software using CiPKR and other known PKRs. The results revealed that CiPKR was an ortholog of mammalian PKR and shared a high homology with CaPKR and DrPKR (Fig. 2). 3.2. Tissue-specific expression of CiPKR Real-time PCR analysis showed that the expression of CiPKR was low under normal conditions. After ip injection with virus, CiPKR mRNA was obviously up-regulated in all tested tissues (Fig. 3A). The expression level peaked at 6 h post-treatment, and then gradually declined to normal levels within 24 h. It was interesting that CiPKR was up-regulated once again in spleen, kidney, gill and heart at 48e 72 h post-treatment (Fig. 3A).

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

3.3. Analysis of up-regulation of CiPKR blocked by CHX in CIK cells On the whole, the tendency of the expression of CiPKR in CIK cells treated with poly I:C was similar to that of the tissues at the indicated time points, but the cells treated with poly I:C plus CHX

1877

were not the same as the tissues (Fig. 3B). The results demonstrated that Cycloheximide had no impact on the first up-regulation of CiPKR expression; however, the second up-regulation observed in the experiment was not detected in the present group of cells. The results suggested that the first expression peak of CiPKR was

Fig. 1. Nucleotide sequence and the predicted amino acid sequence of CiPKR. The start codon (ATG) was boxed and the stop codon (TAA) was indicated with an asterisk. Three dsRBMs were shaded. The conserved kinases domains were indicated by the double underline and the roman numerals IeXI represented kinase subdomains. The motifs associated with mRNA instability (ATTTA) were underlined with rough words.

1878

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

Fig. 1. (continued).

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

1879

Fig. 1. (continued).

directly induced by virus, but the second up-regulation resulted from the de novo synthesis of endogenous IFN (Fig. 3B).

3.4. CiPKR-induced cell viability changed via inhibiting protein synthesis

RnPKR

100

MmPKR

100

HsPKR

93

BtPKR

100

Compared with the mammalian counterparts, fish PKRs possess some unique properties. For instance, fish PKRs often contain variable numbers of conserved dsRBM [15,18]. CiPKR possesses three dsRBMs at its N-terminal regulatory domain (Fig. 1), which is similar to other fish PKRs, such as DrPKR, TnPKR1 and CaPKR, but it is different from mammalian PKRs [7,8,15,16]. Because dsRBM in PKR is responsible for its dsRNA-binding activity, it seems worthwhile to carry out further investigation about the biological functions of fish PKR with variable number of dsRBMs. As a kind of interferon-induced gene, the expression of PKR usually lacks behind that of interferon gene following exposure to virus. Endogenous IFN gene was up-regulated at 8e12 h postchallenge in mammals and fish [21,22]. PoPKR was expressed at 72 h post SMRV (Scophthalmus maximus rhabdovirus) infection [16]. However, the signal pathway of expression and activation for PKR might be more complex than we imagined previously. Would the various infections employ the alternative pathway to launch the up-regulation of PKR? Levy et al. (2001) reviewed that dsRNA was

A 160

120

OmPKR 100 CiPKR

CaPKR DrPKR

0.1

Fig. 2. Phylogenetic relationships of PKRs. Based on the multiple alignments of seventeen PKRs using Clustal X, include Tetraodon nigroviridis PKR (TnPKR), Takifugu rubripes PKR (TrPKR), Paralichthys olivaceus PKR (PoPKR), Gasterosteus aculeatus PKR (GaPKR), Oplegnathus fasciatus PKR (OfPKR), Oncorhynchus mykiss PKR (OmPKR), Carassius auratus PKR (CaPKR), Danio rerio PKR (DrPKR), Rattus norvegicus PKR (RnPKR), Mus musculus PKR (MmPKR), Homo sapiens PKR (HsPKR), Bos taurus PKR (BtPKR), Sus scrofa PKR (SsPKR), and then a Phylogenetic tree was constructed by the Neighbor-Joining method. The position of grass carp was indicated with an arrow. The bootstrap confidence values shown at the nodes of the tree were based on 1000 bootstrap replications.

Fold induction

OfPKR

100

* **

*

*

*

*

6h

12h

24h

48h

72h

Time after induction

GaPKR1

98

**

** **

B

PoPKR

88

heart

**

60

0h

TrPKR1

99

gill **

0

TnPKR3

TnPKR1 78

intestine **

20

TnPKR2

kindey

**

80

TrPKR2 99

**

100

SsPKR 99

spleen

**

40 100

liver

**

140

Fold induction

The recombinant plasmids pcDNA3.1/PKR-wt, pcDNA3.1/PKR-C and two point mutants (pcDNA3.1/PKR-K430R and pcDNA3.1/PKRC-K430R) were constructed (Fig. 4A). Both of the point mutants contain K / R at the residue 430, which is consistent with human PKR residue K296. This point mutation in human PKR loses the enzymatic activity. By comparison with controls, CiPKR (PKR-wt) can significantly inhibit 79% of luciferase activity in CIK cells (Fig. 4B). Surprisingly, the deletion of dsRBD of CiPKR (CiPKR-C) also decreased 64% of luciferase activity, indicating that defective Nterminus of CiPKR exerts function of the complete kinase. By contrast, PKR-K430R and PKR-C-K430R increased a 1.60- and 1.15fold of luciferase activity than the control, respectively. It indicated that the mutants of CiPKR displayed a dominate-negative effect. In Fig. 4C, the viability of the CIK cells transfected with pcDNA3.1, pcDNA3.1/PKR-wt, pcDNA3.1/PKR-K430R, pcDNA3.1/ PKR-C and pcDNA3.1/PKR-C-K430R were 100%, 49%, 90%, 54%, 100%, respectively. These results indicated that CiPKR and CiPKR-C changed the cell viability, whereas PKR-K430R and PKR-C-K430R hardly altered the cell viability.

4. Discussion

9 8 7 6 5 4 3 2 1 0

**

** GCHV GCHV+CHX

* * 0h

6h

24h

48h

72h

Time after induction Fig. 3. Tissue-specific expression of CiPKR and analysis of up-regulation of CiPKR blocked by CHX in CIK cells. (A) Expression analysis of CiPKR mRNA in grass carp tissues at various time following infected with UV-inactivated GCHV. (B) Expression analysis of CiPKR mRNA in CIK cells at various time following infected with GCHV or GCHV plus CHX. The data shown were derived from a representative experiment reported as the mean (n ¼ 3)  S.D. * represented significant (p < 0.05) and ** highly significant (p < 0.01).

1880

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

A

dsRBM1 dsRBM2 dsRBM3

Kinase Domain

dsRBM1 dsRBM2 dsRBM3

Kinase Domain

pcDNA3.1/PKR-wt

pcDNA3.1/PKR-K430R

* Kinase Domain

pcDNA3.1/PKR-C Kinase Domain

*

pcDNA3.1/PKR-C-K430R

%Relative luciferase activity

B 200%

** 150%

100%

**

50%

** 0%

pcDNA3.1

PKR-wt

PKR-K430R

PKR-C

PKR-C-K430R

C Cell viability(% to control

120% 100% 80% 60%

**

**

40% 20% 0%

pcDNA3.1

PKR-wt

PKR-K430R

PKR-C

PKR-C-K430R

Fig. 4. Effect of CiPKR on protein synthesis and cell viability in vivo. (A) The structure diagram of a series of recombinant plasmid of CiPKR. (B) CIK cells were co-transfected by the FuGENE 6 procedure with the plasmid PGL3-promoter (300 ng) and a series of pcDNA3.1/CiPKR recombinant plasmids (300 ng, respectively), the transfected empty pcDNA3.1 vector was used as a control. Cells were harvested 48 h after transfected and assayed for luciferase activity. Each bar was the average of three independent experiments. (C) CIK cells were transfected with pcDNA3.1/CiPKR-wt, pcDNA3.1/CiPKR-K430R, pcDNA3.1/CiPKR-C, pcDNA3.1/CiPKR-C-K430R respectively. 48 h later, cells was evaluated using a MTT reduction assay.

presumed to activate cellular kinases, including constitutively expressed PKR, leading to the stimulation of several transcription factors which participate in promoting IFN expression, such as IRFs, NF-kB and ATF-2/c-Jun [23]. Wang et al. (2013) indicated that mouse embryonic stem cells (mESCs) were susceptible to viral infection due to its inability to express type I interferon; however, Poly I:C could induce PKR and result in a strong inhibition of cell proliferation [22]. Zhou et al. (2013) demonstrated PaMX1 and PaOAS1 were induced highly in an IFN-dependent manner following stimulation with IFN or Poly I:C, whereas PaPKR could be induced at 6 h post-treatment in an IFN-independent manner [6]. Therefore, PKR was partially induced by virus or Poly I:C in an IFNindependent manner, this portion of PKR was expressed at 3e6 h

post-challenge; the other portion of PKR was induced by endogenous IFN. CiPKR mRNA was elevated to the maximum level at 6 h post-injection with GCHV, and declined to the normal levels within 24 h. Intriguingly, CiPKR mRNA was up-regulated once again at 48e 72 h post-injection (Fig. 3A). We supposed there might be two induced pathways (IFN-independent or IFN-dependent pathway) of CiPKR transcription after virus exposure, which is similar to that of mammalian PKR. The primary pathway is directly induced by virus, and it seems to be IFN-independent because the upregulation of CiPKR gene is earlier or no later than those of CiIRF1 [24] and CiIFN [21]. The secondary pathway is in an IFNdependent pathway, i.e., classical pathway for ISGs [25]. In this pathway, CiPKR is induced by endogenous IFN (via IFN antiviral

Y.-S. Hu et al. / Fish & Shellfish Immunology 35 (2013) 1874e1881

signaling pathways), so the time gap between virus infection and CiPKR expression appears rather long. To further demonstrate this, CHX was introduced to block the lately translated IFN (Fig. 3B). So the second up-regulation of CiPKR was disappeared, but the first (6 h) up-regulation of CiPKR remained. Because these CiPKR was transcribed by the protein factors presence before CHX added. PKR is able to sense cellular dsRNA and leads to consequent dimerization and activation, the activated PKR can shut off protein synthesis by means of phosphorylation of eIF-2a [13,14,26]. The dimerization of C-terminus acts as a key role in PKR activation [27e 29]. In this study, overexpression of CiPKR could tremendously reduce luciferase activity in tested CIK cells (Fig. 4B). In addition, PKR-C (the truncated CiPKR lacking the regulatory domain) could also inhibit luciferase activity to a great degree. The results indicated that a CiPKR without the dsRBD also exerted the eIF2a kinase activity, because the C-terminus of PKR could be involved in its auto-dimerization and activation in vivo [20,30e32]. Some key amino acids of PKR are essential for its function. The residue K296 in human PKR is an ATP binding site, so it is one of the key amino acids [33]. K430 in CiPKR corresponds to K296 in human PKR, so the K / R point mutation can significantly alter the function of CiPKR. Actually, human PKR-K296R mutant could increase 2e6-fold of the expression of reporter gene [19]. CiPKR-K430R and CiPKR-C-K430R could severally increase about 1.6-fold and 1.15fold of the luciferase activity in CIK cells (Fig. 4B). Herry et al. (1994) and Liu et al. (2011) supposed that the up-regulation of PKR might be caused by the interaction of PKR-K296R with endogenous RNA, leading to a dominant-negative effect [19,34]. On the other hand, Tan et al. (1998) supposed that the non-functional PKR mutants without the dsRBD could form inactive hetero-dimers with host wild-type PKR and led to a dominant negative phenotype [35]. PKR displays a key role in apoptosis under viral infection and other stress conditions, but these processes are not well-defined [36]. Transient transfection and overexpression of CiPRK in CIK cells could obviously decrease the cell viability (Fig. 4C), indicating that CiPKR performs its biological functions in a way similar to human PKR [37]. Acknowledgments This work was supported by research grants from the National Natural Science Foundation of China (31060358, 31360515), the Science & Technology Project of Jiangxi Province of China (20111BBF60020) and Natural Science Foundation of Jiangxi Province of China (20132BAB204021). References [1] García MA, Gil J, Ventoso I, Domingo S, Rivas C, Esteban M. Impact of protein kinase PKR in cell biology: from antiviral to antiproliferative action. Microbiol Mol Biol Rev 2006;70:1032e60. [2] Pindel A, Sadler A. The role of protein kinase R in the interferon response. J Interferon Cytokine Res 2011;31:59e70. [3] Jammi NV, Beal PA. Phosphorylation of the RNA-dependent protein kinase regulates its RNA-binding activity. Nucleic Acids Res 2001;29(14):3020e9. [4] Hu CY, Zhang YB, Huang GP, Zhang QY, Gui JF. Molecular cloning and characterization of a fish PKR-like gene from cultured CAB cells induced by UVinactivated virus. Fish Shellfish Immunol 2004;17:353e66. [5] Yang PJ, Wu CX, Li W, Fan LH, Lin G, Hu CY. Cloning and functional analysis of PKZ (PKR-like) from grass carp (Ctenopharyngodon idellus). Fish Shellfish Immunol 2011;31:1173e8. [6] Zhou P, Cowled C, Wang LF, Baker ML. Bat Mx1 and Oas1, but not PKR are highly induced by bat interferon and viral infection. Dev Comp Immunol 2013;40(3e4):240e7. [7] Meurs E, Chong K, Galabru J, Thomas N, Kerr I, Williams BR, et al. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell 1990;62:379e90. [8] Perelygin A, Lear T, Zharkikh A, Brinton M. Comparative analysis of vertebrate EIF2AK2(PKR) genes and assignment of the equine gene to ECA15q24-q25 and the bovine gene to BTA11q12-q15. Genet Sel Evol 2006;38:551e63.

1881

[9] García MA, Meurs EF, Esteban M. The dsRNA protein kinase PKR: virus and cell control. Biochimie 2007;89:799e811. [10] Zhang YB, Gui JF. Molecular regulation of interferon antiviral response in fish. Dev Comp Immunol 2012;38:193e202. [11] Dabo S, Meurs EF. dsRNA-dependent protein kinase PKR and its role in stress, signaling and HCV infection. Viruses 2012;4:2598e635. [12] Yu FF, Zhang YB, Liu TK, Liu Y, Sun F, Gui JF. Fish virus-induced interferon exerts antiviral function through Stat1 pathway. Mol Immunol 2010;47: 2330e41. [13] Lu B, Nakamura N, Inouye K, Li JH, Tang YT, Lundback P, et al. Novel role of PKR in inflammasome activation and HMGB1 release. Nature 2012;488(7413): 670e4. [14] Nakamura T, Furuhashi M, Li P, Cao HM, Tuncman G, Sonenberg N, et al. Double-stranded RNA-dependent protein kinase links pathogen sensing with stress and metabolic homeostasis. Cell 2010;140:338e48. [15] Rothenburg S, Deigendesch N, Dey M, Dever T, Tazi L. Double-stranded RNAactivated protein kinase PKR of fishes and amphibians: varying the number of double-stranded RNA binding domains and lineage-specific duplications. BMC Biol 2008;6:6e19. [16] Zhu R, Zhang YB, Zhang QY, Gui JF. Functional domains and the antiviral effect of the double-stranded RNA-dependent protein kinase PKR from Paralichthys olivaceus. J Virol 2008;82(14):6889e901. [17] del Castillo CS, Hikima J, Ohtani M, Jung TS, Aoki T. Characterization and functional analysis of two PKR genes in fugu (Takifugu rubripes). Fish Shellfish Immunol 2012;32(1):79e88. [18] Zenke K, Nam YK, Kim KH. Molecular cloning and expression analysis of double-stranded RNA-dependent protein kinase (PKR) in rock bream (Oplegnathus fasciatus). Vet Immunol Immunopathol 2010;133(2e4):290e5. [19] Liu TK, Zhang YB, Liu Y, Sun F, Gui JF. Cooperative roles of fish protein kinase containing Z-DNA binding domains and double-stranded RNA-dependent protein kinase in interferon-mediated antiviral response. J Virol 2011;85: 12769e80. [20] Donnelly N, Gorman AM, Gupta S, Samali A. The eIF2a kinases: their structures and functions. Cell Mol Life Sci 2013:1e19. [21] Li DM, Tan WL, Ma MS, Yu XJ, Lai QN, Wu ZQ, et al. Molecular characterization and transcription regulation analysis of type I IFN gene in grass carp (Ctenopharyngodon idella). Gene 2012;504:31e40. [22] Wang R, Wang J, Paul AM, Acharya D, Bai F, Huang F, et al. Mouse Embryonic stem cells (mESCs) are deficient in type I interferon expression in response to viral infections and double-stranded RNA (dsRNA). J Biol Chem 2013;288: 15926e36. [23] Levy DE, García-Sastre A. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev 2001;12(2e3):143e56. [24] Lai QN, Lin G, Ma MS, Huang SH, Li W, Li DM, et al. IRF-1 acts as a positive regulator in the transcription of grass carp (Ctenopharyngodon idella) IFN gene. Fish Shellfish Immunol 2013;34:1432e8. [25] Li DM, Gan Lin, Yu XJ, Huang SH, Lai QN, Liu Y, et al. Immunoprotection of grass carp (Ctenopharyngodon idella) with recombinant interferon (rCiIFN) against GCHV infection. Aquaculture 2013;388e391:42e8. [26] Anderson E, Pierre-Louis WS, Wong CJ, Lary JW, Cole JL. Heparin activates PKR by inducing dimerization. J Mol Biol 2011;413(5):973e84. [27] Dar AC, Dever TE, Sicheri F. Higher-order substrate recognition of eIF2alpha by the RNA-dependent protein kinase PKR. Cell 2005;122(6):887e900. [28] George CX, Thomis DC, McCormack SJ, Svahn CM, Samuel CE. Characterization of the heparin-mediated activation of PKR, the interferon-inducible RNAdependent protein kinase. Virol 1996;221(1):180e8. [29] Dey M, Cao C, Dar AC, Tamura T, Ozato K, Sicheri F, et al. Mechanistic link between PKR dimerization, autophosphorylation, and eIF2 substrate recognition. Cell 2005;122:901e13. [30] Dar AC, Sicheri F. X-ray crystal structure and functional analysis of vaccinia virus K3L reveals molecular determinants for PKR subversion and substrate recognition. Mol Cell 2002;10:295e305. [31] Singh M, Patel RC. Increased interaction between PACT molecules in response to stress signals is required for PKR activation. J Cell Biochem 2012;113:2754e64. [32] Lemairel PA, Lary J, Cole JL. Mechanism of PKR activation: dimerization and kinase activation in the absence of double-stranded RNA. J Mol Biol 2005;345: 81e90. [33] Zhou Y, Gobl A, Wang S, Jacobsen MB, Janson ET, Haines GK, et al. Expression of p68 protein kinase and its prognostic significance during IFN-therapy in patients with carcinoid tumours. Eur J Cancer 1998;34(13):2046e52. [34] Henry GL, McCormack SJ, Thomis DC, Samuel CE. Mechanism of interferon action. Translational control and the RNA-dependent protein kinase (PKR): antagonists of PKR enhance the translational activity of mRNAs that include a 161 nucleotide region from reovirus S1 mRNA. J Biol Regul Homeost Agents 1994;8(1):15e24. [35] Tan SL, Michael J, Gale JR, Michael GK. Double-stranded RNA-independent dimerization of interferon-induced protein kinase PKR and inhibition of dimerization by the cellular P58IPK inhibitor. Mol Cell Biol 1998;18(5):2431e43. [36] Colli ML, Nogueira TC, Allagnat F, Cunha DA, Gurzov EN, Cardozo AK, et al. Exposure to the viral by-product dsRNA or coxsackievirus B5 triggers pancreatic beta cell apoptosis via a Bim/Mcl-1 imbalance. PLoS Pathog 2011;7(9):e1002267. [37] Li YY, Xie J, Wu SY, Xia J, Zhang PF, Liu C, et al. Protein kinase regulated by dsRNA downregulates the interferon production in Dengue virus- and dsRNAstimulated human lung epithelial cells. PLoS One 2013;8(1):e55108.