Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus

Fish & Shellfish Immunology 35 (2013) 1421e1432

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus Ting-Ting Wang a, Xue-Hong Song a, *, Guang-Ming Bao b, Li-Xiang Zhao b, Xiao Yu b, Jie Zhao a a b

Department of Hydrobiology, School of Biology and Basic Medical Sciences, Soochow University, 199 Ren’ai Road, Suzhou, Jiangsu 215123, China Laboratory of Cellular and Molecular Tumor Immunology, Institutes of Biology and Medical Sciences, Soochow University, Suzhou, Jiangsu 215123, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 4 November 2012 Received in revised form 5 August 2013 Accepted 8 August 2013 Available online 27 August 2013

Interleukin-8 (IL-8) is a CXC chemokine that plays key regulatory roles in the immune and inflammatory responses implicated in many human diseases. In this study, we identified and characterized an IL-8 homologue from the grass carp, Ctenopharyngodon idellus. A sequence alignment of the full-length cDNA and genomic DNA showed that the exon/intron organization of grass carp IL-8 (gcIL-8) is identical to those of other known CXC chemokine genes. A multiple alignment analysis showed that gcIL-8 is an ELReCXC chemokine, and its deduced amino acid sequence shares 81% and 36% identity with common carp IL-8s L1 (GenBank ID: ABE47600) and L2 (GenBank ID: AB470924), respectively, suggesting that it belongs to the lineage 1 group of fish IL-8 proteins. On a phylogenetic tree, gcIL-8 clustered with other teleost IL-8 proteins to form a fish-specific clade, clearly distinct from those of bird, mammal, and amphibian proteins. Real-time quantitative PCR analysis indicated that gcIL-8 is differentially expressed in various tissues under normal conditions and that the expression of gcIL-8 mRNA in immune-related tissues is clearly upregulated by Aeromonas hydrophila infection. To explore the biological effects of gcIL8, we produced a recombinant protein, rgcIL-8, in a prokaryotic expression system. Purified rgcIL-8 was confirmed to be chemoattractive for head kidney neutrophils and mononuclear leukocytes in vitro. Our histopathological study also revealed that rgcIL-8 exerts proinflammatory effects by inducing neutrophil infiltration and erythrocyte extravasation. Overall, these results suggest that IL-8 is crucially involved in the inflammatory responses of fish. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Interleukin-8 (IL-8) Grass carp Ctenopharyngodon idellus Phylogenetic analysis Gene expression pattern Proinflammatory activity

1. Introduction Chemokines are chemoattractant cytokines defined by the presence of four conserved cysteine residues. Depending on the arrangement of the first two cysteines, mammalian chemokines are usually divided into four classes: CXC, CC, C, and CXXXC chemokines [1]. The CXC chemokines of mammals can be subdivided into two groups, ELRþCXC and ELRCXC, based on the presence of the Glu-Leu-Arg (ELR) motif at the N-terminus. ELRCXC chemokines exert potent angiostatic effects and act as chemoattractants for lymphocytes. In contrast, ELRþCXC chemokines have angiogenic activity and specifically recruit neutrophils and other polymorphonuclear leukocytes [2,3]. Interleukin-8 (IL-8), first identified as a neutrophil-activating cytokine in mammals, is a CXC chemokine exerts powerful proinflammatory effects in

* Corresponding author. Tel.: þ86 0512 65880178; fax: þ86 0512 65880103. E-mail address: [email protected] (X.-H. Song). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.08.006

several animal models of inflammation [4]. IL-8 production has been observed in a wide variety of cells, including monocytes, T lymphocytes, neutrophils, vascular endothelial cells, dermal fibroblasts, keratinocytes, and hepatocytes [5]. Generally, IL-8 plays crucial roles in various pathological processes. Many IL-8 homologues have been identified in mammals and birds. A previous phylogenetic analysis indicated that fish IL-8 is a functional homologue rather than an orthologue of mammalian IL-8. In fish, several homologous IL-8 genes have already been cloned and partially characterized, including in the flounder (Paralichthys olivaceus) [6], rainbow trout (Oncorhynchus mykiss) [7], banded dogfish (Triakis scyllia) [8], common carp (Cyprinus carpio) [9], silver chimaera (Chimaera phantasma) [10], haddock (Melanogrammus aeglefinus) [11], black sea bream (Acanthopagrus schlegeli) [12], Atlantic cod (Gadus morhua) [13], striped trumpeter (Latris lineata) [14], zebrafish (Danio rerio) [15], and half-smooth tongue sole (Cynoglossus semilaevis) [16]. However, to date, the IL-8 gene has not been identified in the grass carp, Ctenopharyngodon idellus.

1422

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

The grass carp is a teleost fish belonging to the family Cyprinidae and is the most intensively cultured freshwater species among the “top four domesticated fish” in China. Under intensive feeding conditions, the grass carp is usually susceptible to massive infections, and then suffers massive inflammation and even death, which seriously hampers the development of grass carp aquaculture. Recent studies have identified two divergent IL-8 lineages in teleost fish [16e18]. The first lineage is highly conserved in all teleosts, whereas the second has as yet only been found in two cyprinid species. More recently, a third lineage (designated “CXCL8_L3”) has been proposed based on a phylogenetic analysis [19]. Here, we specifically refer to IL-8 in the first lineage, CXCL8_L1. In this study, we identified grass carp IL-8 (gcIL-8) and examined its mRNA expression patterns in various tissues under normal conditions and/or when induced by bacterial challenge, and assessed the phylogenetic relationships of the IL-8 gene among fish and other taxa. We also investigated the potential chemoattractant and proinflammatory activities of the protein using recombinant gcIL-8. The cloning and functional analysis of gcIL-8 should allow us to better understand the roles of IL-8 in the inflammatory responses of fish.

2. Materials and methods 2.1. Fish rearing and sampling Grass carp (mean weight: 25  1 g) were supplied by Hanjiang Breeding Farm for Four Major Chinese Carp (Yangzhou, China). They were reared in tanks at 28  C and acclimatized for two weeks before experimental manipulation. The fish were fed daily with commercial feed on a 3% body weight basis. Three fish were dissected to clone the full-length IL-8 cDNA and for its expression pattern analysis under normal physiological conditions. The skin, tail fin, gill, brain, intestine, muscle, liver, spleen, trunk kidney, head kidney, heart, thymus, and blood were collected from each fish for total RNA extraction. Twenty-four fish were randomly assigned to two groups, the control group and the treatment group. Each fish in the treatment group was injected intraperitoneally with 100 ml of an Aeromonas hydrophila cell suspension at 5  107 CFU/ml. Each fish in the control group received the same volume of physiological saline solution (PSS). Three fish from each group were sampled at 4 h, 1 d, 3 d, and 7 d after injection. The skin, tail fin, gill, brain, intestine, liver, spleen, trunk kidney, head kidney, heart, and thymus were taken from each fish. Immediately after sampling, these tissues were transferred to an ultra-low-temperature laboratory freezer and used to isolate total RNA. Each experiment was repeated independently three times. All experiments were conducted in accordance with the Guideline for Care and Use of Laboratory Animals of Jiangsu Province, China.

2.2. RNA extraction and cDNA synthesis Total RNA was isolated from a variety of tissues, as mentioned above, using TRIzol Reagent (Invitrogen, America), according to the protocol described by the manufacturer. Oligo(dT) (1 ml) and total RNA (11 ml) were incubated for 10 min at 70  C, and then incubated at 0  C for 1 min. Then 1 ml of 10 mM dNTP mix, 4 ml of 5  firststrand buffer, 20 U of RNase inhibitor, and reverse transcriptase (Invitrogen) were added. The mixture was incubated for 1 h at 42  C, and was then suitable for use in the real-time quantitative PCR analysis. For 30 rapid amplification of cDNA ends (30 -RACE) and 50 -RACE, the first-strand cDNAs were synthesized using the SMART RACE kit (Clontech, Japan), according to the manufacturer’s instructions. 2.3. Identification of 30 and 50 cDNA ends of gcIL-8 transcripts The 30 - and 50 -RACE techniques were used to identify the 30 and 50 cDNA ends of the gcIL-8 transcript. Two primers (IL8F and IL8R; Table 1) were designed based on the known partial cDNA sequence of grass carp IL-8 (GenBank ID: EU047717.1). 30 - and 50 -RACE were performed using the gene-specific primers IL8F and IL8R, combined with an oligo(dT) adapter primer. The 25 ml reaction mixture for PCR amplification contained 2.5 ml of 10  PCR buffer, 1.5 mM MgCl2, 1 mM dNTP, 0.4 mM primers, 1 ml of cDNA, and 1 U of ExTaq DNA polymerase (Takara, Japan). The PCR was performed on a gradient thermal cycler (Eppendorf, Germany) with an initial denaturation at 94  C for 3 min, followed by 35 cycles of 94  C for 30 s, 56  C for 30 s, and 72  C for 30 s, and then an additional extension step at 72  C for 5 min. The PCR products were purified with a DNA Gel Extraction Kit (AxyGen, America), ligated into the pMD19-T vector (Takara, Japan), and used to transform Escherichia coli DH5a cells. The cells were plated onto LBeagar Petri dishes and incubated overnight at 37  C. Positive clones containing the insert were selected by colony PCR and sequenced by Sangon Biotech (Shanghai, China). 2.4. Real-time quantitative PCR for the analysis of gcIL-8 gene expression Total RNA (see details in Section 2.2) was treated with DNase I (Fermentas, Lithuania) to digest any contaminating genomic DNA. The primers for real-time quantitative PCR were the same as those used for 30 -RACE and 50 -RACE (Table 1). The PCR reactions were performed in a final volume of 20 ml containing 10 ml of 10  master mix, 0.3 ml of each primer (10 mM), and 5 ml of cDNA. Standard realtime quantitative PCR conditions for the system (MastercyclerÒ ep realplex, Eppendorf) were used: an initial denaturation step at 94  C for 2 min, followed by 40 cycles of denaturation at 94  C for 20 s, 60  C for 30 s, and 72  C for 30 s. Each sample was amplified in triplicate, and each experiment was repeated twice. b-Actin primers

Table 1 Oligonucleotide primers used in this study. Primer code

Sequence (50 e30 )

Relevant characteristics

IL8F IL8R b-actinF b-actinR gIL8F gIL8R cIL8F cIL8R

GGTGTAGATCCACGCTGTCG GTGAGGGCTAGGAGGGTAGAG CCTTCTTGGGTATGGAGTCTTG AGAGTATTTACGCTCAGGTGGG CACCAACAGAGCTGAACACC TCCTCAGGCTCAACATCACAG CGCggatccATGAACTGCAAAATCTTTTC CCGctcgagTCATGGTGCTTTGTTGGC

Amplifying partial gcIL8 in real-time quantitative PCR assay Amplifying 30 end of cDNA in 30 -RACE Amplifying 50 end of cDNA in 50 -RACE Amplifying partial b-actin gene (as internal control) in real-time quantitative PCR assay Amplifying the genomic DNA of gcIL8 Amplifying the gcIL8 coding region for recombinant construct; the restriction sites for BamHI and XhoI are shown in lowercase

Notes: All primers were commercially synthesized by Sangon Biotech (Shanghai, China). The universal primers used for 30 - and 50 -RACE are not shown in this table.

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

A

-90

acagaattcaccaacagagctgaacacctacagcat

-60

cgagcatcaacaatacttttacttttgttattttcattagtaaatcttctcgttggcaga

1

ATGAACTGCAAAATCTTTTCAGTCTTTGTTATTGTTGCTGTGGCATGTCTGACCATTACT

1 61 21 121 41 181 61 241 81

M

N

C

K

I

F

S

V

F

V

I

V

A

V

A

C

L

T

I

1423

T

GAAGCAATGAGTCTTAGAGGTCTGGGTGTAGATCTACGCTGTCGCTGCATTAAAACAGAG E

A

M

S

L

R

G

L

G

V

D

L

R

C

R

C

I

K

T

E

AGTCGACGCATTGGTAAACACATAGAGAGTGTGGAGCTCTACCCTCCTAGCCCTCACTGT S

R

R

I

G

K

H

I

E

S

V

E

L

Y

P

P

S

P

H

C

AAAGATACAGAGATCATTGCCACCCTGAAGGAAACCAAGCAGGAGATCTGTCTGGACCCT K

D

T

E

I

I

A

T

L

K

E

T

K

Q

E

I

C

L

D

P

ACTGCTCCCTGGGTTAAGAAGGTCATTGAGAAGATCCTTGCCAACAAAGCACCATGAata T

A

P

W

V

K

K

V

I

E

K

I

L

A

N

K

A

P

*

301

tctggaccatctgtgatgttgagcctgaggatatgcacaatattttaacctgcaccattc

361

tgcttggttatgtttaaaaccgtttgttcaatgtttttgtttatataagtgctgtgctat

421

atatatatatatgtatttatgtatttatttattatatatttttcaataaaacaattttat

481

accaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

B Homo_sapiens---------------------MTSK-LAVALLAAFLISAALCEGAVLPRSAKE ELRCQCIKTYSK-PFHPKFIKELR Gallus_gallus--------------------MMGK-AVAAVMALLLISMAGAKGMAQARSAIE ELRCQCIETHSK-FIHPKFIQNVN Xenopus_Silurana_tropicalis------METKRTLLAIMALCLLCAAVTESMSLTR-IQE ELRCLCIKTESK-PIHPKHIKNIE

Mammals Birds Amphibians

Melanogrammus_aeglefinus-------MKMTSGKIPISSLLVLLVLLSITEGKSLRGLGME ELRCRCIQTESR-PIG-RHIGKME Gadus_morhua-------------------MKMTSGKIPIGSLLVLLVLLTITEGRSLRGLGME ELRCRCIQTESR-QIG-RHIGMVE Dicentrarchus_labrax------------MMSS-KVFATSIVVLLAFLAISEGMSLRSLGVE ELHCRCIQTESK-PIG-RHIGKVE Acanthopagrus_schlegelii---------MSS-RVFVATIVGLLAFLAISE----ASLGVE ELHCRCIQTESK-PIG-RHIEKVE Takifugu_rubripes----------------MCS-RVFLTSLVVLLAFLAISNGMSLRSLGVE EQHCRCIQTESR-PIG-RHIGKVE Paralichthys_olivaceus-----------MSS-RVIVVAVMVLLASLAISEAVSLRSLGVS SLHCRCIETESR-PIG-RYIKSVE Scophthalmus_maximus------------MMSS-RVIVVAVAVLLASLAISEGVSLRSLGVE EMHCRCIQTESK-PIG-RHIEKVE Cynoglossus_semilaevis-----------MAGCKIIISAIVVLLASLAITEGMSLRSPGVA AMHCRCIQKESR-FFG-RSIEKVE Ctenopharyngodon_idellus---------MNC-KIFSVFVIVAVACLTITEAMSLRGLGVD DLRCRCIKTESR-RIG-KHIESVE

Fish

Hypophthalmichthys_nobilis-------MNC-KIFSVFVTVAVAFLTISEGMSLRGLGVD DLRCRCIKTESR-RIG-KHIESVE Cyprinus_carpio_CXC8_L1----------MHF-KIFSVIVFLG--FLTIGEGMSLRGLGVD DPRCRCIETESQ-RIG-KLIESVE Danio_rerio----------------------MTS-KIISVCVIVFLAFLTIIEGMSLRGLAVD DPRCRCIETESR-RIG-KHIKSVE Oncorhynchus_mykiss--------------MSI-RMSASLVVVLLALLTITEGMSLRGMGAD DLRCRCIETESR-RIG-KLIKKVE Larimichthys_crocea-------------------MSIITIVALLVFLTIPEGSSLGDQTLL LLRCQCITKEKK-PIG-RYIGQVE Triakis_scyllium-----------------MNS-KVILAVLALFILYLASTQAASLRHAGVS SLRCQCIKTNSK-FIHPRRMENIE Chimaera_phantasma---------------MNS-KVTITLLTLLVLYLASAQEE-------S SLQCQCMKTWTN-FIHPKFIDEIN Cyprinus_carpio_CXC8_L2-------------MKLTVSAFMLLICTAALLSTTEGRPKSQQ QLSCRCPRMHSEPAIPANKVLSLR Homo_sapiens

VIESGPHCANTEIIVKLSDGR-ELCLDPKENWVQRVVEKFLKRAENS----------

Gallus_gallus------------------LTPSGPHCKNVEVIATLKDGR-EVCLDPTAPWVKLIIKAILDKADTNNKTAS----Xenopus_Silurana_tropicalis----VIPNGPHCKNVEVIVTLTNME-EVCLEPSAPWVKKIIDKILASSKVPEPTPVA----

Birds Amphibians

Melanogrammus_aeglefinus-------IIPANSHCEESEIIATLKRTGQEVCLDGEAPWVKRLIAKMMSSRRR----------Gadus_morhua-------------------IIPANSHCEETEIIATLKRTGQEVCLDADAPWVKNVIERMISSRRH----------Dicentrarchus_labrax-----------LIPANSHCEETEIIATLKKTGQEVCLDPEAPWVKKVIQKILSNRRR----------Acanthopagrus_schlegelii-------LIPANSHCEETEIIATLKRTGQEVCLDPEAPWVKKVIQKILSNARR----------Takifugu_rubripes--------------LIPPNSHCEETEIIATLKMSGQEVCLDPKAPWVKKVINKIMSSRQR----------Paralichthys_olivaceus---------IISPNSHCDKTEIIATLKDTGVELCLDPEAPWVKRVINKLISKRRLSRWREMGSEAV Scophthalmus_maximus-----------LIPGNSHCEETEIIATLKHSGKEVCLDPEAPWVIRVINRIMSNRRR----------Cynoglossus_semilaevis---------IIPASSHCEETEIIATLKKSGVEICLNPEAPWVKKVIQMMMSNNKRR---------Ctenopharyngodon_idellus-------LYPPSPHCKDTEIIATLKETKQEICLDPTAPWVKKVIEKILANKAP-----------

Fish

Hypophthalmichthys_nobilis-----LYPPSPHCKDTEIIATLKEGKQEICLDPTAPWVKKVIEKILANKAP----------Cyprinus_carpio_CXC8_L1--------LFPPSPHCKDTEIIATLKVSRKEICLDPTAPWVKKVIEKIIANKTPAA--------Danio_rerio--------------------LFPPSPHCKDLEIIATLMTTGQEICLDPSAPWVKKIIDRIIVNRKP----------Oncorhynchus_mykiss------------MFPPSSHCRDTEIIATLSKSGQEICLDVSAPWVKKVIEKMLANNK-----------Larimichthys_crocea------------VIPASSHCNEIEIIATLKKDGRRICLDPNARWVRRVLKKKMVQQAP----------Triakis_scyllium---------------IFPSGPHCSNVEIIATLKNGT-PVCLNPEAAWVKKIIDMIIKNSEKTES-------Chimaera_phantasma-------------IFPNGPHCPQTAIIATLKSSE-KVCLNPDAAWVRKIINRIIEESKKPDADQSEEA — Cyprinus_carpio_CXC8_L2--------VIPAGPICKNENIIATMKKGQ--VCLDPTKDWVISLNEEIKKRNLKSQP-------Fig. 1. Characterization of the grass carp IL-8 (gcIL-8) gene. (A) The cDNA sequence of gcIL-8 and its deduced amino acid sequence. The four conserved cysteine residues are shaded in dark gray. The characteristic signature of the CXC chemokines is boxed. The ATTTA motifs and the polyadenylation signal are underlined. (B) Alignment of IL-8 amino acid sequences of the grass carp and other species. The CXC motif highly conserved in the IL-8 protein is marked in pale gray; the ELR motif and other residues at the corresponding positions are highlighted in bold. (C) Predicted tertiary structures of gcIL-8 and human IL-8, obtained using the SWISS MODEL website http://swissmodel.expasy.org/. (D) Comparison of the IL-8 gene structure in the grass carp, rainbow trout, zebra fish, and human. Exons are indicated by white boxes, introns by black lines connecting the boxes. Numbers above the boxes and/or below the lines denote the exact length of each exon/intron in base pairs. NCBI accession numbers for the IL-8 sequences are: Ctenopharyngodon idellus, JN663841; Oncorhynchus mykiss, NM_001124362; Danio rerio, NC_007112.5; human, NG_029889.1.

1424

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

C

gcIL-8

D

hIL-8 Stop

ATG 64

133

Grass carp

123

133

64

Zebrafish

112

112

13 109

133 314

64

Human

125

87

64

Rainbow trout

13

87

143

87 292

247

16

84

136 271

819

10

416

Fig. 1. (continued).

(Table 1) were used in a similar amplification reaction performed in parallel, as an internal control. The gcIL-8 mRNA expression data, normalized to the b-actin mRNA control, were quantified using the 2DDCT method [20]. The mRNA expression levels in various tissues after challenge with A. hydrophila were expressed as fold changes relative to the corresponding control (injected with PSS). 2.5. Genomic DNA isolation and cloning of the genomic gcIL-8 gene The genomic DNA of the grass carp was extracted from the tail fin using a Genomic DNA Mini Preparation Kit (Beyotime, China). A pair of specific primers (gIL8F and gIL8R, Table 1) was designed based on the 30 - and 50 -untranslated regions (UTRs) of IL-8. PCR amplification was performed under the same cycling conditions as those used for RACE, except that the extension time was 1 min. All subsequent DNA manipulations were performed according to the procedures described in the previous section. 2.6. Sequence analysis A sequence homology search of the GenBank database was made using the BLAST program after the gcIL-8 sequence was determined. The open reading frame (ORF) and amino acid sequences were analyzed with DNAstar and DNAman software, respectively. A protein sequence analysis was performed with the SMART online software (http://smart.embl-heidelberg.de/) to predict the signal peptide and conserved domains. The tertiary structure was predicted with the SWISS-MODEL software. Further analysis was performed in Pymol after a PDB file was loaded. The positions of the exons and introns were derived from a Blast alignment of the gcIL-8 cDNA sequence and the genomic DNA sequence, and the intron/exon arrangement structure was compiled with the VECTOR NTI software.

2.7. Phylogenetic analysis The complete ORF in the full cDNA sequence of gcIL-8 was identified using the GeneSTAR and DNAman software, and its deduced amino acid sequence was entered as the query in a BLASTP search to retrieve other IL-8 amino acid sequences from GenBank. A multiple sequence alignment was computed with the ClustalX program, and a phylogenetic tree was constructed with the MEGA4 program using the neighbor-joining (NJ) method. 2.8. Production and purification of rgcIL-8 The full-length cDNA fragment encoding gcIL-8 was amplified from a single-stranded cDNA by PCR with a forward primer (cIL8F) containing a BamHI site and a reverse primer (cIL8R) containing an XhoI site. After digestion with a combination of BamHI and XhoI, the PCR fragment was cloned into the pET32a(þ) expression vector to generate the pET32a(þ)eIL-8 recombinant construct. Competent E. coli BL21 cells were transformed with the construct, and were then induced with IPTG to express the fusion protein with a thioredoxin (Trx) tag. Cells were also transformed in parallel with the expression vector pET32a(þ), which contains only the Trx protein tag, as a control. After induction with IPTG, the E. coli cells expressing rgcIL-8 were harvested by centrifugation. The cell pellets were resuspended in lysis buffer (50 mM TriseHCl, 50 mM NaCl, 1 M urea, 1% [v/v] Triton X-100, pH 8.0), and sonicated 40 times for 15 s with pauses on ice for 10 s. The bacterial lysate was centrifuged to isolate the inclusion bodies of rgcIL-8 protein. The inclusion bodies were washed twice with lysis buffer and resuspended in denaturing buffer (50 mM TriseHCl, 10% glycerol, 50 mM NaCl, 7 M urea, pH 8.0), and sonicated 40 times for 15 s with pauses on ice for 10 s. After centrifugation at 12,000 g for 20 min, the supernatant was

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

applied to a column of NieNTA resin preequilibrated with 0.01 M phosphate-buffered saline (PBS; pH 7.2) and the denaturing buffer described above. The fusion protein was then eluted from the column with elution buffer (50 mM TriseHCl, 10% glycerol, 50 mM NaCl, 7 M urea, 150 mM imidazole, pH 8.0). The pooled elution fractions were sequentially dialyzed, first against imidazole-free elution buffers containing decreasing concentrations of urea (7, 5, 3, 1, and 0 M urea) for 2 h each, and then overnight against 0.01 M PBS (pH 7.2). The dialyzed sample was centrifuged at 12,000 g for 30 min at 4  C to remove any precipitate. After analysis by SDSePAGE, the supernatant was collected for later use. As a control, the Trx expressed in soluble form was also purified in its native state.

1425

2.9. Chemotaxis assay 2.9.1. Isolation of head kidney leukocytes The head kidney was removed aseptically from freshly killed fish and passed through a 75 mm nylon mesh with 10 ml of ice-cold RPMI-1640 medium (Gibco) containing heparin (10 U/ml; Sigma) and penicillin (100 mg/ml)/streptomycin (100 U/ml) (Gibco). The resulting head kidney leukocytes were then adjusted to 1  106 cell/ ml in RPMI-1640 medium for use in the Transwell migration assay. 2.9.2. Transwell migration assay The Transwell migration assay was performed with a 24-well Costar Transwell apparatus (Corning Costar Co., Cambridge, MA,

Fig. 2. Phylogenetic tree of IL-8 protein sequences constructed with the NJ method. The data set includes the fish, amphibian, bird, and mammal sequences that are available in databases. Numbers at the nodes represent the percentage of 1000 bootstrap replications.

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

3. Results Relative expression level

15

10

5

0

m 120

B

*

4h 1d 3d 7d

100 60

*

40

*

20

*

* *

*

er liv

lf in tai

sk in

gi ll

ym us th

he ad

tru

in

ki dn ey

0

br ain

The partial nucleotide sequence of grass carp IL-8 was initially retrieved from the GenBank nucleic acid sequence database (GenBank ID: EU047717). To clone the complete coding region of the gcIL-8 gene, 50 - and 30 -RACE were performed using primers based on the partial nucleotide sequence. Amplification products of 273 bp and 429 bp were obtained with 50 -RACE and 30 -RACE, respectively. The nucleotide sequences of the RACEePCR products and the original partial sequence were assembled to generate a 609-bp full-length gcIL-8 cDNA sequence (Fig. 1A), which contains a 297-bp ORF flanked by a 96-bp 50 -UTR and a 216-bp 30 -UTR. There were also three mRNA instability motifs (ATTTA) and a polyadenylation signal (AATAAA) in the 30 -UTR. The ORF was predicted to encode a protein of 98 amino acids, preceded by a typical signal peptide of 22 residues. The protein contains four conserved cysteines located at positions 34, 36, 60, and 77, with an arginine residue located between the first two cysteines, forming a CXC motif. A multiple alignment of the deduced gcIL-8 amino acid sequence with other known IL-8 proteins from fish species was constructed using the ClustalX program. The results showed that

mRNA expression relative to the mean of control samples

3.1. Cloning the gcIL-8 gene

A

20

e

Data were analyzed with the SPSS 15.0 software, with one-way analysis of variance (ANOVA), and statistical significance was defined as p < 0.05.

The genomic DNA sequence of the gcIL-8 gene was isolated based on its 30 - and 50 -UTR sequences. The gene structure of gcIL-8 was determined by aligning the genomic and cDNA sequences. The gcIL-8 gene contains four exons separated by three introns. The exons range in size from 13 bp to 133 bp, and the introns range from 123 bp to 143 bp. A schematic gene structure of IL-8 of three teleosts (grass carp, zebrafish, and rainbow trout) and hIL-8 is shown in Fig. 1D. The IL-8 gene structure is highly conserved across the four species and the lengths of exon 1 (64 bp), exon 2 (133 bp), and exon 3 (87 bp) of all three teleost fish are identical, except for exon 4, the length of which differs greatly. However, it must be noted that in catfish, the lengths of the exons are not identical to those of the three fish species shown here, although four genes have a highly

ki dn ey sp lee n

2.11. Statistical analysis

3.2. Gene structure of gcIL-8

nk

To evaluate the possible proinflammatory activity of rgcIL-8, grass carp were randomly assigned to five groups of nine fish each. Purified rgcIL-8 was dissolved in PSS (pH 7.4) and injected into the muscle between the dorsal fin and the lateral-line at doses of 1.0, 2.5, 5.0, or 10.0 mg/fish. Purified Trx was also administered at 10.0 mg/fish as a negative control. For the histopathological studies, paraffin sections were prepared according to a routine procedure. Briefly, muscle tissues at the injection sites were excised 1, 3, and 7 d after the intramuscular injection of the protein, then fixed in 10% formalin, and embedded in paraffin. The paraffin-embedded tissues were cut into 8 mm thick sections and stained with a standard hematoxylin and eosin method.

tes tin

2.10. Intramuscular injection and histopathological examination

gcIL-8 (underlined in Fig. 1B) is remarkably similar to other fish IL-8 proteins in that they all lack the Glu-Leu-Arg (ELR) motif highly conserved in mammalian and bird IL-8, but share the CXC motif highly conserved in almost all animals. More specifically, the grass carp protein contains an Asp-Leu-Arg (DLR) motif rather than the ELR motif because a Glu residue has been substituted with Asp. The DLR signature in fish IL-8 has only been found in the rainbow trout and bighead carp (Hypophthalmichthys nobilis) (Fig. 1B). We also found that the three amino acid residues at positions corresponding to the ELR motif were highly variable in fish species. Further analysis with SWISS-MODEL showed that the predicted tertiary structure of gcIL-8 is very similar to that of human IL-8 (hIL-8), both consisting of four b-sheets at the N-terminus and one a-helix at the C-terminus (Fig. 1C). Our results show that gcIL-8 has a CXC chemokine domain, which contains four conserved cysteine residues (C34, C36, C60, and C77), the first two of which are conserved in the CXC motif (35CRC37). gcIL-8 has a DLR amino acid sequence immediately before the CXC motif, which is distinct from the ELR motif conserved in other animal taxa. Interestingly, the single amino acid residue, arginine (R), between the two cysteine residues in the CXC motif is strictly conserved in almost all teleosts (except Larimichthys crocea), as shown in Fig. 1B.

he ar t

USA). Purified rgcIL-8 was diluted in RPMI-1640 medium to 0.01, 0.1, 1.0, and 10 mg/ml and 600 mL aliquots of the dilutions were added to the lower chambers of the Transwell units. Polycarbonate filters with a pore diameter of 3 mm were then placed onto the lower wells, and 100 ml of target cells (1  105) were added to the upper chamber. The unit was incubated at 28  C for 4 h. Migration toward the same volume of Trx (10 mg/ml) was used as a negative control. The number of cells that migrated into the lower chamber was counted under a microscope (Olympus IX71, Japan). Air-dried smears of grass carp head kidney cells before and after migration were stained with Wright’s stain solution and examined under an optical light microscope, essentially following the procedure described in the literature [21]. The assay procedure was repeated independently four times. Chemotactic activity was expressed as a chemotactic index, or the number of cells that migrated in response to rgcIL-8 or Trx divided by the number of cells that migrated to the RPMI-1640 medium (negative control).

us cl br e ain h in eart tes tru b tine nk loo ki d d he sp ney ad le ki en dn ey th gill ym u sk s tai in lf in liv er

1426

Fig. 3. Expression pattern of the grass carp IL-8 (gcIL-8) gene. (A) Relative levels of gcIL-8 mRNA in various tissues of healthy grass carp. (B) Relative levels of gcIL-8 mRNA in various tissues compared with the control group after stimulation with A. hydrophila. The asterisk indicates a significant difference in gcIL-8 expression between the treated and control groups (p < 0.05).

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

1427

5

d

4.5 4

c bc

Chemotactic index

3.5

b

3 2.5 2

a

1.5 1 0.5 0 Con

0.01 µg/ml

0.1 µg/ml

1.0 µg/ml

10.0 µg/ml

Treatment/Dose of rgcIL-8

Fig. 4. SDSePAGE analysis of the expression and purification of rgcIL-8 and Trx fusion tag produced in E. coli BL21. M: molecular size marker (Thermo Scientific-Fermentas, SM0431); lane 1, lysate of E. coli cells containing empty pET32a(þ) vector; lane 2, lysate of E. coli cells expressing recombinant construct pET32a(þ)-IL-8; lane 3, purified thioredoxin (Trx) tag from the sample in lane 1; lane 4, purified Trx-tagged rgcIL-8 from the sample in lane 2 after NieNTA affinity resin chromatography.

conserved gene structure [22]. In contrast, the introns varied considerably in their lengths. 3.3. Phylogenetic analysis of the IL-8 proteins The deduced amino acid sequence of gcIL-8 was compared with all available IL-8 proteins using the BLAST program. The deduced amino acid sequence of gcIL-8 shared highest similarity with that of the bighead carp (95%), followed by those of the rainbow trout (77%), zebrafish (66%), and human (45%). This result was confirmed by a phylogenetic analysis. IL-8 genes are

Fig. 6. Effects of various concentrations of rgcIL-8 on the chemotactic migration of grass carp head kidney leukocytes. Incubation with Trx (10 mg/ml) was used as the control (Con) to verify the specificity of the chemotactic activity. Data are expressed as means  SE (n ¼ 4) of five fish. Bars with different letters are significantly different (p < 0.05).

present in all vertebrates, including mammals, amphibians, and fish. Forty-two IL-8 amino acid sequences were extracted from GenBank to construct a phylogenetic tree using ClustalX 1.83 and MEGA4.0 (Fig. 2). The phylogenetic tree revealed that the grass carp and bighead carp proteins clustered closely on a branch, and then grouped together with the proteins of the zebrafish and many other teleosts to form a fish-specific IL-8 clade, distinct from the other clades formed by the bird, mammal, and amphibian proteins. Using the BLASTP software from the NCBI BLAST online service, we demonstrated that the amino acid sequence identities between gcIL-8 and common carp IL-8 L1 (GenBank ID: ABE47600) and L2 (GenBank ID: AB470924) were 81% and 36%, respectively. These

Fig. 5. The chemoattractive effects of rgcIL-8 on grass carp head kidney cells. Wright’s-stained smears (640) showing the chemotactic migration of head kidney neutrophils (black arrows) and mononuclear leukocytes (white arrows) toward rgcIL-8. A, head kidney cells before the Transwell migration assay; B, migrated cells 4 h after incubation with rgcIL-8.

1428

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

results indicate that gcIL-8 is an ELReCXC chemokine belonging to the lineage 1 group of fish IL-8 proteins. However, further research is required to ascertain whether a lineage 2 group of fish IL-8 proteins is present in the grass carp, considering that the grass carp is a member of the same family as the common carp and zebrafish, which both express the two lineages. 3.4. gcIL-8 gene expression in healthy tissues and those challenged with A. hydrophila Real-time quantitative PCR was used to examine the transcript profiles of the gcIL-8 gene in different tissues of healthy grass carp. The relative gcIL-8 mRNA levels in different tissues were normalized to those of b-actin (Fig. 3A). gcIL-8 was constitutively expressed in all the tissues examined, but its expression varied greatly among the different tissues. The highest mRNA expression was detected in the liver, followed by the tail fin, skin, thymus, gill, head kidney, spleen, and trunk kidney, whereas lower expression was observed in the muscle, brain, heart, intestine, and blood. This implies that gcIL-8 mRNA is not specifically expressed in immune organs, although its expression was elevated in the head kidney, thymus, and spleen. To determine whether gcIL-8 is involved in the inflammatory response in the grass carp, we used real-time quantitative PCR to measure gcIL-8 mRNA expression in the brain, heart, intestine, trunk kidney, spleen, head kidney, gill, thymus, skin, tail fin, and liver at various times (4 h, 1 d, 3 d, and 7 d) after challenge with A. hydrophila. The results were normalized with the corresponding PSS control and are shown in Fig. 3B. gcIL-8 mRNA expression varied greatly among the different tissues after exposure to A. hydrophila. No significant changes in the gcIL-8 transcripts were observed at any time in the brain or gill after challenge with A. hydrophila. gcIL-8 mRNA increased in several tissues after bacterial challenge, peaking at 4 h in the trunk kidney, heart, spleen, and skin, and at 1 d in the intestine, head kidney, gill, thymus, and liver, and declined thereafter. The peak mRNA levels in the trunk kidney, intestine, head kidney, gill, and thymus differed significantly (p < 0.05) between the treatment and control groups. 3.5. Production and purification of rgcIL-8 protein To examine its potential chemotactic activity, rgcIL-8 was produced as a Trx-tagged recombinant protein in E. coli cells that had been transformed with pET32a(þ)eIL-8. The Trx fusion tag was also expressed by transforming cells with the empty pET32a(þ) vector. Both rgcIL-8 and Trx were purified to homogeneity by Nie NTA metal affinity chromatography, as shown in Fig. 4. SDSePAGE analysis showed that purified Trx-fused rgcIL-8 occurred as a single band with a molecular mass roughly consistent with the calculated mass (w28.7 kDa), although its precise size was difficult to determine. The Trx tag, expressed in a soluble form, was also purified. These purified rgcIL-8 and Trx proteins were prepared for subsequent functional studies. 3.6. In vitro and in vivo activities of rgcIL-8 in grass carp 3.6.1. In vitro chemotactic activity of purified rgcIL-8 To determine the cell types upon which rgcIL-8 might exert a chemoattractant effect, the head kidney cells were examined

1429

microscopically before the chemotaxis assay, as were the migrated cells in the lower chamber. The Wright’s-stained smears revealed that rgcIL-8 induced the migration of both neutrophils and mononuclear leukocytes (Fig. 5), supporting the chemoattractant role of this chemokine in the grass carp. Our results show that stimulation with all the tested concentrations (0.01, 0.1, 1.0 and 10.0 mg/ml) of rgcIL-8 significantly enhanced the migration of neutrophils and mononuclear leukocytes, as assessed with the chemotactic index (p < 0.05), when compared with the Trx control (Fig. 6). Moreover, rgcIL-8 induced the migration of these cells in a concentration-dependent manner, as illustrated in Fig. 6. As the concentration of rgcIL-8 increased from 0.01 to 1.0 mg/ml, the numbers of migrated cells (evaluated with the chemotactic index) increased correspondingly, reaching a maximum number with 1.0 mg/ml rgcIL-8 (p < 0.05), although there was no significant difference between the two lower concentrations. However, above this concentration, the numbers declined significantly (p < 0.05). 3.6.2. In vivo proinflammatory activity of rgcIL-8 To verify the potential proinflammatory role of purified rgcIL-8 in the grass carp, we tested whether an intramuscular injection of rgcIL-8 or Trx would induce inflammation in muscle tissues. When injected with the lower dose of rgcIL-8 (1.0 mg/fish), the grass carp displayed no visible inflammatory symptoms within the first 24 h after injection, and only a few inflammatory cells were observed in the muscle tissues (Fig. 7a). When the dose was increased to 2.5 mg/ fish, the muscle tissue around the injection site became inflamed, which was accompanied by blood clot formation and blood cell infiltration (Fig. 7b). When the dose was increased to 5.0 mg/fish or 10.0 mg/fish, the inflammation was exacerbated. However, no symptomatic differences were observed in the fish injected with these two higher doses of rgcIL-8. Interestingly, the most extensive infiltration of inflammatory cells was induced by injection with 5.0 mg/fish rgcIL-8 (Fig. 7c), rather than with the highest dose used, 10.0 mg/fish (Fig. 7d). No visible inflammation was observed when fish were injected with Trx at doses up to 10.0 mg/fish, and only a few inflammatory cells were present in their muscle tissues (Fig. 7e). A histopathological analysis revealed that rgcIL-8 induced inflammation and inflammatory cell infiltration in a timedependent manner. Inflammation peaked 1 d after injection, then began to subside, and had almost disappeared by day 7 (Fig. 8, upper row). Compared with rgcIL-8, Trx caused only slight inflammation 1 d after injection, even at a dose of 10 mg/fish, and this disappeared as early as three days after injection (Fig. 8, lower row). 4. Discussion IL-8 has been intensively studied in a variety of mammals since 1987, when it was first discovered as a neutrophil chemotactic cytokine [23]. IL-8 has also been described in several fish species, especially in teleost fish. Here, we have reported the cloning and characterization of the IL-8 gene of the grass carp, an economically productive freshwater species. The genomic DNA sequence and cDNA sequence of the gcIL-8 gene were determined with conventional PCR and RACE techniques, respectively. By aligning these two sequences, we showed that this gene contains four exons and three introns, with identical exon/intron organization to that reported in

Fig. 7. Histopathological changes in muscle tissues 24 h after injection with different doses of rgcIL-8. Panels aed show the histology of grass carp muscles after injection with 1.0, 2.5, 5.0, and 10.0 mg/fish rgcIL-8, respectively. Panel e shows the histology of grass carp muscles after injection with 10.0 mg/fish Trx (negative control). In each left panel, the lateralline tube (white arrow) was used as a reference to locate the inflammatory sites (boxed area). The panels in the right column represent the enlarged boxed areas in the corresponding left panels, showing the inflammatory cells (thick arrow), extravasated erythrocytes (arrowhead), and necrotic muscle cells (empty arrow).

1430

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

birds [24], mammals [25], humans [26], and several other teleost fish [7,13,15,22]. IL-8 and other CXC chemokines share the same gene organization, suggesting they may have evolved from a common ancestral gene. Members of the CXC chemokine family are usually divided into two categories, the ELRþ and ELR chemokines, based on the presence or absence of the tripeptide motif ELR on the NH2-terminal side of the first cysteine. IL-8 is the most extensively studied member of the CXC chemokine family [27] and is the most potent chemoattractant factor for neutrophils in human and other mammals. Although IL-8 was once regarded as a representative protein containing the ELR motif, both ELRþ and ELRIL-8 proteins have been found throughout the animal kingdom. In fish, ELRþ IL-8 has as yet only been found in the haddock [11] and Atlantic cod [13]. In most fish IL-8 sequences, there is no ELR motif immediately upstream from the CXC domain and the ELR motif is often replaced by other tripeptides, such as SLH in the flounder and DLR in the trout and bighead carp. In this study, a phylogenetic analysis and multiple alignment of the deduced amino acid sequence revealed that unlike its mammalian counterparts, the grass carp IL-8 lacks the ELR motif immediately upstream from the CXC residues, but contains DLR at the same site. Currently, the importance of the ELR motif is controversial. It is thought to play a decisive role in defining the biochemical behavior of IL-8 in humans [28], and mutation of ELR to DLR greatly reduces its biological activity [29]. However, it has also been demonstrated that when mammalian ELR motifs are mutated to DLR, they retain the capacity to attract neutrophils [30], and the DLR motif in the fish CXC chemokines is not essential for neutrophil chemotaxis [31]. We found that rgcIL-8 first induced the dose-dependent in vitro chemotaxis of neutrophils at a high dose of 0.01 mg/ml, approximately 400-fold higher than that described for the common carp, into which rhIL-8 was injected [9]. Therefore, more data are required to determine whether the ELR motif and its tripeptide substitutions, including DLR, are essential for the chemoattractant activity of IL-8 in fish. We also found that gcIL-8 is expressed constitutively in various tissues, although the mRNA levels in the brain, muscle, and tail fin were much lower than those in the other tissues. In the fugu, high IL-8 mRNA levels were detected in the thymus, head kidney, trunk kidney, spleen, heart, and gill, but not in the intestine, skin, brain, muscle, or liver [32]. In the rainbow trout, IL-8 is ubiquitously

expressed in all the tissues tested, except the brain [7]. Recently, constitutive expression patterns of IL-8 have also been observed in the half-smooth tongue sole and zebrafish [16,33]. However, it should be noted that in the channel catfish, no IL-8 expression was detected in the liver, muscle, skin, or heart [22]. Whether the differences reported across these studies are associated with the use of different detection methods is unclear. Generally, early studies mainly focused on the immune organs, such as the head kidney and spleen [34e36]. In this study, gcIL-8 expression was examined in all immune-related tissues, including the head kidney, spleen, thymus, liver, gill, skin, and intestine. Interestingly, we observed relatively higher gcIL-8 mRNA levels in the tail fin, gill, and skin. In fish, these organs are most directly exposed to a variety of stressful conditions, including bacterial infection, and usually provide the first line of defense against pathogens. Higher gcIL-8 expression was also observed in the immune organs, including the head kidney, thymus, and spleen. Upon bacterial challenge, gcIL-8 expression was upregulated in all the immune-related tissues, including the head kidney, spleen, thymus, liver, gill, skin, and intestine, which is remarkably similar to the expression pattern observed in the halfsmooth tongue sole challenged with Listonella anguillarum [16]. From these observations, we infer that gcIL-8 is involved in a defense response to pathogen infection. Again, this seems inconsistent with its proinflammatory effects, demonstrated in our histological analysis. However, inflammation is a normal protective response to a variety of stress stimuli [37]. Undoubtedly, many other proteins, besides IL-8, are involved in the host inflammatory responses. Although IL-8 has been shown to initiate an acute inflammatory cascade [38], information about other inflammatory proteins downstream from IL-8 in the inflammatory cascade is largely unavailable for fish. Therefore, we used histological methods to investigate the proinflammatory effects of gcIL-8 in vivo, and demonstrated that gcIL-8 resulted in profound inflammatory infiltration of the muscle tissues. The broad utility of the E. coli expression system pET32a(þ) has been illustrated by the production of a fish chemoattractant factor [39]. To perform our functional studies, we produced rgcIL-8 by expressing it as a Trx fusion protein from a recombinant pET32a(þ)-IL-8 construct. Previous studies [40] have confirmed that Trx is readily secreted and taken up by cells and may play a role as a costimulatory molecule in immune processes. Trx is also reported to be a chemoattractant for human monocytes,

Fig. 8. Time course of rgcIL-8-induced inflammation and inflammatory cell infiltration in muscle tissues. Upper row, injection with rgcIL-8 (5 mg/fish); lower row, injection with Trx (10 mg/fish) (magnification 160). Muscle tissue samples for histopathological examination were collected 1, 3, and 7 d after injection.

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

polymorphonuclear leukocytes, and T lymphocytes [41]. In an attempt to clarify the possible chemotactic effects and proinflammatory activities of the Trx tag, Trx-fused rgcIL-8 and Trx itself were separately isolated and tested for chemoattractant and proinflammatory activity in the present study. Our chemotaxis assay confirmed that rgcIL-8 stimulated a significantly higher chemotactic effect than Trx alone, although Trx also induced slight chemotaxis. Therefore, we conclude that IL-8 is a functional chemokine with chemoattractant activity in the grass carp, similar to those observed in the common carp [9], the half-smooth tongue sole [16], and the turbot (Scophthalmus maximus) [42]. Several lines of evidence suggest that human ELRþCXC chemokines usually recruit neutrophils and other polymorphonuclear leukocytes, whereas ELReCXC chemokines specifically attract lymphocytes and monocytes [2]. In fish, the chemoattractive activity of IL-8 was first described for neutrophils in the common carp, in which recombinant human IL-8 was tested as a chemoattractant [9]. Recently, the effect of recombinant fish IL-8 in attracting not only neutrophils but also monocytes and macrophages has been confirmed in several teleost fish, including the turbot, half-smooth tongue sole, and common carp [16,42,43]. In another study, recombinant black sea bream IL-8 with an engineered ELR motif exhibited chemoattractive activity for blood neutrophils and head kidney macrophages [31]. In our study, recombinant grass carp IL-8 was shown to be chemoattractive for head kidney neutrophils and mononuclear leukocytes in vitro. IL-8 is a well-recognized proinflammatory chemokine that attracts neutrophils and other leukocytes, promoting their recruitment to sites of inflammation. In some fish species, the in vivo proinflammatory activity of IL-8 has been investigated with gene expression profiling. The head kidney is an important immune organ in teleost fish and contains various inflammatory cells, including neutrophils and macrophages/monocytes [44]. Head kidney cells are often used in chemotaxis assays. The intraperitoneal administration of recombinant IL-8 at high doses greatly enhances head kidney neutrophil recruitment in the rainbow trout [45]. This is further supported by our histopathological studies, in which an intramuscular injection of purified rgcIL-8 induced neutrophil infiltration and erythrocyte extravasation in muscle tissues, and eventual muscle cell necrosis. In summary, we have cloned and characterized an IL-8 gene from the grass carp. Grass carp IL-8 shares high structural similarity to its homologues in mammals and other teleost fish. Like other fish IL-8, gcIL-8 is an ELReCXC chemokine. Comparison of the mRNA expression levels in different tissues demonstrated that the gcIL-8 gene is involved in the host defense response. Our data also confirm that rgcIL-8 expressed from a prokaryotic expression system exerts a chemoattractant effect on neutrophils and mononuclear leukocytes, and induces neutrophil infiltration in vivo. Further studies are required to clarify the distinct roles of fish IL-8 in the inflammatory process. Acknowledgments This work is supported by grants from the Natural Science Foundation of Jiangsu (BK2011285) and the Basic Application Foundation of Suzhou (SYN201111). We thank Dr. Hai-Yan Liu for the initial design of this study and helpful discussions. We also thank Dr. Bing-Yao Sun for experimental guidance. References [1] Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol 2011;35:1215e22.

1431

[2] Streiter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD, Kasper J, et al. The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 1995;270:27348e57. [3] Bizzarri C, Beccari AR, Bertini R, Cavicchia MR, Giorgini S, Allegretti M. ELRþ CXC chemokines and their receptors (CXC chemokine receptor 1 and CXC chemokine receptor 2) as new therapeutic targets. Pharmacol Ther 2006;112:139e49. [4] Baggiolini M, Walz A, Kunkel SL. Neutrophil-activating peptide-1/interleukin 8, a novel cytokine that activates neutrophils. J Clin Invest 1989;84:1045e9. [5] Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol 1994;56:559e64. [6] Lee EY, Park HH, Kim YT, Chung JK, Choi TJ. Cloning and sequence analysis of the interleukin-8 gene from flounder (Paralichthys olivaceous). Gene 2001;274:237e43. [7] Laing KJ, Zou JJ, Wang T, Bols N, Hirono I, Aoki T, et al. Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev Comp Immunol 2002;26:433e44. [8] Inoue Y, Haruta C, Usui K, Moritomo T, Nakanishi T. Molecular cloning and sequencing of the banded dogfish (Triakis scyllia) interleukin-8 cDNA. Fish Shellfish Immunol 2003;14:275e81. [9] Huising MO, Stolte E, Flik G, Savelkoul HF, Verburg-van Kemenade BM. CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio L.). Dev Comp Immunol 2003;27:875e88. [10] Inoue Y, Endo M, Haruta C, Taniuchi T, Moritomo T, Nakanishi T. Molecular cloning and sequencing of the silver chimaera (Chimaera phantasma) interleukin-8 cDNA. Fish Shellfish Immunol 2003;15:269e74. [11] Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombes CJ. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1 beta and IL-8, in haddock (Melanogrammus aeglefinus). Mol Immunol 2007;44:1361e73. [12] Zhonghua C, Chunpin G, Yong Z, Kezhi X, Yaou Z. Cloning and bioactivity analysis of a CXC ligand in black seabream Acanthopagrus schlegeli: the evolutionary clues of ELRþCXC chemokines. BMC Immunol 2008;9:1e12. [13] Seppola M, Larsen AN, Steiro K, Robertsen B, Jensen I. Characterization and expression analysis of the interleukin genes, IL-1beta, IL-8 and IL-10, in Atlantic cod (Gadus morhua L.). Mol Immunol 2008;45:887e97. [14] Covello JM, Bird S, Morrison RN, Battaglene SC, Secombes CJ, Nowak BF. Cloning and expression analysis of three striped trumpeter (Latris lineata) proinflammatory cytokines, TNF-alpha, IL-1beta and IL-8, in response to infection by the ectoparasitic, Chondracanthus goldsmidi. Fish Shellfish Immunol 2009;26:773e86. [15] Oehlers SH, Flores MV, Hall CJ, O’Toole R, Swift S, Crosier KE, et al. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev Comp Immunol 2010;34:352e9. [16] Sun JS, Zhao L, Sun L. Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property. Fish Shellfish Immunol 2011;30: 1362e7. [17] Abdelkhalek NK, Komiya A, Kato-Unoki Y, Somamoto T, Nakao M. Molecular evidence for the existence of two distinct IL-8 lineages of teleost CXC-chemokines. Fish Shellfish Immunol 2009;27:763e7. [18] van der Aa LM, Chadzinska M, Tijhaar E, Boudinot P, Verburg-van Kemenade BM. CXCL8 chemokines in teleost fish: two lineages with distinct expression profiles during early phases of inflammation. PLoS One 2010;5:e12384. [19] Chen J, Xu Q, Wang T, Collet B, Corripio-Miyar Y, Bird S, et al. Phylogenetic analysis of vertebrate CXC chemokines reveals novel lineage specific groups in teleost fish. Dev Comp Immunol 2013;41(2):137e52. [20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT Method. Methods 2001;25(4):402e8. [21] Stakauskas R, Steinhagen D, Guzys G, Mironova L, Leibold W, Schuberth HJ. Quantitative and qualitative assessment of serum- and inflammatory mediator-induced migration of carp (Cyprinus carpio) head kidney neutrophils in vitro. Fish Shellfish Immunol 2006;21(2):187e98. [22] Chen L, He C, Baoprasertkul P, Xu P, Li P, Serapion J, et al. Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella Ictaluri. Dev Comp Immunol 2005;29:135e42. [23] Yoshimura T, Matsushima K, Tanaka S, Robinson EA, Appella E, Oppenheim JJ, et al. Purification of a human monocyte-derived neutrophil chemotactic factor that has peptide sequence similarity to other host defense cytokines. Proc Natl Acad Sci USA 1987;84(24):9233e7. [24] Kaiser P, Hughes S, Bumstead N. The chicken 9E3/CEF4 CXC chemokine is the avian orthologue of IL-8 and maps to chicken chromosome 4 syntenic with genes flanking the mammalian chemokine cluster. Immunogenetics 1999;49: 673e84. [25] Mukaida N, Harada A, Yasumoto K, Matsushima K. Properties of proinflammatory cell type-specific leukocyte chemotactic cytokines, interleukin 8 (IL-8) and monocyte chemotactic and activating factor (MCAF). Microbiol Immunol 1992;36:773e89. [26] Kusner DJ, Luebbers EL, Nowinski RJ, Konieczkowski M, King CH, Sedor JR. Cytokine- and LPS-induced synthesis of interleukin-8 from human mesangial cells. Kidney Int 1991;39:1240e8. [27] Fox SE, Lu W, Maheshwari A, Christensen RD, Calhoun DA. The effects and comparative differences of neutrophil specific chemokines on neutrophil chemotaxis of the neonate. Cytokine 2005;29(3):135e40. [28] Hagedorn M, Zilberberg L, Wilting J, Canron X, Carrabba G, Giussani C, et al. Domain swapping in a COOH-terminal fragment of platelet factor 4 generates potent angiogenesis inhibitors. Cancer Res 2002;62(23):6884e90.

1432

T.-T. Wang et al. / Fish & Shellfish Immunology 35 (2013) 1421e1432

[29] Daly TJ, LaRosa GJ, Dolich S, Maione TE, Cooper S, Broxmeyer HE. High activity suppression of myeloid progenitor proliferation by chimeric mutants of interleukin 8 and platelet factor 4. J Biol Chem 1995;270(40):23282e92. [30] Hébert CA, Vitangcol RV, Baker JB. Scanning mutagenesis of interleukin-8 identifies a cluster of residues required for receptor binding. J Biol Chem 1991;266(28):18989e94. [31] Cai Z, Gao C, Zhang Y, Xing K. Functional characterization of the ELR motif in piscine ELRþCXC-like chemokine. Mar Biotechnol 2009;11(4):505e12. [32] Saha NR, Bei JX, Suetake H, Araki K, Kai W, Kikuchi K, et al. Description of a fugu CXC chemokine and two CXC receptor genes, and characterization of the effects of different stimulators on their expression. Fish Shellfish Immunol 2007;23:1324e32. [33] Oehlers SH, Flores MV, Hall CJ, O’Toole R, Swift S, Crosier KE, et al. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev Comp Immunol 2010;34(3):352e9. [34] Sangrador-Vegas A, Lennington JB, Smith TJ. Molecular cloning of an IL-8-like CXC chemokine and tissue factor in rainbow trout (Oncorhynchus mykiss) by use of suppression subtractive hybridization. Cytokine 2002;17:66e70. [35] Fujiki K, Gauley J, Bols NC, Dixon B. Genomic cloning of novel isotypes of the rainbow trout interleukin-8. Immunogenetics 2003;55:126e31. [36] Chen LC, Chen JY, Hour AL, Shiau CY, Hui CF, Wu JL. Molecular cloning and functional analysis of zebrafish (Danio rerio) chemokine genes. Comp Biochem Physiol B Biochem Mol Biol 2008;151:400e9. [37] Kyritsis N, Kizil C, Zocher S, Kroehne V, Kaslin J, Freudenreich D, et al. Acute inflammation initiates the regenerative response in the adult zebrafish brain. Science 2012;338(6112):1353e6.

[38] Dorward DA, Lucas CD, Rossi AG, Haslett C, Dhaliwal K. Imaging inflammation: molecular strategies to visualize key components of the inflammatory cascade, from initiation to resolution. Pharmacol Ther 2012;135(2): 182e99. [39] Shi X, Zhang Z, Qu M, Ding S, Zheng L. Genomic organization, promoter characterization and expression analysis of the leukocyte cell-derived chemotaxin-2 gene in Epinephelus akaraa. Fish Shellfish Immunol 2012;32(6): 1041e50. [40] Schenk H, Vogt M, Dröge W, Schulze-Osthoff K. Thioredoxin as a potent costimulus of cytokine expression. J Immunol 1996;156(2):765e71. [41] Bertini R, Howard OM, Dong HF, Oppenheim JJ, Bizzarri C, Sergi R, et al. Thioredoxin, a redox enzyme released in infection and inflammation, is a unique chemoattractant for neutrophils, monocytes, and T cells. J Exp Med 1999;189(11):1783e9. [42] Hu YH, Chen L, Sun L. CXCL8 of Scophthalmus maximus: expression, biological activity and immunoregulatory effect. Dev Comp Immunol 2011;35: 1030e7. [43] van der Aa LM, Chadzinska M, Golbach LA, Ribeiro CM, Lidy Verburg-van Kemenade BM. Pro-inflammatory functions of carp CXCL8-like and CXCb chemokines. Dev Comp Immunol 2012;36:741e50. [44] Chen J, Li C, Huang R, Du F, Liao L, Zhu Z, et al. Transcriptome analysis of head kidney in grass carp and discovery of immune-related genes. BMC Vet Res 2012;8:108. [45] Harun NO, Zou J, Zhang YA, Nie P, Secombes CJ. The biological effects of rainbow trout (Oncorhynchus mykiss) recombinant interleukin-8. Dev Comp Immunol 2008;32(6):673e81.