Cloning, expression and functional characterisation of chitinase from larvae of tomato moth (Lacanobia oleracea): a demonstration of the insecticidal activity of insect chitinase

Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050 www.elsevier.com/locate/ibmb

Cloning, expression and functional characterisation of chitinase from larvae of tomato moth (Lacanobia oleracea): a demonstration of the insecticidal activity of insect chitinase Elaine Fitches a, Hillary Wilkinson b, Howard Bell a, David P. Bown b, John A. Gatehouse b,
, John P. Edwards a a

Central Science Laboratory, Department for Environment, Food and Rural Affairs, Sand Hutton, York YO41 1LZ, UK b School of Biological and Biomedical Sciences, University of Durham, Science Laboratories, South Road, Durham DH1 3LE, UK Received 26 April 2004; received in revised form 21 June 2004; accepted 22 June 2004

Abstract Chitinases are vital to moulting in insects, and may also affect gut physiology through their involvement in peritrophic membrane turnover. A cDNA encoding chitinase was cloned from larvae of tomato moth (Lacanobia oleracea), a Lepidopteran pest of crops. The predicted protein contains 553 amino acid residues, with a signal peptide of 20 a.a. Sequence comparison showed 75–80% identity with other Lepidopteran chitinases. L. oleracea chitinase was produced as a functional recombinant enzyme in the yeast Pichia pastoris. A fusion protein containing chitinase joined to the N-terminus of snowdrop lectin (GNA) was also produced, to determine whether GNA could deliver chitinase to the haemolymph of Lepidopteran larvae after oral ingestion. The purified recombinant proteins exhibited similar levels of chitinase activity in vitro. Both proteins were highly toxic to L. oleracea larvae on injection, causing 100% mortality at low dose (2.5 lg/g insect). Injection of chitinase prior to the moult resulted in decreased cuticle thickness. The recombinant proteins caused chronic effects when fed, causing reductions in larval growth and food consumption by up to 60%. The oral toxicity of chitinase was not increased by attaching GNA in the fusion protein, due to degradation in the larval gut, preventing GNA acting as a ‘‘carrier’’. # 2004 Elsevier Ltd. All rights reserved. Keywords: Glycohydrolase; Chitinase; Recombinant expression system; Pichia pastoris; Lepidoptera; Cuticle; Fusion protein; Snowdrop lectin (GNA)

1. Introduction In insects, chitin is a vital component of the cuticle and peritrophic matrix (PM), where it functions as a dynamic and protective structural polysaccharide. Metamorphosis, and growth through ecdysis, is dependent upon the ability of insects to break down and resynthesise chitin-containing structures. Chitin synthesis and degradation is achieved through the tissue-specific expression of chitin synthases and chitinolytic enzymes, both of which have been shown to be under tight
Corresponding author. Tel.: +44-191-334-1264; fax: +44-191-3341201. E-mail address: [email protected] (J.A. Gatehouse).

0965-1748/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2004.06.012

developmental and hormonal control (reviewed by Merzendorfer and Zimoch, 2003). The importance of chitin for insect development and the absence of chitin polymers in vertebrates has led to interest in chitin biosynthesis and turnover as targets for insecticidal molecules, particularly in the development of novel strategies for the protection of crops against insect pests. Insect chitinases belong to family 18 of the glycohydrolase superfamily and are characterised by a multidomain structure with theoretical molecular masses ranging from 40–85 kDa (Kramer and Muthukrishnan, 1997). Chitinases have been cloned from Lepidopteran and Coleopteran insects including tobacco hornworm (Manduca sexta; Kramer et al., 1993), the fall webworm

1038

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

(Hyphantria cunea; Kim et al., 1998), the silkworm (Bombyx mori; Kim et al., 1998), the common cutworm (Spodoptera litura; Shinoda et al., 2001), the yellow mealworm (Tenebrio molitor; Royer et al., 2002), and the spruce budworm (Choristoneura fumiferana; Zheng et al., 2002). The Lepidopteran chitinases all contain a signal peptide, an N-terminal catalytic domain, a PESTlike linker region (enriched in proline, glutamate, serine and threonine), and a cysteine-rich chitin-binding domain (Kramer and Muthukrishnan, 1997). The chitinase from the coleopteran T. molitor has a complex structure, with multiple catalytic and chitin-binding domains. Whilst chitinase activity has been shown to depend on the presence of the catalytic domain alone (Wang et al., 1996; Zhu et al., 2001), the interaction of insect chitinases with chitin in the cuticle and the PM is thought to depend upon the co-ordinated action of the chitin-binding domain and the catalytic domain (Arakane et al., 2003). The developmentally and hormonally controlled expression patterns of insect chitinase genes have been relatively well characterised, in relation to the role of the enzyme in moulting and metamorphosis. However, the potential for chitinase to be used as an insecticide, via disruption of the endogenously controlled turnover of chitin in the PM or cuticle of exposed insects, has not been extensively studied. Wang et al. (1996) reported that a truncated 46 kDa M. sexta chitinase, purified from transgenic tobacco, was toxic to larvae of the merchant grain beetle (Oryzaephilus mercator), causing 100% larval mortality after 6 days when administered orally at a level of 2% (w/w), although this result was based on a single assay of seven larvae. Ding et al. (1998) tested transgenic tobacco expressing the truncated 46 kDa M. sexta chitinase for effects against tobacco hornworm (M. sexta) and budworm (Heliothis virescens) larvae. The survival and growth of budworm larvae, but not hornworm larvae, was significantly reduced when reared on plants expressing chitinase at a level of 0.02–0.03% of total protein. However, larval growth of both species was significantly reduced (compared to controls) when fed on chitinase-expressing plants coated with sub-lethal concentrations of Bacillus thuringiensis toxin. These results from diet and transgenic plant bioassays are suggestive of the potential of insect chitinase as an insecticide, but have not provided full evidence to demonstrate its effectiveness. The present paper reports data confirming the toxicity of insect chitinases, both when injected and when administered orally, which establish that chitinase can be an effective insecticide. An additional aim in this study was to investigate the potential use of snowdrop lectin (GNA) to deliver an attached chitinase enzyme to the haemolymph of orally exposed insects. In previous studies, we have shown that GNA is resistant to gut proteolysis and is

able to deliver attached peptides and proteins to the blood of insects exposed to diets containing recombinant fusion proteins (Fitches et al., 2002, 2004). Using this approach an insect neuropeptide (Manse-AS) and an insect specific spider neurotoxin (SFI1), both nontoxic when ingested in isolation, have been shown to result in toxic effects upon Lepidopteran larvae when ingested as GNA-fusion proteins. Delivery to the haemolymph would allow orally ingested chitinase to act on the cuticle, whereas chitinase in the gut could only affect the peritrophic membrane, and thus the fusion protein might be expected to be more effective as an insecticide than chitinase when delivered orally. Experiments to test this hypothesis are described.

2. Materials and methods 2.1. Insect culture Lacanobia oleracea were reared continuously on artiv ficial diet (Bown et al., 1997) at 25 C under a 16:8 h light:dark regime. 2.2. Materials and general cloning methods Oligonucleotide primers were synthesised by SigmaGenosys Ltd. (www.genosys.co.uk). Sub-cloning was carried out using the TOPO cloning kit (pCR2.1 TOPO vector) purchased from Invitrogen (www.invitrogen.com). Restriction endonucleases and T4 DNA ligase were from Promega (www.promega.com), and plasmid DNA was prepared using Promega Wizard miniprep kits. Standard GNA was obtained from Vector Laboratories Inc. (www.vectorlabs.com) and anti-GNA antibodies, raised in rabbits, were prepared by Genosys Biotechnologies, Cambridge, UK. Rabbit anti-sera raised against the active site of a truncated recombinant M. sexta chitinase (Chi386) were kindly provided by Dr. Subbaratnam Muthukrishnan, Department of Biochemistry, Kansas State University, Manhattan, KS 66506, USA. All DNA sequencing was carried out using dideoxynucleotide chain termination protocols on Applied Biosystems automated DNA sequencers by the DNA Sequencing Service, School of Biological and Biomedical Sciences, University of Durham. Sequences were checked and assembled using Sequencher software (Gene Codes Corporation; www.genecodes.com) running on Mac OS computers. Sequence comparisons to the non-redundant databases were carried out using BlastP software on the NCBI site (www.ncbi.nlm.nih.gov), and sequence alignments for phylogenetic analysis were carried out using DNAStar software (www.lasergene.com). Signal peptide prediction was carried out using SignalP v. 2.0 software

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

(www.cbs.dtu.dk/Services/SignalP-2.0; Nielsen et al., 1997). Domain and motif prediction was carried out using the InterPro database and tools (www.ebi.ac.uk/ interpro).

1039

nucleotide sequence of the chitinase cDNA has been given EMBL accession number AJ620505. 2.4. Cloning, expression, and purification of chitinase and chitinase/GNA constructs

2.3. Isolation and sequencing of chitinase cDNAs A full length chitinase cDNA was amplified from L. oleracea larval cDNA using a rapid amplification of cDNA ends (RACE) strategy. Total RNA was isolated from intact day 3 sixth instar (pre-pupal) L. oleracea larvae ground in liquid nitrogen using TRI-reagent (Sigma; www.sigmaaldrich.com), as described in the protocol supplied. Degenerate primers were designed on the basis of conserved regions within previously cloned insect chitinase genes (residues 139–149 and 369–379, Fig. 1) and used in a PCR experiment to amplify a 750 bp fragment of L. oleracea chitinase cDNA. The product was purified by agarose gel electrophoresis followed by excision of the desired band, extraction of DNA, and cloning into pCR2.1 (see above). Plasmid DNA from a miniprep of a clone containing the PCR product was subjected to DNA sequencing. Sequence data from this partial cDNA clone was subsequently used to design gene-specific primers for the RACE amplifications. One microgram of total RNA was used to prepare 50 and 30 RACE ready cDNA, using a Clontech SMART RACE cDNA amplification kit (www.bdbiosciences.com) and following the manufacturer’s protocols. RACE PCR reactions were subjected to the following v cycles: an initial hold of 94 C for 180 s followed by 25 v v v cycles of: 94 C for 30 s; 50 C for 30 s (60 C for 30 RACE reactions and final full length cDNA amplifiv v cation); and 72 C for 120 s with a final 72 C extension for 300 s. The gene-specific primer 3CHIT (ATGACNTGGGCNATYGAYATGGAYGAYTT) was used to amplify a 30 RACE cDNA fragment of approximately 1200 bp. A 50 RACE product was obtained using the degenerate antisense primer RCHIT (AARTCRTCCATRTCNATNGCCCANGTCAT) to amplify a 50 RACE cDNA of approximately 1200 bp. The amplified products were purified by agarose gel electrophoresis, cloned into pCR2.1 and subjected to DNA sequencing. Several independent clones of each product were sequenced to eliminate possible PCR errors. Finally, a full-length cDNA was amplified from RACE ready cDNA using gene specific primers 50 GSP; ATGAGAGCGATACTAGCGACGTTGGCC and 30 GSP; CTAAGGTTCGCAGTCGTTGCGGTCGGC and sub-cloned into pCR2.1TOPO. Two independent clones were sequenced using both internal and external sequencing primers. The sequences of the various clones were assembled to obtain a fully determined, complete L. oleracea chitinase cDNA sequence. The

The mature L. oleracea chitinase coding sequence (1599 bp) was amplified from RACE derived cDNA (Section 2.3) using primers 50 CHITGAP (CGCTCGAGAAAAGAGAGGCTGAAGCGGACAGCAAAGCG) and 30 CHITGAP (CGGCGGCCGCAGGTTCGC AGTCGTTGCG). Primers contained 50 XhoI and 30 NotI sites to facilitate insertion of the PCR fragment into the yeast expression vector pGAPZaA (Invitrogen). Following gel purification and sub-cloning, the PCR product was digested with XhoI and NotI and ligated into pGAPZaA (similarly digested). The resulting plasmid, chitinase-pGAPZaA, was characterised by sequencing, linearised by digestion with BlnI, and transformed into Pichia pastoris protease A deficient SMD1168H cells (Invitrogen) according to the manufacturer’s recommendations. Positive clones after selection of transformants on zeocin-containing media were identified by colony PCR (Sambrook & Russell, 2001). A chitinase/GNA fusion construct was prepared using a previously generated expression construct SFI1/GNA-pGAPZaA (Fitches et al., 2004) which contained the mature GNA coding sequence (105 residues) derived from LECGNA2 (Van Damme et al., 1991). This construct was restricted with XhoI and NotI to remove the SFI1-encoding sequence and gel purified. The chitinase coding sequence was excised from plasmid chitinase-pGAPZaA by restriction with XhoI and NotI and subsequently ligated into the SFI1/ GNA-pGAPZaA vector (similarly digested) containing the GNA-encoding sequence. The resulting plasmid, chitinase/GNA-pGAPZaA, was characterised by sequencing and transformed into P. pastoris SMD1168H cells. Positive clones were identified as above. For protein overproduction P. pastoris cells containing the chitinase and chitinase/GNA constructs were grown in shake-flasks or a BioFlo 110 laboratory fermenter (New Brunswick Scientific, www.nbs.com) as previously described (Fitches et al., 2004). Protease inhibitor Pepstatin A (Sigma) was added to culture supernatant to a final concentration of 0.7 lg/ml prior to purification of recombinant proteins. Recombinant proteins were purified by phenyl-Sepharose (Amersham-Pharmacia; www.apbiotech.com) chromatography. Columns (25 ml) loaded at 2 ml/min were washed with 2 M NaCl and a salt gradient of 2–0.2 M over 30 min, followed by a gradient of 0.2–0 M over 30 min, was applied. Recombinant proteins eluted at approximately 0.2 M NaCl and were checked for purity by SDS-PAGE. Combined column fractions

1040

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

Fig. 1. L. oleracea chitinase sequence. (A) Diagrammatic representation of chitinase domain structure. Boxed region (amino acids 1–20), signal peptide (predicted by SignalP); shaded region (amino acids 24–376), glycoside hydrolase family 18 domain (InterPro IPR001223/PF00704); boxed and shaded region (amino acids 498–551), chitin-binding peritrophin-A domain (InterPro IPR002557/PF01607). (B) Amino acid sequence of protein encoded by chitinase cDNA AJ 620505. Features as in part (A); additional feature shown boxed in shaded region (amino acids 139–147) corresponds to the motif characteristic of glycoside hydrolases, chitinase active site (InterPro IPR001579/PS01095). The active site catalytic glutamate residue is shown in white text on a black background. The two putative glycosylation site motifs are indicated by dotted boxes. (C) Phylogenetic tree produced by comparison of amino acid sequences of lepidopteran chitinases (Clustal method), and the chitinase gene in the Drosophila genome, which is most similar to them. L. oleracea chitinase is indicated by shading.

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

containing recombinant proteins were de-salted and concentrated using Microsep TM centrifugal concentrators (VivaScience AG, Hannover, Germany). 2.5. Chitinase assay using CM-chitin-RBV as substrate Colorimetric assays of chitinase activity were performed in duplicate using the purple dye-labelled biopolymeric substrate, CM-chitin-RBV (Loewe Biochemica GmbH, Sauerlach, Germany). To compare recombinant enzyme activities with endogenous chitinase activity a crude gut extract was prepared from day 3 sixth stadium L. oleracea larvae. Guts were dissected over ice, homogenised in 50 mM sodium phosphate buffer (pH 7.0) containing pepstatin (0.7 lg/ml) and 1% PMSF (36 mg/ml in EtOH). After centrifugation v (12 000 rpm for 20 min at 4 C) the supernatant was collected. Protein concentrations were estimated by a microtitre-based Bradford assay (Biorad) using BSA as the standard protein. Each enzyme sample (0.5–5 lg for recombinant proteins or 5–10 lg of gut extract) was diluted to 0.1 ml with water and incubated with 0.2 ml of CM-chitin-RBV (1 mg/ml) and 0.2 ml of v 0.2 M sodium phosphate buffer (pH 6.8) at 37 C for 2 h. As a control 0.2 ml of CM-chitin-RBV was mixed with 0.1 ml of distilled water and 0.2 ml of buffer. The reaction was stopped by the addition of 0.2 ml of 1 N HCl. Samples were cooled on ice for 15 min and then v centrifuged (12 000 rpm for 5 min at 4 C) to remove non-degraded substrate. The absorbance of the supernatant was measured at 550 nm. 2.6. pH profile The effect of pH on endogenous and recombinant chitinase activity was studied using 0.5 ml reaction mixture containing 0.2 ml of buffer and 0.2 ml CM-chiv tin-RBV (1 mg/ml) as substrate at 37 C for 2 h. Water was used as a control and samples were analysed in duplicate. The concentration of all buffers was 0.2 M. Buffers used were sodium citrate (pH 4.0–4.5), sodium acetate (pH 4.5–6.0), sodium phosphate (pH 6.0–8.0), and glycine–NaOH (pH 9.0–10.5). 2.7. Temperature profile The optimum temperatures for enzyme activity were investigated by incubating 0.5 ml reaction mixture for 2 h. Reaction mixtures contained 0.2 ml of 0.2 M sodium phosphate buffer pH 7.0, 0.2 ml CM-chitin-RBV (1 mg/ml) substrate and 0.1 ml of enzyme (0.5–5 lg for recombinant proteins or 5–10 lg of gut extract), over the v range of 0–70 C. Water was used as a control and samples were analysed in duplicate.

1041

2.8. Haemagglutination assays Haemagglutination assays were carried out in roundbottomed micro-titre plates. A total volume of 100 ll was used in each well: 50 ll aliquots of serial two-fold dilutions of standard GNA or recombinant chitinase/ GNA fusion protein in PBS and 50 ll of 2% erythrocyte suspension in PBS were incubated for 2–3 h at room temperature. The lowest concentration required to completely agglutinate the red blood cells was determined visually. 2.9. Electrophoresis and western blotting Proteins were separated by SDS-PAGE (La¨emmli, 1970). Samples were prepared, run on SDS-gels, and stained or transferred to nitrocellulose as previously described (Fitches et al., 2004). Western blotted, purified chitinase/GNA was analysed for concentration and reactivity with anti-GNA antibodies as previously described (Fitches and Gatehouse, 1998). Reactivity of both recombinant proteins with anti-chitinase antibodies (Chi386) was carried out using Bo¨ehringer blocking reagent and Tris buffered saline (TBS containing 0.05% (v/v) Tween-20) as antisera buffer. Blots were incubated overnight with antiChi386 (1:3000 dilution) and processed as previously described (Fitches and Gatehouse, 1998). Endogenous expression of chitinase was analysed by SDS-PAGE separation of cuticular proteins prepared from staged L. oleracea larvae, followed by western blotting using anti-chitinase antibodies. Cuticle and pupal extracts were prepared as described for gut extract preparation in Section 2.5. 2.10. Injection bioassays Purified chitinase and FP were tested for in vivo biological activity by injecting 5–10 ll of aqueous samples containing various concentrations of protein (0.125–5 lg) into L. oleracea larvae of approximately 50–70 mg in weight. In order to compare effects of chitinase injections upon pre-moult and newly moulted insects, clear head capsule (CHC) fourth stadium and day 1 fifth stadium larvae were injected. The concentration of injected proteins was based on SDS-PAGE analysis. For each concentration tested 10 larvae were injected and effects upon survival and weight gain were monitored over the next 48 h. GNA has previously been shown to have no acute effect when injected into L. oleracea larvae (Fitches et al., 2004) and so distilled water was injected as a control.

1042

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

2.11. Preparation of transverse sections of injected larvae for analysis of cuticle integrity by light microscopy CHC fourth stadium larvae injected with water or recombinant proteins (2.5 lg/g insect) were sacrificed 24 h post injection and samples were prepared for light microscopy in the following manner: following the removal of head capsules and lower abdomens (over ice) insects were placed in fixative (4% paraformaldehyde v/v; 1.25% glutaraldehyde v/v) for 24 h. Samples were dehydrated at room temperature by 2 h incubations in a graded alcohol series (12.5%; 25%; 50%; 75%) with a final overnight absolute ethanol incubation. Specimens were infiltrated at room temperature for 24 h with a 50:50 LR White Resin (medium grade acrylic Resin, London Resin Co, Ltd.): ethanol mix followed by infiltration for 4 days with 100% LR White Resin with daily changes of resin. Specimens were embedded overnight in gelatin capsules containing v fresh LR White Resin at 55 C. Semi-thin (1 lm) transverse sections were cut (Leica, Reichert Ultracut 5 microtome) and mounted on glass slides. After airdrying on a hot plate sections were stained with 0.1% (w/v) toluidine blue (EBS Sciences). High power (40 magnification) digital images of the insect cuticle were taken (Nikon OPTIPHOT-2; Nikon COOLPIX 950) from sections prepared from control (water), chitinase, and chitinase/GNA-injected larvae. Ten images were taken from each of three comparable sections (derived from different larvae) for each treatment. Image J software (http://rsb.info.nih.gov/ ij/) was used to set a scale (using an image of a calibration slide of 40 magnification) and to take measurements of cuticle width (10 per image). Care was taken to select comparable images of the cuticle from control and experimental sections i.e., convoluted regions of highly variable cuticular thickness were not included in the analysis. Measurements were analysed for significant differences between treatments (Section 2.14). 2.12. Fluorescent wheat germ agglutinin (WGA) labelling of semi-thin sections Larval semi-thin transverse sections were air-dried and blocked in PGA blocking buffer (0.2% v/v gelatin, 0.5% w/v BSA in phosphate buffered saline; PBS) for 3 h at room temperature. Sections were incubated in PBS containing 50 lg/ml fluorescent (F)-WGA (Vector Labs) for 16 h at room temperature. Unbound FWGA was removed by several rinses in PBS. Air-dried sections were mounted in Vectashield mounting medium (Vector Labs) and F-WGA binding was visualised using a fluorescence microscope (Nikon OPTIPHOT-2).

2.13. Artificial diet bioassays Due to the instability of chitinase and chitinase/ GNA in our standard leaf-based diet recombinant proteins in aqueous solution were added directly to freezedried tobacco leaf powder (400 ll per 0.1 g leaf). For each treatment 20 larvae were maintained in clear plastic pots (five larvae per pot) containing moist filter paper to prevent diet desiccation. Newly moulted fourth stadium larvae were exposed to recombinant proteins at a concentration of approximately 2 mg/5 g wet weight of diet for 6 days. The amount of recombinant proteins added to the diet was based on SDSPAGE analysis. The control diet was freeze-dried tobacco leaf powder with the addition of distilled water. Larval wet weights (0.1 mg) were recorded before, during and after exposure to treatments, and diet consumption was estimated on a wet weight basis. At the termination of the bioassay gut, gut contents, and haemolymph samples were taken and examined for the presence of GNA and/or chitinase by western blotting as described in Section 2.9. 2.14. Statistical analysis All data analysis was carried out using the Statview (v. 5.0; SAS Inc., Carey, NC, USA) software packages on Apple Macintosh computers. ANOVA analysis (Bonferroni–Dunn) was carried out to determine any significant differences between treatments in the parameters measured. 3. Results 3.1. Isolation of a cDNA encoding a chitinase gene from L. oleracea larvae Degenerate primers corresponding to conserved residues of aligned insect chitinase sequences were used in RT-PCR reactions to amplify a 750 bp product from pre-pupal L. oleracea RNA. The amplified product contained an open reading frame (ORF), which was compared to proteins in the GenBank database using BlastP. The amplified sequence had greatest similarity to insect chitinase enzymes. Primers designed from regions of the 750 bp amplification product were used in rapid amplification of cDNA ends (RACE) PCR reactions to retrieve 50 and 30 ends of the cDNA. Sequences were determined from multiple independent clones and verified by reamplifying the complete sequence using gene-specific primers. The full-length cDNA was 2437 bp in length and included a 50 untranslated region of 99 bp and a 30 untranslated region of 676 bp. The longest ORF is of 1662 bp (Fig. 1A,B). Analysis of the sequence using SignalP software predicts a signal peptide of 20 amino acids,

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

resulting in a predicted mature polypeptide of 533 amino acids, Mr 59 825. The protein has two predicted N-glycosylation sites (N-X-S/T) located at amino acid residues 86–88 and 304–307 (Fig. 1B). Sequence similarity searches of GenBank using BlastP found this protein to have greatest similarity to Lepidopteran chitinases; strongest similarity was observed to chitinases from Spodoptera litura, Helicoverpa armigera, and Hyphantria cunae (85%, 81%, and 79% identity, respectively). A sequence comparison of all the Lepidopteran chitinase sequences and the most similar chitinase predicted by the Drosophila melanogaster genome is shown as a phylogenetic tree in Fig. 1C. The Drosophila genome contains 17 genes, which are either known chitinases or are similar in sequence, but the Lepidopteran chitinases are all more similar to Drosophila gene CG9307 than to any other Drosophila chitinase. This comparison defines CG9307 and the Lepidopteran chitinases as a distinct group of related proteins. Comparison of the L. oleracea chitinase sequence against the Interpro database showed the three domain structure, consisting of a catalytic region (glycohydrolase family 18 chitinase domain), a PESTlike linker region, and a cysteine-rich region (peritrophin A chitin-binding domain), typical of insect chitinases (Kramer and Muthukrishnan, 1997). Also depicted in Fig. 1B is the presence of the highly conserved sequence (FDGLDLDWEYP) found in insect chitinases. This sequence is consistent with the glycohydrolase family 18 active site signature (Van Scheltinga et al., 1994; Choi et al., 1997; De la Vega et al., 1998) and has been shown to be essential for enzyme activity (Huang et al., 2000; Lu et al., 2002; Royer et al., 2002).

1043

SDS-PAGE using known amounts of molecular weight markers as standards. Recombinant proteins were purified by hydrophobic interaction chromatography on phenyl-Sepharose (Fig. 2). Despite the use of a protease-deficient yeast expression host strain, the recombinant proteins were susceptible to proteolytic cleavage, with fragmentation of a proportion of the original intact protein being observed in all the samples prepared. Purified recombi-

3.2. Expression and purification of recombinant chitinase and chitinase/GNA Constructs encoding the mature L. oleracea chitinase enzyme, and a chitinase/GNA fusion protein in which chitinase is fused to the N-terminus of mature GNA (residues 1–105) via a 3 amino acid linker peptide were prepared and cloned into the expression vector pGAPZaA. The sequence coding for GNA in chitinase/GNA omitted the C-terminal extension removed from the protein in planta; this truncated form of GNA has been shown to be fully active as a lectin (Longstaff et al., 1998). The predicted protein products were arranged in frame with the yeast a-factor N-terminal secretory signal. Sequenced clones were transformed into competent protease A deficient P. pastoris cells, and transformed colonies were selected on zeocin containing media. Constitutive expression of recombinant proteins after cultivation in a bench-top fermenter gave respective yields of 0.5–2 mg/l culture and 2–5 mg/l culture for chitinase and chitinase/GNA as assessed following chromatographic purification by

Fig. 2. (i) SDS-PAGE (10% acrylamide gel) analysis of (A) recombinant chitinase, and (B) recombinant chitinase/GNA, after purification by hydrophobic interaction chromatography (gel stained for total protein). Intact chitinase and FP proteins are denoted with an arrow and samples (5–10 lg) are loaded in duplicate. The molecular weight scales are taken from two standard marker protein mixtures (SDS-7 & M0671, Sigma). (ii) Analysis of purified (A) recombinant chitinase and (B and C) recombinant chitinase/GNA by SDS-PAGE (10% acrylamide gel) and western blotting. Blots (A) and (B) were probed with anti-chitinase antibodies, and blot (C) with anti-GNA antibodies. Intact chitinase and chitinase/GNA fusion proteins are denoted with an arrow. The molecular weight scales are taken from two standard marker protein mixtures (SDS-7 & M0671, Sigma).

1044

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

nant chitinase gives a single major band after analysis by SDS-PAGE, at the predicted molecular weight of approximately 60 kDa (Fig. 2(i)A). This polypeptide reacted positively with anti-chitinase antibodies (Fig. 2(ii)A). The anti-chitinase antibody also reacted with smaller polypeptides in the molecular weight range 36–50 kDa (Fig. 2(ii)A) representing cleavage products that contained the active site region. The chitinase primary antibody used was raised against a truncated form of M. sexta chitinase (Chi386 contains the entire catalytic domain; Arakane et al., 2003). Hence, this antibody reacts with both intact and cleaved recombinant protein. SDS-PAGE analysis of recombinant chitinase/ GNA fusion protein in Fig. 2(i)B shows a major polypeptide of molecular weight approximately 72 kDa, with smaller and less abundant polypeptides of approximately 45 and 30 kDa. The predicted molecular weight of the chitinase/GNA is 70.5 kDa, and thus the major band is the correct size (within the accuracy of SDS-PAGE) to be the intact fusion polypeptide. In confirmation, the 72 kDa polypeptide exhibits immunoreactivity with both anti-chitinase (Fig. 2(ii)B) an anti-GNA (Fig. 2(ii)C) antibodies. Like recombinant chitinase, the fusion protein contains smaller polypeptides resulting from proteolytic cleavage; western blotting of chitinase/GNA shows anti-chitinase immunoreactivity with a smaller molecular weight poly-peptide (approximately 60 kDa). The size of this polypeptide and its lack of immunoreactivity with antiGNA antibodies (Fig. 2(ii)C) suggests that it is chitinase from which the GNA domain has been cleaved. The chitinase/GNA fusion protein is also cleaved within the

chitinase sequence, since western blots show at least eight smaller (<45 kDa) cleavage products that react with positively with anti-GNA antibodies but not antichitinase antibodies (Fig. 2(ii)C). As GNA itself is known to exert no acute detrimental effects when injected into or orally ingested by fourth or fifth stadium L. oleracea larvae (Fitches et al., 2002, 2004) the presence of these cleavage products containing a functional GNA domain but a cleaved chitinase is unlikely to interfere with subsequent insect bioassays. Approximately 20 mg of recombinant proteins were produced for use in subsequent assays. Recombinant chitinase/GNA required a ten-fold higher concentration to agglutinate rabbit erythrocytes, as compared to GNA. This considerably decreased agglutination activity may be caused by steric interference, due to the presence of the large chitinase moiety attached to the N-terminal of the GNA domain. 3.3. In vitro chitinase activity Purified recombinant chitinase and chitinase/GNA fusion protein were shown to exhibit chitinase activity using a colorimetric substrate, CM-chitin-RBV. Both proteins consistently exhibited similar levels of activity according to protein concentration estimates based on SDS-PAGE, giving an increase in absorbance at 550 nm of 0.25/lg protein. This indicated that the presence of GNA in chitinase/GNA did not interfere with the activity of the attached chitinase. A protein extract prepared from pre-pupal L. oleracea larval guts was used to compare activity versus pH and temperature with recombinant proteins. The pH profiles (Fig. 3A) for all

Fig. 3. Effect of (A) pH and (B) temperature on activities of L. oleracea gut extract, recombinant chitinase, and recombinant chitinase/GNA expressed as a percentage of maximum increase in absorbance at 550 nm using CM-chitin RBV as a substrate.

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

1045

three forms of insect chitinase exhibited similar broad pH optima between pH 5 and 9. Equally all three forms of insect chitinase displayed a similar temperature dependance on their enzyme activities (Fig. 3B). Enzyme activities increased with temperature from 0 to v 40–50 C and decreased sharply at temperatures above v v 50 C. An optimum temperature of 40 C for recombinant enzyme activity was lower than the optimum temv perature of 50 C recorded for endogenous enzyme activity. This difference in stability is likely to be due to the protective effects of other proteins present in the gut extract, which will result in a higher protein concentration in the assay. 3.4. Toxicity of proteins after injection into the haemolymph As depicted in Fig. 4(A) during the normal processes of moulting and metamorphosis in lepidopteran larvae, chitinase is synthesised immediately prior to moulting, and at the pre-pupal stage; the enzyme is not present immediately after the moult. The effects of injected chitinase were thus assessed both at a stage when the enzyme is normally present, by injecting larvae exhibiting a clear head capsule (CHC) immediately prior to moulting, and when it is not normally present by injecting larvae on day 1 after moulting. CHC fourth stadium and day 1 fifth stadium L. oleracea larvae (50– 70 mg) were injected with purified recombinant chitinase and chitinase/GNA. Control insects were injected with distilled water only. Injections of amounts of recombinant chitinase or chitinase/GNA in the range 4–70 lg/g insect resulted in 100% larval mortality in 24 h (40 larvae injected per treatment). In order to examine the effects of chitinase on the integrity of the cuticle larvae were injected at a lower dose of 2.5 lg protein per gram insect. At this lower dose, mortality of insects injected with chitinase or chitinase/GNA was comparable to controls up to 24 h after injection, but all experimental insects were dead by 48 h after injection (control survival 96%; 25 larvae injected per treatment). At this concentration chitinase had a greater effect upon larvae than chitinase/GNA. All fourth stadium CHC larvae injected with water moulted to the fifth stadium, but a successful moult to fifth instar was observed for only 66% and 85% of larvae injected with chitinase and chitinase/GNA, respectively. Qualitatively similar effects were also observed in change in mean larval weight over the 24 h period. Control (water injected) insects showed only a relatively small increase in mean larval weight if injected at the CHC stage, reflecting deferred feeding during the moulting process (Fig. 4). In comparison both experimental treatments exhibited a reduction in mean larval weight 24 h post injection, which was greater for chitinase than for chitinase/GNA-injected insects. Control

Fig. 4. (A) Analysis of endogenous chitinase expression in cuticle extracts prepared from staged L. oleracea larvae by SDS-PAGE (10% acrylamide gel) and western blotting using anti-chitinase antibodies. (B) Change in mean weight (as a percentage of initial weight) of IV stadium (CHC) and day 1 V stadium larvae 24 h after injection of chitinase (Chit) or FP (2.5 lg/g insect).

denotes significant differences (mean larval weights) between chitinase and control, and chitinase and FP treatments, and
denotes significant differences between FP and control, and FP and chitinase treatments (ANOVA; P < 0:05, 25 larvae injected per treatment).

insects injected at day 1 fifth stadium increased in weight by approximately 90% in 24 h, but larvae injected with chitinase increased in weight by only approximately 40%, compared to an increase of approximately

1046

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

80% for the chitinase/GNA treatment. Differences in mean larval weights between control and both experimental treatments were significant for injected CHC fourth stadium larvae, but were only significant between chitinase and control, and chitinase and chitinase/GNA-injected fifth stadium larvae (Fig. 4; ANOVA; P < 0:05, n ¼ 25). 3.5. Effects of chitinase and FP injections upon the integrity of the larval cuticle Semi-thin sections were prepared from control and experimental insects to determine whether the injection of chitinase or chitinase/GNA affected the thickness or integrity of the chitin layer in the cuticle in L. oleracea larvae. Sections were prepared from larvae that had been injected at the CHC stage immediately prior to moulting from the fourth stadium, and had successfully moulted to the fifth stadium. Fluorescent-WGA labelling was used to visualise chitin in the cuticular layers. Toluidine blue-stained sections were used to visualise the cuticular layer and the sub-cuticular epidermal layer and to take measurements of cuticle width. In both toluidine blue-stained (Fig. 5A–D) and lectinlabelled sections (Fig. 5E–H), the exo- and endocuticular layers of chitinase-injected insects appeared considerably narrower than corresponding layers in control sections. In stained sections the subcuticular epidermal cell layer appeared to be narrower and composed of smaller cells as compared to control sections. These differences were not apparent for chitinase/ GNA-injected samples. No obvious differences between treatments in the integrity of the epi-cuticle were observed. Subsequently, measurements of the combined exo- and endo-cuticle width were taken from high power digital images using Image J software (Fig. 5C and D). Sections from three insects per treatment were used for analysis and 10 measurements were taken from each of six images. Representative sections are shown in Fig. 5A–D. The mean cuticle width of chitinase-injected samples was found to be significantly smaller (ANOVA, P < 0:0001, n ¼ 180 per treatment) than that measured from both control and chitinase/ GNA-injected sections. Respective means were 4.38 lm (SE 0.087), 6.15 lm (SE 0.122), and 6.33 lm (SE 0.145), for chitinase, chitinase/GNA, and control treatments. This effect of chitinase on the cuticle was not observed in insects injected at day 1 of the fifth stadium, suggesting that the injected chitinase is more effective in interfering with chitin deposition than in attacking a preformed chitin layer. 3.6. Toxicity of proteins delivered orally Newly eclosed fourth stadium tomato moth larvae were exposed to diet containing recombinant chitinase

and recombinant chitinase/GNA at approximately 2% of dietary protein. Both chitinase and chitinase/GNA caused a significant (P < 0:0001, n ¼ 20) reduction in L. oleracea larval weight gain and consumption, compared to control-fed insects, throughout the assay period. GNA at these dietary levels has previously been shown to have no significant effect upon L. oleracea larval growth or consumption (Fitches et al., 2004). Both chitinase and chitinase/GNA had similar effects in this assay. By day 6 the mean weights of chitinasefed and chitinase/GNA-fed insects were 60% and 56% lower, respectively, than the mean weight of controlfed larvae. Consumption paralleled larval weight gain. Total consumption of diet by chitinase-fed and chitinase/GNA-fed larvae was 66% and 60% lower, respectively, than the total amount of diet consumed by control-fed larvae. Thus, the addition of GNA to chitinase conferred no increase in insecticidal effects against orally exposed L. oleracea larvae when compared to chitinase alone. Western blotting of dissected tissues indicated that degradation of the fusion protein in the guts of larvae-fed chitinase/GNA had occurred. GNA and GNA immunoreactive proteins (molecular weight of 14–24 kDa), but not chitinase or intact chitinase/GNA fusion protein, were detected in the guts and blood of these insects (results not shown).

4. Discussion Recombinant chitinase and a chitinase/GNA fusion protein were produced using a Pichia expression system and purified by hydrophobic interaction chromatography (Fig. 2). Previous studies using tobacco transformed with a M. sexta chitinase gene with a predicted molecular weight of 85 kDa (Wang et al., 1996; Ding et al., 1998) showed that plants expressed a truncated, less active 46 kDa chitinase as a result of proteolysis in planta. Similarly considerable problems were encountered with cleavage of our recombinant proteins during production and purification. Despite this, preparations where the major component was uncleaved protein, and which exhibited similar chitinase specific activities were obtained. The injection of recombinant proteins was acutely toxic at low doses to both pre-moult and newly moulted insects. Earlier studies using a recombinant spider toxin, SFI1, showed that the injection of 60–90 lg of SFI1 per gram of insect resulted in 100% L. oleracea larval mortality 48 h post injection. Chitinase is at least tenfold more effective as an insecticidal protein, since injection of only 2.5 lg/g insect resulted in 100% mortality after 48 h and, at higher concentrations (5–70 lg/g insect) 100% mortality was observed 24 h after injection. The chitinase/GNA fusion protein was comparable in toxicity when injected, establishing that the fusion protein has full chitinase activity. If the

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

1047

Fig. 5. Representative digital images of semi-thin transverse sections prepared from newly moulted control-injected (A, C, E, and F), and chitinase-injected (B, D, F, and H) insects. A–D are toluidine blue-stained sections; A and B are low power images (4) with 200 lm scale bars and C and D are high power images (40) with 20 lm scale bars. E–H are fluorescent images of WGA stained sections; E and F (10 magnification) with 5 lm scale bars, and G and H are high power (40) images with 20 lm scale bars. Sections were prepared as in Section 3.5. Arrows in A and B depict the insect cuticular layer and M adjoining arrows in C and D depict measurements of cuticle width taken using Image J software and analysed for significant differences between treatments. The mean cuticle width of chitinase-injected samples was significantly smaller than that of control and FP treatments (ANOVA; P < 0:0001, n ¼ 180 per treatment).

1048

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

fusion protein delivered chitinase to the blood of insects following oral ingestion, it would have the potential to be significantly more toxic than chitinase alone. Observations from semi-thin transverse sections probed with fluorescent chitin-binding WGA or stained with toluidine blue indicated that the injection of chitinase immediately prior to the moult at a low level caused a reduction in the thickness of the cuticular chitin layer. However, similar injections of chitinase/ GNA had only a marginal effect on the cuticle, although the fusion protein was till acutely toxic. Similarly, insects injected with chitinase alone showed a greater reduction, both in ability to moult and in mean larval weight, as compared to fusion-injected insects 24 h after injection. It is possible that chitinase and chitinase/GNA may differ in their effects on chitin deposition. A chitinase-induced reduction in the integrity of the supportive chitinous cuticle would presumably inhibit larval mobility and feeding. GNA is known to bind to L. oleracea haemocytes (Fitches, 1999) and fat bodies (Fitches et al., 2001) and the chitinase/GNA fusion protein may be less able to access chitin in the cuticle, as compared to chitinase alone, due to restrictive binding of GNA to other larval tissues. Whilst the mode of action has not been fully clarified, this is the first report showing damage to the cuticle of a lepi-

dopteran larvae induced by the injection of a recombinant chitinase. The results presented in this paper have shown that, in this case, the N-terminal linkage of GNA to chitinase confers no increased insecticidal activity towards larvae as compared to chitinase alone. Oral exposure of fourth stadium insects for 6 days at 2% dietary protein resulted in highly similar reductions in larval weight gain and diet consumption for both chitinase and chitinase/GNA treatments (Fig. 6A and B). Since analysis of gut contents showed that orally ingested chitinase/ GNA fusion protein had been proteolytically cleaved, this result is not surprising. As a result of proteolysis, oral delivery of chitinase to the blood by GNA was not observed, although GNA and GNA immunoreactive fragments were detectable in the haemolymph of insects fed the chitinase/GNA fusion. The observed insecticidal activity of both recombinant proteins following oral ingestion was thought to be due, at least in part, to chitinase mediated disruption of the chitin containing PM. In this respect the results are similar to previous studies showing significant reductions in the survival of the merchant grain beetle fed diet containing M. sexta chitinase (Wang et al., 1996) and reductions in the survival and growth of H. virescens exposed to chitinase-expressing tobacco plants (Ding et al., 1998).

Fig. 6. (A) Mean weight of fourth stadium L. oleracea larvae during exposure to control diet; diet containing recombinant chitinase (2 mg/5 g diet); and diet containing recombinant FP (2 mg/5 g diet) for 6 days. Error bars show means  SE; (n ¼ 20 per treatment). (B) Total daily diet consumption estimated for larvae exposed to diets depicted in (A).

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

In conclusion, injection studies have indicated that a recombinant chitinase/GNA fusion has potential to significantly enhance the insecticidal effects of chitinase, if delivered to the blood of orally exposed insects. In this instance susceptibility of the fusion protein to cleavage in the guts of exposed larvae prevented delivery of the enzyme to the blood. However, the potential use of chitinase/GNA to control insects such as aphids that are known to have little, if any, gut proteolytic activity would still be feasible. Studies to investigate the potential use of this fusion protein for crop protection against Homopteran pests are currently in progress.

Acknowledgements The authors thank Dr. Subbaratnam Muthukrishnan, Department of Biochemistry, Kansas State University, Manhattan, KS 66506, USA for the kind provision of anti-chitinase antibodies, and Mrs. Christine Richardson for assistance with microscopy. This work was supported by the Pesticides Safety Directorate of the Department for Environment, Food and Rural Affairs.

References Arakane, Y., Zhu, Q., Matsumiya, M., Muthukrishnan, S., Kramer, K.J., 2003. Properties of catalytic, linker and chitin-binding domains of insect chitinase. Insect Biochemistry and Molecular Biology 33, 631–648. Bown, D.P., Wilkinson, H.S., Gatehouse, J.A., 1997. Differentially regulated inhibitor sensitive and insensitive protease genes from the phytophagous insect pest Helicoverpa armigera, are members of complex multi-gene families. Insect Biochemistry and Molecular Biology 27 (7), 625–638. Choi, H.K., Choi, K.H., Kramer, K.J., Muthukrishnan, S., 1997. Isolation and characterisation of a genomic clone for the gene of an insect molting enzyme, chitinase. Insect Biochemistry and Molecular Biology 27, 37–47. De la Vega, H., Specht, C.A., Liu, Y., Robbins, P.W., 1998. Chitinases are a multi-gene family in Aedes, Anopheles and Drosophila. Insect Molecular Biology 7, 233–239. Ding, X., Gopalakrishnan, B., Johnson, L.B., White, F.F., Wang, X., Morgan, T.D., Kramer, K.J., Muthukrishnan, S., 1998. Insect resistance of transgenic tobacco expressing an insect chitinase gene. Transgenic Research 7, 77–84. Fitches, E., 1999. The mechanisms of action of insecticidal lectins from snowdrop (GNA) and jackbean (Concanavalin A) on tomato moth larvae. PhD thesis, University of Durham, UK. Fitches, E., Gatehouse, J.A., 1998. A comparison of the short and long term effects of insecticidal lectins on the activities of soluble and brush border enzymes of tomato moth larvae (Lacanobia oleracea). Journal of Insect Physiology 44, 1213–1224. Fitches, E., Woodhouse, S., Edwards, J.P., Gatehouse, J.A., 2001. In vitro and in vivo binding of snowdrop (Galanthus nivalis agglutinin; GNA) and jackbean (Canavalia ensiformis; Con A) lectins within tomato moth (Lacanobia oleracea) larvae; mechanisms of insecticidal action. Journal of Insect Physiology 47, 777–787.

1049

Fitches, E., Audsley, N., Gatehouse, J.A., Edwards, J.P., 2002. Fusion proteins containing neuropeptides as novel insect control agents: snowdrop lectin delivers fused allatostatin to insect haemolymph following oral ingestion. Insect Biochemistry and Molecular Biology 32, 1653–1661. Fitches, E., Edwards, M.J., Mee, C., Grishan, E., Gatehouse, A.M.R., Edwards, J.P., Gatehouse, J.A., 2004. Fusion proteins containing neurotoxins as insect control agents: snowdrop lectin delivers fused insecticidal spider venom neurotoxin to insect haemolymph following oral ingestion. Journal of Insect Physiology 50, 61–71. Huang, X., Zhang, H., Zen, K.-C., Muthukrishnan, S., Kramer, K.J., 2000. Homology modelling of the insect chitinase catalytic domain-oligosaccharide complex and the role of a putative active site tryptophan in catalysis. Insect Biochemistry and Molecular Biology 30, 107–117. Kim, M.G., Shin, S.W., Bae, K.-S., Kim, S.C., Park, H.-Y., 1998. Molecular cloning of chitinase cDNAs from the silkworm, Bombyx mori and the fall webworm, Hyphantria cunae. Insect Biochemistry and Molecular Biology 28, 163–171. Kramer, K.J., Muthukrishnan, S., 1997. Insect chitinases: molecular biology and potential use as biopesticides. Insect Biochemistry and Molecular Biology 27 (11), 887–900, (Mini-review). Kramer, K.J., Corpuz, L., Choi, H., Muthukrishnan, S., 1993. Sequence of a cDNA and expression of the genes encoding epidermal and gut chitinases of Manduca sexta. Insect Biochemistry and Molecular Biology 23, 691–701. La¨emmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of Bacteriophage T4. Nature 227, 680–685. Longstaff, M., Powell, K., Gatehouse, J.A., Raemaekers, R., Newell, C.A., Hamilton, W.D.O., 1998. Production and purification of active snowdrop lectin in Escherichia coli. European Journal of Biochemistry 252, 59–65. Lu, Y., Zen, K.C., Muthukrishnan, S., Kramer, K.J., 2002. Sitedirected mutagenesis and functional analysis of active site acidic amino acid residues D142, D144 and E146 in Manduca sexta (tobacco hornworm) chitinase. Insect Biochemistry and Molecular Biology 32, 1369–1382. Merzendorfer, H., Zimoch, L., 2003. Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. Journal of Experimental Biology 206, 4393–4412, (Review). Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 1–6. Royer, V., Fraichard, S., Bouhin, H., 2002. A novel putative insect chitinase with multiple catalytic domains: hormonal regulation during metamorphosis. Biochemical Journal 366, 921–928. Sambrook, J., Russell, D.W., 2001. Molecular cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory, Spring Harbor, New York. Shinoda, T., Kobayashi, J., Matsui, M., Chinzei, Y., 2001. Cloning and functional expression of a chitinase cDNA from the common cutworm, Spodoptera litura, using a recombinant baculovirus lacking the virus encoded chitinase gene. Insect Biochemistry and Molecular Biology 31, 521–532. Van Damme, E.J.M., De Clercq, N., Claessens, F., Hemschoote, K., Peeters, B., Peumans, W.J., 1991. Molecular cloning and characterisation of multiple isoforms of the snowdrop (Galanthus nivalis L.) lectin. Planta 186, 35–43. Van Scheltinga, A.C.T., Kalk, K.H., Beintema, J.J., Dijkstra, B.W., 1994. Crystal structure of hevamine, and its complex with an inhibitor. Structure 2, 1181–1189. Wang, X., Ding, X., Gopalakrishnan, B., Morgan, T.D., Johnson, L., White, F.F., Muthukrishnan, S., Kramer, K.J., 1996. Characterisation of a 46 kDa insect chitinase from transgenic tobacco. Insect Biochemistry and Molecular Biology 2610, 1055–1064.

1050

E. Fitches et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1037–1050

Zheng, Y., Zheng, S., Cheng, X., Ladd, T., Lingohr, E.J., Krell, P.J., Arif, B.M., Retnakaran, A., Feng, Q., 2002. A molt associated chitinase cDNA from the spruce budworm, Choristoneura fumiferana. Insect Biochemistry and Molecular Biology 32, 1813–1823.

Zhu, X., Zhang, H., Fukamizo, T., Muthukrishnan, S., Kramer, K.J., 2001. Properties of Manduca sexta chitinase and its C-terminal deletions. Insect Biochemistry and Molecular Biology 31, 1221–1230.