- Email: [email protected]
Cloning, expression, and purification of a recombinant Tat-HA-NR2B9c peptide
Protein Expression and Purification 85 (2012) 239–245
Contents lists available at SciVerse ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Cloning, expression, and purification of a recombinant Tat-HA-NR2B9c peptide Hai-Hui Zhou, Ai-Xia Zhang, Yu Zhang, Dong-Ya Zhu ⇑ Laboratory of Cerebrovascular Disease, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Nanjing Medical University, Nanjing 210029, China
a r t i c l e
i n f o
Article history: Received 3 August 2012 and in revised form 15 August 2012 Available online 25 August 2012 Keywords: Tat-HA-NR2B9c Cloning Expression Purification Cerebral ischemic injury Neuroprotection
a b s t r a c t To design a peptide disrupting the interaction between N-methyl-D-aspartate receptors-2B (NR2B) and postsynaptic density protein-95 (PSD-95), a gene fragment encoding a chimeric peptide was constructed using polymerase chain reaction and ligated into a novel expression vector for recombinant expression in a T7 RNA polymerase-based expression system. The chimeric peptide contained a fragment of the cell membrane transduction domain of the human immunodeficiency virus type1 (HIV-1) Tat, a influenza virus hemagglutinin (HA) epitope-tag, and the C-terminal 9 amino acids of NR2B (NR2B9c). We named the chimeric peptide Tat-HA-NR2B9c. The expression plasmid contained a gene fragment encoding the Tat-HA-NR2B9c was ligated to the C-terminal fragment of L-asparaginase (AnsB-C) via a unique acid labile Asp-Pro linker. The recombinant fusion protein was expressed in inclusion body in Escherichia coli under isopropyl b-D-1-thiogalactopyranoside (IPTG) and purified by washing with 2 M urea, solubilizing in 4 M urea, and then ethanol precipitation. The target chimeric peptide Tat-HA-NR2B9c was released from the fusion partner following acid hydrolysis and purified by isoelectric point precipitation and ultrafiltration. SDS–PAGE analysis and MALDI-TOF-MS analysis showed that the purified Tat-HA-NR2B9c was highly homogeneous. Furthermore, we investigated the effects of Tat-HA-NR2B9c on ischemia-induced cerebral injury in the rats subjected to middle cerebral artery occlusion (MCAO) and reperfusion, and found that the peptide reduced infarct size and improved neurological functions. Ó 2012 Elsevier Inc. All rights reserved.
Introduction Stroke is a major public disease leading to high rates of death and disability in adults [1,2]. Excessive stimulation of N-methyl1 D-aspartate receptors (NMDARs) and the resulting neuronal nitric oxide synthase (nNOS) activation are crucial for neuronal injury after stroke insult [3,4]. Because NMDARs has a dual role in both normal and abnormal function in brain, directly blocking NMDARs has failed as a clinical stroke therapy [5]. NMDAR complexes containing NR2B facilitate cell death signaling whereas NR2A-containing NMDARs promote neuronal survival [6,7]. An alternative strategy is to block downstream of NMDAR/PSD-95/nNOS excitotoxic signal without interference with physiological function of NMDARs. PSD-95 binds the COOH-terminal tSXV motif of NMDAR ⇑ Corresponding author. Address: Department of Pharmacology, School of Pharmacy, Nanjing Medical University, Nanjing 210029, China. Fax: +86 25 86862818. E-mail address: [email protected] (D.-Y. Zhu). 1 Abbreviations used: AnsB-C, C-terminal fragment of L-asparaginase; NMDARs, Nmethyl-D-aspartate receptors; NR2B, N-methyl-D-aspartate receptors-2B; PSD-95, postsynaptic density protein-95; Tat, cell membrane transduction domain of the human immunodeficiency virus type 1; HA, hemagglutinin; nNOS, neuronal nitric oxide synthase; MCAO, middle cerebral artery occlusion; E. coli, Escherichia coli; IPTG, isopropyl b-D-1-thiogalactopyranoside; SDS–PAGE, sodium dodecyl sulfate– polyacrylamide gel electrophoresis; TTC, 2,3,5-triphenyltetrazolium chloride. 1046-5928/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pep.2012.08.011
NR2 subunits as well as nNOS [8,9]. Tat-NR2B9c, a peptide that uncouples PSD-95 and NR2B, reduced focal ischemic brain damage in rats, and improved their neurological function [10]. Chemical synthesis of peptide, though very efficient, is a complex and costly process [11]. So, it is not an ideal strategy for large-scale peptide production. Fortunately, recombinant DNA technology provides an economical means to prepare peptides, and it could be used as a substitute for chemical synthesis. Actually, many peptides have been successfully obtained through recombinant production in various heterologous hosts [12,13]. Among the systems available for recombinant protein production, Escherichia coli has been the most widely used host [14,15]. It possesses numerous advantages including easy cultivation, inexpensive production, and high yield potential, thereby allowing easy scalability from the laboratory to industrial production. The use of the T7 RNA polymerase-based system allows high level expression of recombinant proteins [16,17]. However, short peptide fragments are easily degraded by proteases in the engineered strains when produced by recombinant DNA technology [18,19]. Here, we packaged Tat-HA-NR2B9c gene fragment into a highly efficient expression plasmid pED [13] containing a mutant AnsB-C downstream of the T7 promoter of the expression vector pET28a. This allows the recombinant protein to be expressed at high levels in E. coli strain BL21 (DE3) pLysS and to accumulate in inclusion bodies. An acid-labile aspartyl-prolyl linker was introduced
240
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
between AnsB-C and Tat-HA-NR2B9c so that the target peptide Tat-HA-NR2B9c could be released by diluted hydrochloric acid treatment. Tat-HA-NR2B9c contained the proline residue of the cleaved dipeptide linker, 3 Gly amino acid spacer, 11 amino acid fragment of the cell membrane transduction domain of the human immunodeficiency virus type 1 (HIV-1) Tat protein (YGRKKRRQRRR) [20], 9 amino acid HA epitope-tag (YPYDVPDYA), and 9 COOH-terminal residues of NR2B (KLSSIESDV) [10]. HA epitope-tag has been established for protein detection in vitro and to some extent in vivo [21]. Tat-HA-NR2B9c had neuroprotective activity in focal cerebral artery ischemic damage in rats subjected to MCAO and reperfusion. Materials and methods Reagents E. coli strain BL21 (DE3) pLysS and the pET28a plasmid were purchased from Novagen (USA). Heat stable Pfu DNA polymerase, reagents for PCR and restriction endonucleases (Takara Biotechnology Co, Ltd, PR China), tryptone, yeast extract (OXOID LTD, England), acrylamide, bis-acrylamide, Tween-20, sodium dodecyl sulfate, urea (AMRESCO, Solon, OH), isopropyl b-D-1-thiogalactopyranoside (IPTG) and 2,3,5-triphenyltetrazolium chloride (TTC) (Sigma, USA) were used. All other chemicals were obtained from Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, PR China). Construction of Tat-HA-NR2B9c chimeric peptide The gene fragment coding for a Tat-HA-NR2B9c chimeric peptide containing HIV-1 transmembrane transduction domain (Tat), influenza virus hemagglutinin epitope tag (HA), and a COOH-terminal tSXV motif of NR2B (NR2B9c) was constructed by PCR amplification using four synthetic oligonucleotides as follows. First, the partial coding sequence of a chimeric peptide containing a AnsBC-Tat peptide was amplified by PCR using: (a) A-Foward: 50 -TACC ATGGATACGCCATTCG-30 and (b) A-Reverse50 -CGGCGGCGCTGGCG GCGTTTTTTACGACCGTAACCCGGATCCGCGTACTGGTT-30 as primers
and pED plasmid as template, PCR was carried through 30 cycles of: denaturation at 94 °C, annealing at 55 °C, and extension at 72 °C for 1 min each. Second, the PCR product from the first reaction was used as template for amplification of the coding sequence of AnsB-C-Tat-HA using: A-Forward and H-Reverse 50 -TACCAGC AACGTCCGGAACGTCGTACGGGTAACCGCGGCGGCGCTGGCGGCGT30 as primers, PCR was carried through 30 cycles of: denaturation at 94 °C, annealing at 58 °C, and extension at 72 °C for 1 min each. Third, the PCR product from the second reaction was used as template for PCR amplification of the full coding sequence of AnsB-CTat-HA-NR2B9c using: A-Foward and N-Reverse 50 -TTGAATTCTAAACGTCAGATTCGATAGAAGACAGTTTACCAGCAACGTCCGGAA-30 as primers, under the similar parameters with second reaction. The resulting DNA fragment was digested with NcoI and EcoRI and inserted into the NcoI and EcoRI sites of the expression vector pET28a [22] producing a recombinant expression plasmid (pEDTat-HA-NR2B9c) used to transform E. coli strain BL21 (DE3) pLysS. The nucleotide sequence of the target gene was confirmed in the positive clones by DNA sequencing. Induction and expression AnsB-C-Tat-HA-NR2B9c fusion protein E. coli strain BL21 (DE3) pLysS which contain the recombinant plasmid pED-Tat-HA-NR2B9c were grown in Super Broth (SB) (3% Tryptone, 2% Yeast extract, 1% MOPS, pH 7.0) supplemented with kanamycin 50 lg/ml. A single bacterial colony was inoculated into 5 ml of SB medium containing kanamycin 50 lg/ml in a 25 ml test tube and kept on a rotary shaker at 37 °C overnight. Cultures were then transferred into shaker flasks (2.5% v/v) containing 200 ml SB medium and grown to an OD600 reading of 0.68 (about 3 h). The cultures were induced with 0.1 mM IPTG for 1, 2, 3, 4, 5, 6, 7 or 8 h at 37 °C on the rotary shaker, centrifuged. Protein levels were expressed as a percentage of the total cell protein content, and samples were taken for SDS–PAGE analyses. Purification of Tat-HA-NR2B9c The bacteria were harvested by centrifugation at 5000g for 20 min. The supernatant was discarded and 6.5 g wet cells was resuspended in lysis buffe (0.5% Triton X-100, 50 mM Tris–HCl,
Fig. 1. Schematic diagram of the Tat-HA-NR2B9c expression plasmid. (a) PCR schematic diagram (b) Plasmid schematic (c) Chimeric peptide amino acid sequence.
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
Fig. 2. Expression of the AnsB-C-Tat-HA-NR2B9c. (a) SDS–PAGE analyze the expression of the recombinant protein (arrow) following a 8 h IPTG induction. Lanes 1–9, samples from fermentation cultures with different induction times: 0– 8 h, respectively. (b) Fusion protein expression curve, the fusion protein reach its peak expression level after 0.1 nM IPTG was added at 37 °C for 7 h.
pH 8.0) at a concentration of 10 g/100 ml. It was frozen at 80 °C for 3 h and then thawed. This step was repeated three times at least. Then the suspension was further disrupted by ultrasonic cell disruptor (Branson) for 30 min in ice-bath. The lysate was centrifuged for 20 min at 12,000g in order to collect the inclusion bodies. Then the pellet was washed two times with 50 ml lysis buffer each, followed by two washes with 50 ml of 2 M urea, and a final rinse in 50 ml water in order to remove the contaminants. Every wash lasted for 30 min. Then, the lysate was centrifuged at 12,000g for 20 min and the supernatant was carefully removed. The pellet containing wet inclusion bodies was resuspended in 4 M urea, 50 mM Tris–HCl (pH 8.0), at a final protein concentration of 3 g/100 ml, stirred slowly at 4 °C overnight, and centrifuged the next day. The supernatant was collected for precipitation by ethanol [13]. Briefly, 0.5-fold volume of cold ethanol was slowly added into
241
the supernatant, followed by 20 °C incubation for 20 min and centrifugation at 12000g for 20 min. Then ethanol was added continuously to the supernatant to a final level of two volumes of ethanol to one volume of supernatant at 20 °C for 1 h. The precipitation was collected by centrifugation. The pellets collected following each centrifugation were assayed for protein concentration and Tris–SDS–PAGE analysis. The quantity of the fusion protein was assessed by SDS–PAGE which was stained with Coomassie brilliant blue R250. To release the chimeric peptide from the fusion protein, the fusion protein was dissolved in 80 or 100 mM hydrochloric acid at a protein concentration of 3 mg/100 ml and incubated at 50 °C for 72 h. The isoelectric point of fusion partner and chimeric peptide are respectively 4.68 and 10.17. The pH of the solution was adjusted to 4.68 using 0.5 M NaOH to precipitate the fusion partner. After being centrifuged at 12000g for 20 min, the supernatant containing the chimeric peptide was applied in Amicon Ultra centrifugal filter units (10 kDa MW cutoff, Millipore) and centrifuged at 4000g for 30 min. The filtrate was transferred into Spectra/Pro dialysis bag (2 kDa MW cutoff, Spectrum) for desalting and lyophilized in freeze dryer. The sample was analyzed by Tricine-SDS–PAGE [23]. BCA™ Protein Assay Kit was used to analyze the concentration of Tat-HA-NR2B9c. SDS–PAGE and MALDI-TOF-MS analysis of Tat-HA-NR2B9c The lyophilized powder sample was analyzed by Tricine–SDS– PAGE. The gel was stained with silver nitrate. The single band was used for MALDI-TOF-MS analysis. Middle cerebral artery occlusion (MCAO) Focal cerebral ischemia was induced by intraluminal middle cerebral artery occlusion as described previously [4]. Adult male Sprague–Dawley rats (250–300 g; B&K Universal Group Limited, Shanghai) under chloral hydrate anesthesia (350 mg/kg, intraperitoneally). A 4/0 (for rats) surgical nylon monofilament with rounded tip was introduced into the internal carotid artery through the external carotid artery advanced 20–21 mm past the carotid bifurcation until a slight resistance was felt, effectively occluding the middle cerebral artery, then the suture was
Fig. 3. Purification of Tat-HA-NR2B9c peptide. (a) SDS–PAGE gel electrophoresis of the effect of washing of inclusion bodies. Lanes 1–2 Tris–HCl washing inclusion bodies (supernatant); Lanes 3–4, 2 M urea washing inclusion bodies (supernatant); Lanes 5–6, 0.5-fold volume and 2-fold volume ethanol precipitation. (b)SDS–PAGE in Tris–Tricine buffer showed acid-cleavage of the fusion protein. Lanes 1–4, 0, 24, 48, 72 h incubation with 100 mM HCl at 50 °C, respectively; Lanes 5–8, 0, 24, 48, 72 h incubation with 80 mM HCl at 50 °C. (c) SDS–PAGE using Tris–Tricine buffer showed target peptide Tat-HA-NR2B9c. Lane 1, purified Tat-HA-NR2B9c.
242
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245 Table 1 Summary of purification of the recombinant Tat-HA-NR2B9c. Purification steps
Total protein (mg)
Fusion protein (mg)
Tat-HANR2B9c (mg)
Purity (%)
Yield (%)
Cell lysate Inclusion bodies Ethanol precipitation Lyophilized powder
780 302 225
312 242 202
68 52 44
– 80 90
– 100 85
–
–
11
98
21
We started with 6.5 g wet weight cell pellet.
withdrawn after 120 min and the external carotid artery was ligated. Body temperature was maintained at 37 ± 0.5 °C with a thermostatically controlled infrared lamp. Animals were then returned to their cages and closely monitored until they recovered from anesthesia. In sham-operated mice, the ICA was surgically prepared for insertion of the filament, but the filament was not inserted. Neurological deficit evaluation Neurological deficits were measured 24 h after reperfusion based on a five-point scale system as described previously [4]. It was performed by an experimenter blinded to the experimental groups (Rating scale: 0 = no deficit, 1 = failure to extent left forepaw, 2 = decreased grip strength of left forepaw, 3 = circling to left by pulling the tail, and 4 = spontaneous circling). Assessment of infarct area After neurological evaluation, the mice were deeply anesthetized. The necks were cut and brains were removed quickly and frozen immediately (20 °C) for 5 min. Then, brains were cut into 2 mm slices and incubated with 2% TTC at 37 °C for 20 min. The presence or absence of infarction was determined by examining
TTC-stained sections for the areas on the side of infarction that were not stained with TTC. A computerized image analysis system Uthscsa Image Tool was used to analyze the infarct area in each brain slice. Statistical analysis All the statistical analyses were carried out with one-way ANOVA. Data were presented as mean ± SEM, p < 0.05 was considered statistically significant. Results Construction of the expression vector for Tat-HA-NR2B9c The gene fragment encoding AnsB-C-Tat-HA-NR2B9c was assembled by PCR and inserted into a T7 RNA polymerase-based expression system pET28a vector. We named the expressing plasmid pED-Tat-HA-NR2B9c. Tat-HA-NR2B9c was ligated to the truncated AnsB-C gene through an acid labile dipeptide linker (Asp–Pro) sequence. The 5850 bp expression plasmid pEDTat-HA-NR2B9c encoded HIV-1 transmembrane transduction domain (Tat) [21], influenza virus hemagglutinin epitope-tag (HA), and the COOH-terminal tSXV motif of NR2B (NR2B9c). The purified
Fig. 4. MALDI-TOF-MS analysis of Tat-HA-NR2B9c. The molecular weight of purified Tat-HA-NR2B9c measured by mass spectrometry was 3802.8 Da which was almost identical to the theoretical value (3808 Da).
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
peptide Tat-HA-NR2B9c contained in series, the proline residue of the cleaved dipeptide linker, 11 a.a. Tat peptide, 3 Gly a.a. spacer, 9 a.a. HA fragment, and 9 a.a. NR2B9c (Fig. 1). Expression of the AnsB-C-Tat-HA-NR2B9c fusion protein The resulting plasmid pED-Tat-HA-NR2B9c was transformed into E. coli strain BL21 (DE3) pLysS cultures, which were grown in Super Broth (SB) medium. The 17.5 kDa AnsB-C-Tat-HA-NR2B9c fusion protein was expressed in recombinant E. coli strain BL21 (DE3) pLysS at a high-level, and fusion protein reach its peak expression level after the 0.1 nM IPTG was added 7 h. Fusion protein was approximately 40% of total protein content in the bacterial lysates (analyzed by scanning a Coomassie-stained gel using Quantity One-4.4.1 Bio-Rad) (Fig. 2). Purification of recombinant Tat-HA-NR2B9c peptide Fusion of Tat-HA-NR2B9c to the L-asparaginase C-terminal sequence promoted aggregation of the recombinant fusion proteins into inclusion bodies. Bacteria were disrupted by freeze–thaw in lysis buffer, and subsequently lysed with ultrasonication. SDS– PAGE showed that some of the fusion proteins and most of the other bacterial proteins were eliminated during the early steps of washing the resulting pellet with Tris–HCl buffer and 2 M urea (Fig. 3a). Data showed that the second wash effect of 2 M urea
243
was poor and the inclusion bodies were partly solubilized, so this step should be omitted. Inclusion bodies were solubilized by 4 M urea. The fusion protein was precipitated by two steps ethanol precipitation. SDS–PAGE showed that both precipitates had few impurities (Fig. 3a). Both of them were used for acid hydrolysis with hydrochloric acid. The fusion protein was completely hydrolyzed by 100 mM HCl in 72 h at 50 °C, and the hydrolysis efficiency of 100 mM HCl is better than 80 mM HCl (Fig. 3b). Then, the pH of the solution was adjusted to 4.68 to precipitate fusion partner. The supernatant was used for ultrafiltration, desalting and lyophilized in freeze dryer. A single band was seen on the electrophoresis gel (Fig. 3c). The purity of initial inclusion bodies after ultrasonication is 55%. Washing inclusion bodies two times with Tris–HCl buffer increased the purity to about 70%. 2 M urea solution could selectively solubilize some of the impurities from the inclusion bodies. The final inclusion bodies contained approximately 80% fusion protein. The purity of final Tat-HA-NR2B9c was 98%. The purification procedure resulted in final yields of 1.7 mg purified Tat-HA-NR2B9c per gram of wet bacteria (Table 1). Analysis of purified Tat-HA-NR2B9c The purified Tat-HA-NR2B9c was applied to electrophoresis analysis, and a single band was seen on the gel (Fig. 3c). The molecular weight of purified Tat-HA-NR2B9c measured by mass spec-
Fig. 5. The pirified Tat-HA-NR2B9c showed same effect as active chemical synthetic Tat-HA-NR2B9c Tat-HA-NR2B9c or vehicle was administrated at 1 h after reperfusion (n = 7–8). (a) Neurological score. (b) Infarct size. (c) Representative of triphenyltetrazolium chloride-stained slices. ⁄⁄⁄P < 0.001 versus sham in a and b and ##P < 0.01 versus vehicle in a and b.
244
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
Fig. 6. Tat-HA-NR2B9c prevents NMDAR-dependent excitotoxicity and cerebral ischemia. (a and b) Dose–effect relationship experiments (n = 8–9). Tat-HA-NR2B9c or vehicle was administrated at 1 h after reperfusion. (a) Neurological score. (b) Infarct size. (c) Representative of triphenyltetrazolium chloride-stained slices. ⁄⁄⁄P < 0.001 versus sham in a and b and #P < 0.05, ##P < 0.01 versus vehicle in a and b.
trometry was 3802.8 Da which was almost identical to the theoretical value (3808 Da) (Fig. 4). Effect of Tat-HA-NR2B9c on focal cerebral ischemia To determine whether the Tat-HA-NR2B9c has benefits in cerebral ischemia, we treated MCAO rats with Tat-HA-NR2B9c (i.v.) at 1 h after reperfusion and tested neurological outcome and infarct size at 24 h after reperfusion. We compared the effect of purified Tat-HA-NR2B9c (1.12 mg/kg) with known active chemical synthetic Tat-HA-NR2B9c (1.12 mg/kg), they showed same effect in improving neural function (Fig. 5a) and reducing brain infarct area of rats (Fig. 5b and c). The effective mol concentration of Tat-HANR2B9c (0.3 nM/g) was same as Tat-NR2B9c which has been reported previously [24]. Next, we detected the dose–effect relationship of purified Tat-HA-NR2B9c. It significantly improved neural function (Fig. 6a) and reduced brain infarct area of rats (Fig. 6b and c) in a dose-dependent manner. Discussion Here, we cloned, expressed, and purified a recombinant TatHA-NR2B9c peptide by genetic engineering techniques. Because short peptide fragments are easily degraded by proteases in the engineered strains when being produced by recombinant DNA technology, we constructed a highly effective expression plasmid to express Tat-HA-NR2B9c in the form of a fusion protein under the control of an inducible T7 promoter. The fusion protein AnsB-C-Tat-HA-NR2B9c was accumulated in inclusion bodies in bacteria, which simplified protein purification,
achieved high-level expression and enhanced stability. In addition, the use of an acid-labile dipeptide linker between the target peptide Tat-HA-NR2B9c and the fusion partner AnsB-C facilitated target peptide release by acid hydrolysis. The isoelectric point of AnsB-C and Tat-HA-NR2B9c are 4.68 and 10.17, so they could be easily separated by isoelectric point precipitation; they also have different molecular weights: the former is 13.75 kDa, the latter is 3.8 kDa, so they could be further separated by ultrafiltration. The filtrate contained Tat-HA-NR2B9c only. After desalting, Tat-HANR2B9c was concentrated with freeze dryer. We inserted a HA tag in the chimeric peptide, this epitope tag could be used for detection in vitro and to some extent in vivo for subsequent pharmacokinetic study of Tat-HA-NR2B9c. Tat-HA-NR2B9c freeze–dry powder has good water solubility, stability and usability. It showed remarkable neuroprotective effects on MCAO rats in a dose dependent manner. In conclusion, the novel preparation method is a potentially useful strategy for the large-scale preparations of bioactive peptides due to its high yield, simple purification steps and inexpensive production. Further, the availability of Tat-HA-NR2B9c and its high neuroprotective effects in the rats enable the use of TatHA-NR2B9c for stroke therapy in animals or humans. Acknowledgments This work was supported by the National Major Scientific and Technological Special Project for ‘‘Significant New Drugs Creation’’ of China (NO. 2009ZX09103), and Natural Science Foundation of Jiangsu Province (NO. BK2011029), and National Natural Science Foundation of China (NO. 30971021).
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
References [1] R.W. Flynn, R.S. MacWalter, A.S. Doney, The cost of cerebral ischaemia, Neuropharmacology 55 (2008) 250–256. [2] J. Gállego, R. Muñoz, E. Martínez-Vila, Emergent cerebrovascular disease risk factor weighting: is transient ischemic attack an imminent threat?, Cerebrovasc Dis. 27 (2009) 88–96. [3] R. Sattler, Z. Xiong, W.Y. Lu, M. Hafner, J.F. MacDonald, M. Tymianski, Specific coupling of NMDA receptor activation to nitric oxide neurotoxicity by PSD-95 protein, Science 284 (1999) 1845–1848. [4] L. Zhou, F. Li, H.B. Xu, C.X. Luo, H.Y. Wu, M.M. Zhu, W. Lu, X. Ji, Q.G. Zhou, D.Y. Zhu, Treatment of cerebral ischemia by disrupting ischemia-induced interaction of nNOS with PSD-95, Nat. Med. 16 (2010) 1439–1443. [5] S.M. Davis, K.R. Lees, G.W. Albers, H.C. Diener, S. Markabi, G. Karlsson, J. Norris, Selfotel in acute ischemic stroke: possible neurotoxic effects of an NMDA antagonist, Stroke 31 (2000) 347–354. [6] Q. Chen, S. He, X.L. Hu, J. Yu, Y. Zhou, J. Zheng, S. Zhang, C. Zhang, W.H. Duan, Z.Q. Xiong, Differential roles of NR2A- and NR2B-containing NMDA receptors in activity-dependent brain derived neurotrophic factor gene regulation and limbic epileptogenesis, J. Neurosci. (2007) 542–552. [7] Y. Liu, T.P. Wong, M. Aarts, A. Rooyakkers, L. Liu, T.W. Lai, D.C. Wu, J. Lu, M. Tymianski, A.M. Craig, Y.T. Wang, NMDA receptor subunits have differential roles in mediating excitotoxic neuronal death both in vitro and in vivo, J. Neurosci. 27 (2007) 2846–2857. [8] H.C. Kornau, L.T. Schenker, M.B. Kennedy, P.H. Seeburg, Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD95, Science 269 (1995) 1737–1740. [9] J.E. Brenman, D.S. Chao, S.H. Gee, A.W. McGee, S.E. Craven, D.R. Santillano, Z. Wu, F. Huang, H. Xia, M.F. Peters, S.C. Froehner, D.S. Bredt, Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alpha1syntrophin mediated by PDZ domains, Cell 84 (1996) 757–767. [10] M. Aarts, Y. Liu, L. Liu, S. Besshoh, M. Arundine, J.W. Gurd, Y.T. Wang, M.W. Salter, M. Tymianski, Treatment of ischemic brain damage by Perturbing NMDA receptor-PSD-95 protein interactions, Science 298 (2002) 846–850. [11] L. Andersson, L. Blomberg, M. Flegel, L. Lepsa, B. Nilsson, M. Verlander, Largescale synthesis of peptides, Biopolymers 55 (2000) 227–250.
245
[12] A.B. Ingham, R.J. Moore, Recombinant production of antimicrobial peptides in heterologous microbial systems, Biotechnol. Appl. Biochem. 47 (2007) 1–9. [13] J. Feng, Y. Liu, Y. Xing, H. Wang, T. Li, J. Liu, H. Fan, R. Cao, A novel human parathyroid hormone (1–34) analog for the treatment of osteoporosis, Peptides 30 (2009) 1173–1180. [14] Y. Li, Z. Chen, RAPD: a database of recombinantly-produced antimicrobial peptides, FEMS Microbiol. Lett. 289 (2008) 126–129. [15] S. Handa, T.J. Spradling, D.R. Dempsey, D.J. Merkler, Production of the catalytic core of human peptidylglycine a-hydroxylating monooxygenase (hPHMcc) in Escherichia coli, Protein Expr. Purif. 84 (2012) 9–13. [16] Y. Zhang, L. Taiming, J. Liu, Low temperature and glucose enhanced T7 RNA polymerase-based plasmid stability for increasing expression of glucagon-like peptide-2 in Escherichia coli, Protein Expr. Purif. 29 (2003) 132–139. [17] G.C. Barnard, G.E. Henderson, S. Srinivasan, T.U. Gerngross, High level recombinant protein expression in Ralstonia eutropha using T7 RNA polymerase based amplification, Protein Expr. Purif. 38 (2004) 264–271. [18] F.A. Marston, The purification of eukaryotic polypeptides synthesized in Escherichia coli, Biochem. J. 240 (1986) 1–12. [19] D.L. Wilkinson, R.G. Harrison, Predicting the solubility of recombinant proteins in Escherichia coli, Biotechnology (NY) 9 (1991) 443–448. [20] S.R. Schwarze, A. Ho, A. Vocero-Akbani, S.F. Dowdy, In vivo protein transduction: delivery of a biologically active protein into the mouse, Science 285 (1999) 1569–1572. [21] Z. Shevtsova, J.M. Malik, U. Michel, U. Schöll, M. Bähr, S. Kügler, Evaluation of epitope tags for protein detection after in vivo CNS gene transfer, Eur. J. Neurosci. 23 (2006) 1961–1969. [22] J. Xu, Z. Zhu, P. Duan, W. Li, Y. Zhang, J. Wu, Z. Hu, R.S. Roque, J. Liu, Cloning, expression, and purification of a highly immunogenic recombinant gonadotropin-releasing hormone (GnRH) chimeric peptide, Protein Expr. Purif. 50 (2006) 163–170. [23] H. Schägger, G. von Jagow, Tricine-sodium dodecyl sulfate-polyacryl-amide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa, Anal. Biochem. 166 (1987) 368–379. [24] H.S. Sun, T.A. Doucette, Y. Liu, Y. Fang, L. Teves, M. Aarts, C.L. Ryan, P.B. Bernard, A. Lau, J.P. Forder, M.W. Salter, Y.T. Wang, R.A. Tasker, M. Tymianski, Effectiveness of PSD95 inhibitors in permanent and transient focal ischemia in the rat, Stroke 39 (2008) 2544–2553.
Contents lists available at SciVerse ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Cloning, expression, and purification of a recombinant Tat-HA-NR2B9c peptide Hai-Hui Zhou, Ai-Xia Zhang, Yu Zhang, Dong-Ya Zhu ⇑ Laboratory of Cerebrovascular Disease, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Nanjing Medical University, Nanjing 210029, China
a r t i c l e
i n f o
Article history: Received 3 August 2012 and in revised form 15 August 2012 Available online 25 August 2012 Keywords: Tat-HA-NR2B9c Cloning Expression Purification Cerebral ischemic injury Neuroprotection
a b s t r a c t To design a peptide disrupting the interaction between N-methyl-D-aspartate receptors-2B (NR2B) and postsynaptic density protein-95 (PSD-95), a gene fragment encoding a chimeric peptide was constructed using polymerase chain reaction and ligated into a novel expression vector for recombinant expression in a T7 RNA polymerase-based expression system. The chimeric peptide contained a fragment of the cell membrane transduction domain of the human immunodeficiency virus type1 (HIV-1) Tat, a influenza virus hemagglutinin (HA) epitope-tag, and the C-terminal 9 amino acids of NR2B (NR2B9c). We named the chimeric peptide Tat-HA-NR2B9c. The expression plasmid contained a gene fragment encoding the Tat-HA-NR2B9c was ligated to the C-terminal fragment of L-asparaginase (AnsB-C) via a unique acid labile Asp-Pro linker. The recombinant fusion protein was expressed in inclusion body in Escherichia coli under isopropyl b-D-1-thiogalactopyranoside (IPTG) and purified by washing with 2 M urea, solubilizing in 4 M urea, and then ethanol precipitation. The target chimeric peptide Tat-HA-NR2B9c was released from the fusion partner following acid hydrolysis and purified by isoelectric point precipitation and ultrafiltration. SDS–PAGE analysis and MALDI-TOF-MS analysis showed that the purified Tat-HA-NR2B9c was highly homogeneous. Furthermore, we investigated the effects of Tat-HA-NR2B9c on ischemia-induced cerebral injury in the rats subjected to middle cerebral artery occlusion (MCAO) and reperfusion, and found that the peptide reduced infarct size and improved neurological functions. Ó 2012 Elsevier Inc. All rights reserved.
Introduction Stroke is a major public disease leading to high rates of death and disability in adults [1,2]. Excessive stimulation of N-methyl1 D-aspartate receptors (NMDARs) and the resulting neuronal nitric oxide synthase (nNOS) activation are crucial for neuronal injury after stroke insult [3,4]. Because NMDARs has a dual role in both normal and abnormal function in brain, directly blocking NMDARs has failed as a clinical stroke therapy [5]. NMDAR complexes containing NR2B facilitate cell death signaling whereas NR2A-containing NMDARs promote neuronal survival [6,7]. An alternative strategy is to block downstream of NMDAR/PSD-95/nNOS excitotoxic signal without interference with physiological function of NMDARs. PSD-95 binds the COOH-terminal tSXV motif of NMDAR ⇑ Corresponding author. Address: Department of Pharmacology, School of Pharmacy, Nanjing Medical University, Nanjing 210029, China. Fax: +86 25 86862818. E-mail address: [email protected] (D.-Y. Zhu). 1 Abbreviations used: AnsB-C, C-terminal fragment of L-asparaginase; NMDARs, Nmethyl-D-aspartate receptors; NR2B, N-methyl-D-aspartate receptors-2B; PSD-95, postsynaptic density protein-95; Tat, cell membrane transduction domain of the human immunodeficiency virus type 1; HA, hemagglutinin; nNOS, neuronal nitric oxide synthase; MCAO, middle cerebral artery occlusion; E. coli, Escherichia coli; IPTG, isopropyl b-D-1-thiogalactopyranoside; SDS–PAGE, sodium dodecyl sulfate– polyacrylamide gel electrophoresis; TTC, 2,3,5-triphenyltetrazolium chloride. 1046-5928/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pep.2012.08.011
NR2 subunits as well as nNOS [8,9]. Tat-NR2B9c, a peptide that uncouples PSD-95 and NR2B, reduced focal ischemic brain damage in rats, and improved their neurological function [10]. Chemical synthesis of peptide, though very efficient, is a complex and costly process [11]. So, it is not an ideal strategy for large-scale peptide production. Fortunately, recombinant DNA technology provides an economical means to prepare peptides, and it could be used as a substitute for chemical synthesis. Actually, many peptides have been successfully obtained through recombinant production in various heterologous hosts [12,13]. Among the systems available for recombinant protein production, Escherichia coli has been the most widely used host [14,15]. It possesses numerous advantages including easy cultivation, inexpensive production, and high yield potential, thereby allowing easy scalability from the laboratory to industrial production. The use of the T7 RNA polymerase-based system allows high level expression of recombinant proteins [16,17]. However, short peptide fragments are easily degraded by proteases in the engineered strains when produced by recombinant DNA technology [18,19]. Here, we packaged Tat-HA-NR2B9c gene fragment into a highly efficient expression plasmid pED [13] containing a mutant AnsB-C downstream of the T7 promoter of the expression vector pET28a. This allows the recombinant protein to be expressed at high levels in E. coli strain BL21 (DE3) pLysS and to accumulate in inclusion bodies. An acid-labile aspartyl-prolyl linker was introduced
240
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
between AnsB-C and Tat-HA-NR2B9c so that the target peptide Tat-HA-NR2B9c could be released by diluted hydrochloric acid treatment. Tat-HA-NR2B9c contained the proline residue of the cleaved dipeptide linker, 3 Gly amino acid spacer, 11 amino acid fragment of the cell membrane transduction domain of the human immunodeficiency virus type 1 (HIV-1) Tat protein (YGRKKRRQRRR) [20], 9 amino acid HA epitope-tag (YPYDVPDYA), and 9 COOH-terminal residues of NR2B (KLSSIESDV) [10]. HA epitope-tag has been established for protein detection in vitro and to some extent in vivo [21]. Tat-HA-NR2B9c had neuroprotective activity in focal cerebral artery ischemic damage in rats subjected to MCAO and reperfusion. Materials and methods Reagents E. coli strain BL21 (DE3) pLysS and the pET28a plasmid were purchased from Novagen (USA). Heat stable Pfu DNA polymerase, reagents for PCR and restriction endonucleases (Takara Biotechnology Co, Ltd, PR China), tryptone, yeast extract (OXOID LTD, England), acrylamide, bis-acrylamide, Tween-20, sodium dodecyl sulfate, urea (AMRESCO, Solon, OH), isopropyl b-D-1-thiogalactopyranoside (IPTG) and 2,3,5-triphenyltetrazolium chloride (TTC) (Sigma, USA) were used. All other chemicals were obtained from Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, PR China). Construction of Tat-HA-NR2B9c chimeric peptide The gene fragment coding for a Tat-HA-NR2B9c chimeric peptide containing HIV-1 transmembrane transduction domain (Tat), influenza virus hemagglutinin epitope tag (HA), and a COOH-terminal tSXV motif of NR2B (NR2B9c) was constructed by PCR amplification using four synthetic oligonucleotides as follows. First, the partial coding sequence of a chimeric peptide containing a AnsBC-Tat peptide was amplified by PCR using: (a) A-Foward: 50 -TACC ATGGATACGCCATTCG-30 and (b) A-Reverse50 -CGGCGGCGCTGGCG GCGTTTTTTACGACCGTAACCCGGATCCGCGTACTGGTT-30 as primers
and pED plasmid as template, PCR was carried through 30 cycles of: denaturation at 94 °C, annealing at 55 °C, and extension at 72 °C for 1 min each. Second, the PCR product from the first reaction was used as template for amplification of the coding sequence of AnsB-C-Tat-HA using: A-Forward and H-Reverse 50 -TACCAGC AACGTCCGGAACGTCGTACGGGTAACCGCGGCGGCGCTGGCGGCGT30 as primers, PCR was carried through 30 cycles of: denaturation at 94 °C, annealing at 58 °C, and extension at 72 °C for 1 min each. Third, the PCR product from the second reaction was used as template for PCR amplification of the full coding sequence of AnsB-CTat-HA-NR2B9c using: A-Foward and N-Reverse 50 -TTGAATTCTAAACGTCAGATTCGATAGAAGACAGTTTACCAGCAACGTCCGGAA-30 as primers, under the similar parameters with second reaction. The resulting DNA fragment was digested with NcoI and EcoRI and inserted into the NcoI and EcoRI sites of the expression vector pET28a [22] producing a recombinant expression plasmid (pEDTat-HA-NR2B9c) used to transform E. coli strain BL21 (DE3) pLysS. The nucleotide sequence of the target gene was confirmed in the positive clones by DNA sequencing. Induction and expression AnsB-C-Tat-HA-NR2B9c fusion protein E. coli strain BL21 (DE3) pLysS which contain the recombinant plasmid pED-Tat-HA-NR2B9c were grown in Super Broth (SB) (3% Tryptone, 2% Yeast extract, 1% MOPS, pH 7.0) supplemented with kanamycin 50 lg/ml. A single bacterial colony was inoculated into 5 ml of SB medium containing kanamycin 50 lg/ml in a 25 ml test tube and kept on a rotary shaker at 37 °C overnight. Cultures were then transferred into shaker flasks (2.5% v/v) containing 200 ml SB medium and grown to an OD600 reading of 0.68 (about 3 h). The cultures were induced with 0.1 mM IPTG for 1, 2, 3, 4, 5, 6, 7 or 8 h at 37 °C on the rotary shaker, centrifuged. Protein levels were expressed as a percentage of the total cell protein content, and samples were taken for SDS–PAGE analyses. Purification of Tat-HA-NR2B9c The bacteria were harvested by centrifugation at 5000g for 20 min. The supernatant was discarded and 6.5 g wet cells was resuspended in lysis buffe (0.5% Triton X-100, 50 mM Tris–HCl,
Fig. 1. Schematic diagram of the Tat-HA-NR2B9c expression plasmid. (a) PCR schematic diagram (b) Plasmid schematic (c) Chimeric peptide amino acid sequence.
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
Fig. 2. Expression of the AnsB-C-Tat-HA-NR2B9c. (a) SDS–PAGE analyze the expression of the recombinant protein (arrow) following a 8 h IPTG induction. Lanes 1–9, samples from fermentation cultures with different induction times: 0– 8 h, respectively. (b) Fusion protein expression curve, the fusion protein reach its peak expression level after 0.1 nM IPTG was added at 37 °C for 7 h.
pH 8.0) at a concentration of 10 g/100 ml. It was frozen at 80 °C for 3 h and then thawed. This step was repeated three times at least. Then the suspension was further disrupted by ultrasonic cell disruptor (Branson) for 30 min in ice-bath. The lysate was centrifuged for 20 min at 12,000g in order to collect the inclusion bodies. Then the pellet was washed two times with 50 ml lysis buffer each, followed by two washes with 50 ml of 2 M urea, and a final rinse in 50 ml water in order to remove the contaminants. Every wash lasted for 30 min. Then, the lysate was centrifuged at 12,000g for 20 min and the supernatant was carefully removed. The pellet containing wet inclusion bodies was resuspended in 4 M urea, 50 mM Tris–HCl (pH 8.0), at a final protein concentration of 3 g/100 ml, stirred slowly at 4 °C overnight, and centrifuged the next day. The supernatant was collected for precipitation by ethanol [13]. Briefly, 0.5-fold volume of cold ethanol was slowly added into
241
the supernatant, followed by 20 °C incubation for 20 min and centrifugation at 12000g for 20 min. Then ethanol was added continuously to the supernatant to a final level of two volumes of ethanol to one volume of supernatant at 20 °C for 1 h. The precipitation was collected by centrifugation. The pellets collected following each centrifugation were assayed for protein concentration and Tris–SDS–PAGE analysis. The quantity of the fusion protein was assessed by SDS–PAGE which was stained with Coomassie brilliant blue R250. To release the chimeric peptide from the fusion protein, the fusion protein was dissolved in 80 or 100 mM hydrochloric acid at a protein concentration of 3 mg/100 ml and incubated at 50 °C for 72 h. The isoelectric point of fusion partner and chimeric peptide are respectively 4.68 and 10.17. The pH of the solution was adjusted to 4.68 using 0.5 M NaOH to precipitate the fusion partner. After being centrifuged at 12000g for 20 min, the supernatant containing the chimeric peptide was applied in Amicon Ultra centrifugal filter units (10 kDa MW cutoff, Millipore) and centrifuged at 4000g for 30 min. The filtrate was transferred into Spectra/Pro dialysis bag (2 kDa MW cutoff, Spectrum) for desalting and lyophilized in freeze dryer. The sample was analyzed by Tricine-SDS–PAGE [23]. BCA™ Protein Assay Kit was used to analyze the concentration of Tat-HA-NR2B9c. SDS–PAGE and MALDI-TOF-MS analysis of Tat-HA-NR2B9c The lyophilized powder sample was analyzed by Tricine–SDS– PAGE. The gel was stained with silver nitrate. The single band was used for MALDI-TOF-MS analysis. Middle cerebral artery occlusion (MCAO) Focal cerebral ischemia was induced by intraluminal middle cerebral artery occlusion as described previously [4]. Adult male Sprague–Dawley rats (250–300 g; B&K Universal Group Limited, Shanghai) under chloral hydrate anesthesia (350 mg/kg, intraperitoneally). A 4/0 (for rats) surgical nylon monofilament with rounded tip was introduced into the internal carotid artery through the external carotid artery advanced 20–21 mm past the carotid bifurcation until a slight resistance was felt, effectively occluding the middle cerebral artery, then the suture was
Fig. 3. Purification of Tat-HA-NR2B9c peptide. (a) SDS–PAGE gel electrophoresis of the effect of washing of inclusion bodies. Lanes 1–2 Tris–HCl washing inclusion bodies (supernatant); Lanes 3–4, 2 M urea washing inclusion bodies (supernatant); Lanes 5–6, 0.5-fold volume and 2-fold volume ethanol precipitation. (b)SDS–PAGE in Tris–Tricine buffer showed acid-cleavage of the fusion protein. Lanes 1–4, 0, 24, 48, 72 h incubation with 100 mM HCl at 50 °C, respectively; Lanes 5–8, 0, 24, 48, 72 h incubation with 80 mM HCl at 50 °C. (c) SDS–PAGE using Tris–Tricine buffer showed target peptide Tat-HA-NR2B9c. Lane 1, purified Tat-HA-NR2B9c.
242
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245 Table 1 Summary of purification of the recombinant Tat-HA-NR2B9c. Purification steps
Total protein (mg)
Fusion protein (mg)
Tat-HANR2B9c (mg)
Purity (%)
Yield (%)
Cell lysate Inclusion bodies Ethanol precipitation Lyophilized powder
780 302 225
312 242 202
68 52 44
– 80 90
– 100 85
–
–
11
98
21
We started with 6.5 g wet weight cell pellet.
withdrawn after 120 min and the external carotid artery was ligated. Body temperature was maintained at 37 ± 0.5 °C with a thermostatically controlled infrared lamp. Animals were then returned to their cages and closely monitored until they recovered from anesthesia. In sham-operated mice, the ICA was surgically prepared for insertion of the filament, but the filament was not inserted. Neurological deficit evaluation Neurological deficits were measured 24 h after reperfusion based on a five-point scale system as described previously [4]. It was performed by an experimenter blinded to the experimental groups (Rating scale: 0 = no deficit, 1 = failure to extent left forepaw, 2 = decreased grip strength of left forepaw, 3 = circling to left by pulling the tail, and 4 = spontaneous circling). Assessment of infarct area After neurological evaluation, the mice were deeply anesthetized. The necks were cut and brains were removed quickly and frozen immediately (20 °C) for 5 min. Then, brains were cut into 2 mm slices and incubated with 2% TTC at 37 °C for 20 min. The presence or absence of infarction was determined by examining
TTC-stained sections for the areas on the side of infarction that were not stained with TTC. A computerized image analysis system Uthscsa Image Tool was used to analyze the infarct area in each brain slice. Statistical analysis All the statistical analyses were carried out with one-way ANOVA. Data were presented as mean ± SEM, p < 0.05 was considered statistically significant. Results Construction of the expression vector for Tat-HA-NR2B9c The gene fragment encoding AnsB-C-Tat-HA-NR2B9c was assembled by PCR and inserted into a T7 RNA polymerase-based expression system pET28a vector. We named the expressing plasmid pED-Tat-HA-NR2B9c. Tat-HA-NR2B9c was ligated to the truncated AnsB-C gene through an acid labile dipeptide linker (Asp–Pro) sequence. The 5850 bp expression plasmid pEDTat-HA-NR2B9c encoded HIV-1 transmembrane transduction domain (Tat) [21], influenza virus hemagglutinin epitope-tag (HA), and the COOH-terminal tSXV motif of NR2B (NR2B9c). The purified
Fig. 4. MALDI-TOF-MS analysis of Tat-HA-NR2B9c. The molecular weight of purified Tat-HA-NR2B9c measured by mass spectrometry was 3802.8 Da which was almost identical to the theoretical value (3808 Da).
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
peptide Tat-HA-NR2B9c contained in series, the proline residue of the cleaved dipeptide linker, 11 a.a. Tat peptide, 3 Gly a.a. spacer, 9 a.a. HA fragment, and 9 a.a. NR2B9c (Fig. 1). Expression of the AnsB-C-Tat-HA-NR2B9c fusion protein The resulting plasmid pED-Tat-HA-NR2B9c was transformed into E. coli strain BL21 (DE3) pLysS cultures, which were grown in Super Broth (SB) medium. The 17.5 kDa AnsB-C-Tat-HA-NR2B9c fusion protein was expressed in recombinant E. coli strain BL21 (DE3) pLysS at a high-level, and fusion protein reach its peak expression level after the 0.1 nM IPTG was added 7 h. Fusion protein was approximately 40% of total protein content in the bacterial lysates (analyzed by scanning a Coomassie-stained gel using Quantity One-4.4.1 Bio-Rad) (Fig. 2). Purification of recombinant Tat-HA-NR2B9c peptide Fusion of Tat-HA-NR2B9c to the L-asparaginase C-terminal sequence promoted aggregation of the recombinant fusion proteins into inclusion bodies. Bacteria were disrupted by freeze–thaw in lysis buffer, and subsequently lysed with ultrasonication. SDS– PAGE showed that some of the fusion proteins and most of the other bacterial proteins were eliminated during the early steps of washing the resulting pellet with Tris–HCl buffer and 2 M urea (Fig. 3a). Data showed that the second wash effect of 2 M urea
243
was poor and the inclusion bodies were partly solubilized, so this step should be omitted. Inclusion bodies were solubilized by 4 M urea. The fusion protein was precipitated by two steps ethanol precipitation. SDS–PAGE showed that both precipitates had few impurities (Fig. 3a). Both of them were used for acid hydrolysis with hydrochloric acid. The fusion protein was completely hydrolyzed by 100 mM HCl in 72 h at 50 °C, and the hydrolysis efficiency of 100 mM HCl is better than 80 mM HCl (Fig. 3b). Then, the pH of the solution was adjusted to 4.68 to precipitate fusion partner. The supernatant was used for ultrafiltration, desalting and lyophilized in freeze dryer. A single band was seen on the electrophoresis gel (Fig. 3c). The purity of initial inclusion bodies after ultrasonication is 55%. Washing inclusion bodies two times with Tris–HCl buffer increased the purity to about 70%. 2 M urea solution could selectively solubilize some of the impurities from the inclusion bodies. The final inclusion bodies contained approximately 80% fusion protein. The purity of final Tat-HA-NR2B9c was 98%. The purification procedure resulted in final yields of 1.7 mg purified Tat-HA-NR2B9c per gram of wet bacteria (Table 1). Analysis of purified Tat-HA-NR2B9c The purified Tat-HA-NR2B9c was applied to electrophoresis analysis, and a single band was seen on the gel (Fig. 3c). The molecular weight of purified Tat-HA-NR2B9c measured by mass spec-
Fig. 5. The pirified Tat-HA-NR2B9c showed same effect as active chemical synthetic Tat-HA-NR2B9c Tat-HA-NR2B9c or vehicle was administrated at 1 h after reperfusion (n = 7–8). (a) Neurological score. (b) Infarct size. (c) Representative of triphenyltetrazolium chloride-stained slices. ⁄⁄⁄P < 0.001 versus sham in a and b and ##P < 0.01 versus vehicle in a and b.
244
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
Fig. 6. Tat-HA-NR2B9c prevents NMDAR-dependent excitotoxicity and cerebral ischemia. (a and b) Dose–effect relationship experiments (n = 8–9). Tat-HA-NR2B9c or vehicle was administrated at 1 h after reperfusion. (a) Neurological score. (b) Infarct size. (c) Representative of triphenyltetrazolium chloride-stained slices. ⁄⁄⁄P < 0.001 versus sham in a and b and #P < 0.05, ##P < 0.01 versus vehicle in a and b.
trometry was 3802.8 Da which was almost identical to the theoretical value (3808 Da) (Fig. 4). Effect of Tat-HA-NR2B9c on focal cerebral ischemia To determine whether the Tat-HA-NR2B9c has benefits in cerebral ischemia, we treated MCAO rats with Tat-HA-NR2B9c (i.v.) at 1 h after reperfusion and tested neurological outcome and infarct size at 24 h after reperfusion. We compared the effect of purified Tat-HA-NR2B9c (1.12 mg/kg) with known active chemical synthetic Tat-HA-NR2B9c (1.12 mg/kg), they showed same effect in improving neural function (Fig. 5a) and reducing brain infarct area of rats (Fig. 5b and c). The effective mol concentration of Tat-HANR2B9c (0.3 nM/g) was same as Tat-NR2B9c which has been reported previously [24]. Next, we detected the dose–effect relationship of purified Tat-HA-NR2B9c. It significantly improved neural function (Fig. 6a) and reduced brain infarct area of rats (Fig. 6b and c) in a dose-dependent manner. Discussion Here, we cloned, expressed, and purified a recombinant TatHA-NR2B9c peptide by genetic engineering techniques. Because short peptide fragments are easily degraded by proteases in the engineered strains when being produced by recombinant DNA technology, we constructed a highly effective expression plasmid to express Tat-HA-NR2B9c in the form of a fusion protein under the control of an inducible T7 promoter. The fusion protein AnsB-C-Tat-HA-NR2B9c was accumulated in inclusion bodies in bacteria, which simplified protein purification,
achieved high-level expression and enhanced stability. In addition, the use of an acid-labile dipeptide linker between the target peptide Tat-HA-NR2B9c and the fusion partner AnsB-C facilitated target peptide release by acid hydrolysis. The isoelectric point of AnsB-C and Tat-HA-NR2B9c are 4.68 and 10.17, so they could be easily separated by isoelectric point precipitation; they also have different molecular weights: the former is 13.75 kDa, the latter is 3.8 kDa, so they could be further separated by ultrafiltration. The filtrate contained Tat-HA-NR2B9c only. After desalting, Tat-HANR2B9c was concentrated with freeze dryer. We inserted a HA tag in the chimeric peptide, this epitope tag could be used for detection in vitro and to some extent in vivo for subsequent pharmacokinetic study of Tat-HA-NR2B9c. Tat-HA-NR2B9c freeze–dry powder has good water solubility, stability and usability. It showed remarkable neuroprotective effects on MCAO rats in a dose dependent manner. In conclusion, the novel preparation method is a potentially useful strategy for the large-scale preparations of bioactive peptides due to its high yield, simple purification steps and inexpensive production. Further, the availability of Tat-HA-NR2B9c and its high neuroprotective effects in the rats enable the use of TatHA-NR2B9c for stroke therapy in animals or humans. Acknowledgments This work was supported by the National Major Scientific and Technological Special Project for ‘‘Significant New Drugs Creation’’ of China (NO. 2009ZX09103), and Natural Science Foundation of Jiangsu Province (NO. BK2011029), and National Natural Science Foundation of China (NO. 30971021).
H.-H. Zhou et al. / Protein Expression and Purification 85 (2012) 239–245
References [1] R.W. Flynn, R.S. MacWalter, A.S. Doney, The cost of cerebral ischaemia, Neuropharmacology 55 (2008) 250–256. [2] J. Gállego, R. Muñoz, E. Martínez-Vila, Emergent cerebrovascular disease risk factor weighting: is transient ischemic attack an imminent threat?, Cerebrovasc Dis. 27 (2009) 88–96. [3] R. Sattler, Z. Xiong, W.Y. Lu, M. Hafner, J.F. MacDonald, M. Tymianski, Specific coupling of NMDA receptor activation to nitric oxide neurotoxicity by PSD-95 protein, Science 284 (1999) 1845–1848. [4] L. Zhou, F. Li, H.B. Xu, C.X. Luo, H.Y. Wu, M.M. Zhu, W. Lu, X. Ji, Q.G. Zhou, D.Y. Zhu, Treatment of cerebral ischemia by disrupting ischemia-induced interaction of nNOS with PSD-95, Nat. Med. 16 (2010) 1439–1443. [5] S.M. Davis, K.R. Lees, G.W. Albers, H.C. Diener, S. Markabi, G. Karlsson, J. Norris, Selfotel in acute ischemic stroke: possible neurotoxic effects of an NMDA antagonist, Stroke 31 (2000) 347–354. [6] Q. Chen, S. He, X.L. Hu, J. Yu, Y. Zhou, J. Zheng, S. Zhang, C. Zhang, W.H. Duan, Z.Q. Xiong, Differential roles of NR2A- and NR2B-containing NMDA receptors in activity-dependent brain derived neurotrophic factor gene regulation and limbic epileptogenesis, J. Neurosci. (2007) 542–552. [7] Y. Liu, T.P. Wong, M. Aarts, A. Rooyakkers, L. Liu, T.W. Lai, D.C. Wu, J. Lu, M. Tymianski, A.M. Craig, Y.T. Wang, NMDA receptor subunits have differential roles in mediating excitotoxic neuronal death both in vitro and in vivo, J. Neurosci. 27 (2007) 2846–2857. [8] H.C. Kornau, L.T. Schenker, M.B. Kennedy, P.H. Seeburg, Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD95, Science 269 (1995) 1737–1740. [9] J.E. Brenman, D.S. Chao, S.H. Gee, A.W. McGee, S.E. Craven, D.R. Santillano, Z. Wu, F. Huang, H. Xia, M.F. Peters, S.C. Froehner, D.S. Bredt, Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alpha1syntrophin mediated by PDZ domains, Cell 84 (1996) 757–767. [10] M. Aarts, Y. Liu, L. Liu, S. Besshoh, M. Arundine, J.W. Gurd, Y.T. Wang, M.W. Salter, M. Tymianski, Treatment of ischemic brain damage by Perturbing NMDA receptor-PSD-95 protein interactions, Science 298 (2002) 846–850. [11] L. Andersson, L. Blomberg, M. Flegel, L. Lepsa, B. Nilsson, M. Verlander, Largescale synthesis of peptides, Biopolymers 55 (2000) 227–250.
245
[12] A.B. Ingham, R.J. Moore, Recombinant production of antimicrobial peptides in heterologous microbial systems, Biotechnol. Appl. Biochem. 47 (2007) 1–9. [13] J. Feng, Y. Liu, Y. Xing, H. Wang, T. Li, J. Liu, H. Fan, R. Cao, A novel human parathyroid hormone (1–34) analog for the treatment of osteoporosis, Peptides 30 (2009) 1173–1180. [14] Y. Li, Z. Chen, RAPD: a database of recombinantly-produced antimicrobial peptides, FEMS Microbiol. Lett. 289 (2008) 126–129. [15] S. Handa, T.J. Spradling, D.R. Dempsey, D.J. Merkler, Production of the catalytic core of human peptidylglycine a-hydroxylating monooxygenase (hPHMcc) in Escherichia coli, Protein Expr. Purif. 84 (2012) 9–13. [16] Y. Zhang, L. Taiming, J. Liu, Low temperature and glucose enhanced T7 RNA polymerase-based plasmid stability for increasing expression of glucagon-like peptide-2 in Escherichia coli, Protein Expr. Purif. 29 (2003) 132–139. [17] G.C. Barnard, G.E. Henderson, S. Srinivasan, T.U. Gerngross, High level recombinant protein expression in Ralstonia eutropha using T7 RNA polymerase based amplification, Protein Expr. Purif. 38 (2004) 264–271. [18] F.A. Marston, The purification of eukaryotic polypeptides synthesized in Escherichia coli, Biochem. J. 240 (1986) 1–12. [19] D.L. Wilkinson, R.G. Harrison, Predicting the solubility of recombinant proteins in Escherichia coli, Biotechnology (NY) 9 (1991) 443–448. [20] S.R. Schwarze, A. Ho, A. Vocero-Akbani, S.F. Dowdy, In vivo protein transduction: delivery of a biologically active protein into the mouse, Science 285 (1999) 1569–1572. [21] Z. Shevtsova, J.M. Malik, U. Michel, U. Schöll, M. Bähr, S. Kügler, Evaluation of epitope tags for protein detection after in vivo CNS gene transfer, Eur. J. Neurosci. 23 (2006) 1961–1969. [22] J. Xu, Z. Zhu, P. Duan, W. Li, Y. Zhang, J. Wu, Z. Hu, R.S. Roque, J. Liu, Cloning, expression, and purification of a highly immunogenic recombinant gonadotropin-releasing hormone (GnRH) chimeric peptide, Protein Expr. Purif. 50 (2006) 163–170. [23] H. Schägger, G. von Jagow, Tricine-sodium dodecyl sulfate-polyacryl-amide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa, Anal. Biochem. 166 (1987) 368–379. [24] H.S. Sun, T.A. Doucette, Y. Liu, Y. Fang, L. Teves, M. Aarts, C.L. Ryan, P.B. Bernard, A. Lau, J.P. Forder, M.W. Salter, Y.T. Wang, R.A. Tasker, M. Tymianski, Effectiveness of PSD95 inhibitors in permanent and transient focal ischemia in the rat, Stroke 39 (2008) 2544–2553.