Cloning of a second proopiomelanocortin cDNA from the pituitary of the sturgeon, Acipenser transmontanus

Peptides 20 (1999) 431– 436

Cloning of a second proopiomelanocortin cDNA from the pituitary of the sturgeon, Acipenser transmontanus Jasem Alrubaiana, Phillip Danielsona, Martin Fitzpatrickb, Carl Schreckb, Robert M. Doresa,* a

University of Denver, Department of Biological Sciences, Denver, Colorado 80208, USA Oregon Cooperative Fishery Research Unit, Oregon State University, Corvallis, Oregon 97331, USA

b

Received 26 October 1998; accepted 14 December 1998

Abstract A recent study on the pituitary of the sturgeon, Acipenser transmontanus, resulted in the cloning of a cDNA that codes for the prohormone, proopiomelanocortin (POMC). This cDNA is designated sturgeon POMC A. Subsequent analysis of the sturgeon pituitary uncovered a second distinct POMC cDNA (sturgeon POMC B). In both sturgeon POMC cDNAs the open reading frame is 795 nucleotides in length. However, the two sturgeon POMC cDNAs differ at 26 amino acid positions in the opening frame. In addition, the 2 forms of POMC differ at 45 nucleotide positions within the open reading frame. The number and types of point mutations are compared in the 2 sturgeons POMC cDNAs, and the origin of the two POMC genes is discussed. © 1999 Elsevier Science Inc. All rights reserved.

1. Introduction Recent studies indicate that proopiomelanocortin (POMC) [18], the common precursor for ACTH-related and ␤-endorphin-related end-products appeared early during the radiation of the vertebrates. The POMC gene has been cloned from a jawless fish [10,24], ray finned fishes [2,7, 15,19,21], amphibians [11,16,20] and mammals (for review see Ref. [8]). In addition, POMC-related products have been detected in reptiles and birds (for review see Ref. [5]). A unifying feature of vertebrate POMC genes is the presence of an MSH or ACTH sequence located roughly in the middle of the precursor, and the presence of a ␤-endorphin sequence located at the C terminal end of the precursor (Fig. 2; [18,24]). During the evolution of the vertebrates, the MSH sequence has been duplicated more than once to yield ␣-MSH, ␤-MSH and ␥-MSH [18,24]. In addition, there is increasing evidence that the entire POMC gene has been duplicated in several lineages during the radiation of the vertebrates. For example, duplicate POMC genes are expressed in the lamprey, Petromyzon marinus [24], salmonid fish [15,19,21] and the amphibian, Xenopus laevis [16]. In

* Corresponding author. Tel.: ⫹1-303-871-3596; fax: ⫹1-303-8713471.

the case of the lamprey, one form of POMC, referred to as POC (proopiocortin), is expressed in the anterior pituitary, and the other form of POMC, POM (proopiomelanotropin), is expressed in the intermediate pituitary [24]. In salmonid fishes and X. laevis, both copies of the POMC gene are expressed in the anterior and intermediate pituitary [16,19, 21]. The expression of duplicate POMC genes is not restricted to just three lineages of vertebrates. Recently, a cDNA coding for POMC was cloned and sequenced from the pituitary of the chondrostean fish, Acipenser transmontanus [2]. This cDNA, currently designated sturgeon POMC A, has an open reading frame of 792 bases. In this study we report the isolation of both sturgeon POMC A and sturgeon POMC B, a second distinct POMC cDNA cloned from the pituitary of A. transmontanus.

2. Materials and Methods 2.1. Animals Sexually immature white sturgeon, Acipenser transmontanus were obtained from the Oregon Cooperative Fishery Research Unit, Oregon State University (Corvallis, Ore-

0196-9781/99/$ – see front matter © 1999 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 9 9 ) 0 0 0 2 1 - 2

432

J. Alrubaian et al. / Peptides 20 (1999) 431– 436

Fig. 1. Nucleotide sequence and deduced amino acid sequence of sturgeon POMC A and POMC B. Multiple clones for sturgeon POMC A and sturgeon POMC B were sequenced in both directions. Amino acids are shown in capital levels and nucleotides are shown in lower case letters. Nucleotide positions that differ are shown in bold. At the amino acid level, silent mutations are marked by (⫹), and mutations that resulted in an amino acid difference are marked by (*). At the amino acid level, predicted paired basic cleavage sites are shown in bold.

J. Alrubaian et al. / Peptides 20 (1999) 431– 436

Fig. 1. (Continued)

433

434

J. Alrubaian et al. / Peptides 20 (1999) 431– 436

gon). Animals were anesthetized with MS-222 (Sigma, St. Louis, MO), and sacrificed by decapitation. Pituitaries were removed and quick frozen on dry ice. mRNA was extracted from individual pituitaries. 2.2. mRNA isolation and cDNA synthesis mRNA was isolated from pituitary tissue by using oligo dT25 paramagnetic beads (Novagen, Madison, WI) [9]. Superscript II reverse transcriptase (Life Technologies, Grand Island, NY) was used to synthesize first-strand cDNA primed from the poly(A) tail by an oligo dT17 anchor primer (5⬘ GACTCGAGTCGGATCCATCGATTTTTTTTTTTTT TTTT 3⬘). To prepare template for all 5⬘RACE reactions, a synthetic poly G tail was added to all first-strand cDNAs using terminal deoxynucleotidyl transferase (Life Technologies, Grand Island, NY). 2.3. Cloning of POMC cDNAs A combination of 3⬘ and 5⬘ RACE [15] was used to obtain the full-length sturgeon POMC cDNAs. 3⬘ RACE employed a degenerate forward primer (POMC1024) targeted to sequence encoding seven residues (i.e. KRYGGFM) that encompass the amino end of ␤-endorphin. The sequence of this primer was 5⬘ AA[A/G][A/C]GITA[C/ T]GGIGGITT[C/T] ATG 3⬘ where the brackets contain mixed bases and ‘I’ represents deoxyinosine that minimizes mismatch instability [12,17]. The reverse primer was identical to the twenty-two 5⬘ nucleotides of the synthetic dT17 anchor primer. Sequence information generated by 3⬘RACE was used to design a gene-specific, reverse primer (STPOMC-R1: 5⬘ATGGCCATCCTTGATCATGAC 3⬘) for use in 5⬘ RACE. The forward primer used in all 5⬘RACE reactions (5⬘Amp dC10: 5⬘ GAATTCGCGGCCGCTTC AGTCCCCCCCCCC 3⬘) was targeted to the synthetic poly G anchor added to all first-strand cDNAs.

primers: T7, SP6, F1 (Fig. 1, nt 335–355), and POMC B R2 (Fig. 1, nt 631– 651). To minimize sequence errors due to Taq DNA polymerase associated nucleotide misincorporation, full-length cDNA sequences reflect the consensus of multiple overlapping clones. Sequences were analyzed for similarity to known genes using the BLAST algorithm [1] at the National Center for Biotechnology Information.

3. Results Two distinct POMC cDNAs were isolated from the pituitary of the sturgeon, Acipenser transmontanus. The nucleotide sequences and the deduced amino acid sequences of the sturgeon POMC A (GenBank #AF092937) and the sturgeon POMC B (GenBank #AF092936) cDNAs are shown in Fig. 1. Gaps were inserted to align the 5⬘UTR and 3⬘UTR regions of the two cDNAs. The number of nucleotide differences in the UTR regions eliminates the possibility that these 2 distinct cDNAs are the result of Taq errors during the PCR amplification of the cDNA products. The open reading frames of POMC A and POMC B are both 792 nucleotides in length, and 94% of the nucleotides positions are identical. Within the open reading frame there are 45 nucleotide substitutions (shown in bold). Within codons, 49% of the nucleotide substitutions occurred at the 3rd position, 22% of the substitutions occurred at the 2nd position, and 29% of the substitutions occurred at the 1st position. This proportion of substitutions within codon positions is not unusual [13]. Within the open reading frame, transitions accounted for 61% of the point mutations, and transversions accounted for 49% of the point mutations. At the amino acid level, there were 14 silent mutations (Fig. 1; ⫹), and 26 non-synonymous nucleotide substitutions resulting in 26 amino acids differences (Fig. 1; *) within the open reading frame.

2.4. Isolation and sequencing of plasmid DNA

4. Discussion

PCR products were purified by Wizard PCR Preps, and ligated into pGEM-T (Promega, Madison, WI). Following heat shock transformation and propagation in Escherichia coli strain DH5␣, transformants were cultured and plasmid DNA was isolated using the CTAB procedure [4]. Plasmids containing appropriate size inserts (300 – 400 bp for 3⬘RACE products; 800 –1000 bp for 5⬘RACE products) were glass milk purified [25] and sequenced by the dideoxy chain termination method [22] using sequenase 2.0 (Amersham, Arlington Heights, IL). The sequencing primers used for 3⬘RACE products were: T7 (5⬘ TAATACGACTCACTATAGGG 3⬘), and SP6 (5⬘ GATTTAGGTGACACTATAG 3⬘). POMC A 5⬘ RACE fragments were sequenced using the following primers: T7, SP6, F1 (Fig. 1, nt 335–355), R2 (Fig. 1, nt 628 – 648), and R3 (Fig. 1, nt 361–381). POMC B 5⬘ RACE fragments were sequenced using the following

The chondrostean fishes may have originated as early as the Carboniferous period, and represent one of the oldest lineages of extant ray-finned fishes [3]. This group has been reduced to two extant families, Polyodintidae (paddlefishes) and Acipenseridae (the sturgeons). Because the chondrostean fish are the sister group to the Neopterygii (gar, bowfin and teleosts), an analysis of the POMC gene in the sturgeon provides a reference point for evaluating the radiation of this gene in the neopterygian fishes. In this regard, it would be interesting to first compare the 2 forms of sturgeon POMC to each other, and then to compare the organization of the sturgeon genes to forms of POMC in a teleost fish (sockeye salmon) that has undergone tetraploidization. A comparison of the degree of primary sequence conservation between sturgeon POMC A and sturgeon POMC B is summarized in Fig. 2. The ␣-MSH sequences in both forms

J. Alrubaian et al. / Peptides 20 (1999) 431– 436

435

Fig. 2. Percent differences between regions of sturgeon POMC A and sturgeon POMC B are compared to Sockeye Salmon POMC A and Sockeye Salmon POMC B [19].

of sturgeon POMC are identical (Fig. 1; positions S140 to V152). These results confirm an earlier HPLC/RIA analysis which predicted that the primary sequence of sturgeon ␣-MSH is identical to mammalian ␣-MSH [14]. In addition, within the entire deduced amino acid sequence of sturgeon ACTH (Fig. 1; positions S140-I178) there is only a single amino acid substitution (Fig. 1; position 165). The ␤-endorphin region was also highly conserved in both forms of sturgeon POMC (Figs. 1 and 2). These observations are in sharp contrast to the situation observed in the two forms of sockeye salmon POMC (Fig. 2; 19) where the duplicate forms of ACTH and ␤-endorphin show considerable primary sequence divergence. In addition, in the forms of sockeye salmon POMC, both the ␥-LPH region and the ␤-MSH regions have diverged, whereas these 2 regions in sturgeon POMC A and B are nearly identical (Figs. 1 and 2). In both sturgeon and sockeye salmon, the N terminal half (N terminal Region, ␥-MSH region, and Joining Peptide region) of POMC show considerable variability between the A form and the B form of POMC (Fig. 2). In the N terminal region of the two sturgeon POMCs (Fig. 1), the amino acid substitutions are minimal. Sturgeon POMC B does have a potential N-linked glycosylation site at positions N52L53S54 (Fig. 1) that is not present in the sturgeon POMC A sequence. More amino acid substitutions are observed in the ␥-MSH region and the Joining Peptide region of the sturgeon POMCs. As reported by Amemiya et al. [2], the ␥-MSH region of sturgeon POMC A lacks a functional proteolytic cleavage site N terminal to the ␥-MSH sequence (Fig. 1; positions Q74-N75), and the MSH Core sequence, HFRW, has mutated in POMC A to HRHW. Given the conventional view of how the prohormone convertases function, it is doubtful that the ␥-MSH sequence is endoproteolytically cleaved out of sturgeon POMC A [1]. However, a paired basic cleavage site is found C terminal to the ␥-MSH sequence in sturgeon POMC A (Fig. 1; positions K98-R99). Thus it is possible that posttranslational processing of sturgeon POMC A may yield a N terminal Region polypeptide that has the ␥-MSH region as a C terminal extension. It is unknown whether such a peptide would be

able to bind to a melanocortin receptor. In sturgeon POMC B the mutations to the ␥-MSH region preclude the latter possibility. Although sturgeon POMC B has retained the MSH core sequence, HFRW (Fig. 1; positions H80-W83), both the N terminal and the C terminal proteolytic cleavage sites that flank the ␥-MSH region have mutated to nonfunctional states. A similar level of degeneration is observed in the ␥-MSH region of gar POMC [5]. Collectively, these observations suggest that in the ray-finned fish lineage there has been a progressive degeneration of the ␥-MSH region, and the eventual deletion of this region in teleost fish [1]. Finally, the Joining Peptide region (E100-D137), a proposed spacer region in POMC [6,7], also has accumulated substitutions in sturgeon POMC A and B, but not to the degree seen in sockeye salmon POMC A and B [19]. Given the number and distribution of point mutations observed between sturgeon POMC A and B, it is unlikely that these 2 cDNAs are the result of PCR-based cloning errors. However, the origin of the 2 forms of sturgeon POMC has not been resolved. At this level of analysis it is unclear whether both POMC genes reflect duplication of a single locus, or are the result of a large scale polyploidization (genome duplication) event. Furthermore, the timing of the duplication has not been resolved. Using the alignment of sockeye POMC A and B proposed by Okuta et al. [19], it is possible to estimate the timing for the sturgeon POMC duplication event. Based on the assumption that the salmonid fish underwent a tetraploidization event 80 million years ago [19], the rate of amino acid substitutions between sockeye POMC A and B is approximately 3 substitutions/1 million years. If the POMC gene has been evolving at a uniform rate, then the salmon substitution rate (3 substitutions/1 million years) can be applied to any lineage. Based on these assumptions, since 26 amino acid substitutions were observed between sturgeon POMC A and B (Fig. 1), then the duplication of sturgeon POMC would be predicted to have occurred approximately 8 million years ago. If these assumptions are correct, then a similar set of duplicate forms of POMC should not be found in the paddlefish, another chondrostean fish that shared a common ancestor

436

J. Alrubaian et al. / Peptides 20 (1999) 431– 436

with the sturgeon lineage over 150 million years ago [3]. However, if the sturgeon lineage is evolving at a very slow rate, as proposed by Stanley [23], and if the rate of substitutions in POMC is lineage specific, then the duplication of sturgeon POMC may have been a much earlier event in vertebrate phylogeny. Both of these scenarios are testable.

Acknowlegments We wish to thank Tina Ruth for her help with the preparation of the manuscript, and Cristina Sollars and Stephanie Lecaude for their careful reading of this manuscript. This research was supported by NSF grants IBN9597171 (RMD) and IBN-9810516 (RMD & PD).

[10]

[11]

[12]

[13] [14]

[15]

References [1] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJJ. Basic logical alignment search tool. Mol Biol 1990;215:403–10. [2] Amemiya Y, Takahashi A, Dores RM, Kawauchi H. Sturgeon proopiomelanocortin has a remnant of ␥- elanotropin. Biochem Biophys Res Comm 1997;230:452– 6. [3] Carroll RL. In: Vertebrate paelontology and evolution. New York: W.H. Freeman and Co.; 1988:84 –110. [4] Del Sal G, Manifioletti G, Schneider C. The TAB-DNA precipitation method. A common mini-scale preparation of template DNA from phagemids, phages, or plasmids suitable for sequencing. BioTechniques 1989;7:514 –20. [5] Dores RM, Steveson TC, Price ML. A view of the N-acetylation of ␣-melanocyte-stimulating hormone and ␤-endorphin from a phylogenetic perspective. Ann NY Acad Sci 1993;680:161–74. [6] Dores RM, Rubin DA, Quinn TW. Review: is it possible to construct phylogenetic trees using polypeptide hormone sequences? Gen Comp Endocrinol 1996;103:1–12. [7] Dores RM, Smith TR, Marra LE, Danielson P, Marra L, Youson J. Deciphering post-tractional processing events in the pituitary of a neopterygian fish: cloning of a gar proopiomelanocortin cDNA. Gen Comp Endocrinol 1997;107:401–13. [8] Douglass J, Civelli O, Herbert E. Polyprotein gene expression: generation of diversity of neuroendocrine peptides. Ann Rev Biochem 1984;53:665–715. [9] Frohman MA, Dush MK, Martin GR. Rapid production of full length cDNAs from rare transcripts: amplification using a single gene-

[16]

[17] [18]

[19]

[20] [21]

[22] [23] [24]

[25]

specific oligonucleotide primer. Proc Natl Acad Sci USA 1988;85: 8998 –9002. Heinig JA, Keeley FW, Robson P, Sower SA, Youson J. The appearance of proopiomelanocortin early in vertebrate evolution: cloning and sequencing of POMC from a lamprey pituitary cDNA library. Gen Comp Endocrinol 1995;99:137– 44. Hilario E, Lihrmann I, Vaudry H. Characterization of the cDNA encoding proopiomelanocortin in the frog Rana ridibunda. Biochem Biophys Res Comm 1990;173:653–9. Jakobsen KS, Haugen M, Saeboe–Larsen S, Hollung K, Espelund M, Hornes E. In: Uhlon M, Hornes E, Olsvik O, eds. Advances in biomagnetic separation. Eaton Publishing: Oslo; 1994;61–71. Li W–H, Grau D. In: Fundamentals of molecular Evolution. Sinauer: Sunderland, MA; 1991. Keller H, Redding M, Moberg G, Dores, R. M. Analysis of the posttranslational processing of ␣-MSH in the pituitaries of the chondrostean fishes, Acipenser transmontanus, and Polyodon spathula. Gen Comp Endocrinol 1994;94:159 – 65. Kitahara N, Nishizawa T, Iida K, Okazaki H, Andoh T, Soma G. Absence of a ␥-melanocyte-stimulating hormone sequence in proopiomelanocortin mRNA of chum salmon, Onchorhynchus keta. Biochem Biophys Res Comm 1988;91B:365–70. Martens GJM. Expression of two proopiomelanocortin genes in the pituitary of Xenopus laevis: complete structures of the two preprohormones. Nucl Acids Res 1986;14:3791– 8. Martin FH, Castro MM. Base pairing involving deoxyinosine: implications for probe design. Nucl Acids Res 1985;13:8927–38. Nakanishi S, Inoure A, Kita T, Nakamura M, Chang ACY, Cohen SN, Numa S. Nucleotide sequence of cloned cDNA for bovine corticiotropin-␤-lipotropin precursor. Nature 1979;278:423–7. Okuta A, Ando H, Ueda H, Urano A. Two types of cDNAs encoding proopiomelanocortin of sockeye salmon, Onchorhynchus nerka. Zool Sci 1996;13:421–7. Pan F, Chang WC. Nucleotide sequence of bullfrog pro-opiomelanocortin cDNA. Nucl Acids Res 1989;17:5843. Salbert G, Chauveau I, Bonnec G, Valotaire Y, Jego P. One of the two trout proopiomelanocortin messenger RNAs potentially encodes new peptides. Mol Endocrinol 1992;6:1605–12. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463–7. Stanley SM. Macroevolution: pattern and process: Johns Hopkins Press: Baltimore, MD; 1998:122–32. Takahashi A, Amemiya Y, Sarashi M, Sower SA, Kawauchi H. Melanoctropin and corticotropin are encoded on two distinct genes in the lamprey, the earliest evolved extant vertebrate. Biochem Biophys Res Comm 1995;213:490 – 6. Vogelstein B, Gillespie D. Preparative and analytical purification of DNA from agarose. Proc Natl Acad Sci USA 1979;76:615–9.