Molecular Cloning of Lungfish Proopiomelanocortin cDNA

General and Comparative Endocrinology 115, 415–421 (1999) Article ID gcen.1999.7327, available online at http://www.idealibrary.com on

Molecular Cloning of Lungfish Proopiomelanocortin cDNA1 Yutaka Amemiya, Akiyoshi Takahashi, Hiroshi Meguro,* and Hiroshi Kawauchi Laboratory of Molecular Endocrinology, School of Fisheries Sciences, Kitasato University, Sanriku, Iwate 022-0101, Japan; and *Institute for the Development of Kansei and Welfare, Tohoku Fukushi University, Sendai, Miyagi 981-8522, Japan Accepted May 21, 1999

To investigate the evolution of proopiomelanocortin (POMC) from fish to tetrapods, nucleotide sequence of POMC cDNA from a lobe-finned fish, the African lungfish, was determined. POMC cDNA was prepared from lungfish pituitary glands. The POMC cDNA is composed of 1114 bp, excluding a poly-A tail, and encodes 255 amino acids (aa) including a signal peptide of 25 aa. The lungfish POMC contains the segment corresponding to ␥-melanotropin (MSH), corticotropin, ␣-MSH, ␤-MSH, and ␤-endorphin at positions (50–61), (108–146), (108– 120), (178–194), and (197–230), respectively. The lungfish POMC shows greater sequence identity on average with amphibian (62%), ancient ray-finned fishes including acipenseriformes and semionotiformes (62%), and mammalian POMC (52%) than with teleostean (49%), elasmobranch (46%), and agnathan POMC (31%). Thus, the overall structural feature of lungfish POMC is close to the tetrapod POMCs which contain ␥-MSH and the ancient ray-finned fishes POMCs containing ␥-MSH-like sequence. However, amino acid sequence of lungfish ␤-endorphin exhibits properties which are specifically observed in the ray-finned fishes and the elasmobranchs.

INTRODUCTION POMC is a precursor protein for ACTH, ␣-MSH, ␤-MSH, ␥-MSH, and ␤-endorphin in tetrapods (Nakanishi et al., 1979; Smith and Funder, 1988; Castro and Morrison, 1997). Recent advances in molecular cloning of fish POMC cDNAs have revealed that fish POMCs vary in the number of MSH sequence depending on the taxonomic classes. In contrast to MSH sequence, only one ␤-endorphin is consistently present at the C-terminal of the precursor throughout vertebrate POMCs. In ray-finned fishes, ␥-MSH is present as a remnant in the early evolved groups such as sturgeon and gar (Amemiya et al., 1997; Dores et al., 1997) but is absent in the most derived group, the teleosts (Kitahara et al., 1988; Salbert et al., 1992; Okuta et al., 1996; Arends et al., 1998). In elasmobranchs, a new MSH in addition to the three classical MSHs was found in dogfish POMC and was thus named ␦-MSH (Amemiya et al., 1999). In agnathans, two distinct precursors were identified in sea lamprey; one contains ACTH and lacks ␤-MSH, and the other contains two MSHs corresponding to ␣-MSH and ␤-MSH (Heinig et al., 1995; Takahashi et al., 1995). These results suggest that POMC gene has evolved by duplication, insertion, deletion, and subsequent point mutations of the MSH segments. To complete the scenario for molecular evolution of POMC, it is indispensable to characterize POMC from

r 1999 Academic Press

1

The accession number of the nucleotide sequence data reported in this paper is AB017199 in the DDBJ, EMBL, and GenBank nucleotide sequence databases. 0016-6480/99 $30.00 Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

415

416

Amemiya et al.

MATERIALS AND METHODS

58-region of lungfish POMC cDNA was amplified using 58 RACE System for Rapid Amplification of cDNA Ends, Version 2 (Life Technologies). Primer B, GATTCATCCTCCATGCCATT, and primer C, TATACCTTGATTGGTCTCCT, were synthesized based on the nucleotide sequence of the 38-region of lungfish POMC cDNA. The primer B was used for reverse transcription, whereas primer C and abridged anchor primer of the kit were used for subsequent PCR. PCR was performed with condition of 35 cycles of 60 s at 94°C, 60 s at 51°C, 120 s at 72°C, and a final extension for 5 min at 72°C. To compensate for the errors, at least three independent PCRs were performed for both the 58and the 38-regions.

Nucleic Acid Preparation

Nucleotide Sequence Determination

Lungfish, Protopterus annectens, was obtained from a commercial dealer in Ibaraki Prefecture, Japan. Pituitary was dissected out and stored at ⫺80°C until analysis. Total RNA was prepared from this pituitary using Isogen (Nippon Gene) and the extracting solution was based on the guanidinium thiocyanate method (Chomczynski et al., 1987).

PCR-amplified cDNA was inserted into pT7 Blue T (Novagen). Plasmid DNA was prepared by the alkaline–SDS method (Mierendorf and Pfeffer, 1987) and then subjected to sequence determination using Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin–Elmer). Nucleotide sequence was determined using 373 DNA sequencer (Perkin–Elmer). DNASIS-Mac (Hitachi) was used for processing, calculating sequence identity, and sequence alignment.

the lobe-finned fish (Sarcopterygii). The Sarcopterygii include lungfish and coelacanth, and are considered to be the basal members of the lineage which led to the tetrapods. Although immunoreactive forms of ␣-MSH, ACTH, and ␤-endorphin have been detected in the African and Australian lungfishes (Vallarino et al., 1992; Dores and Joss, 1988; Dores et al., 1988, 1990), neither POMC nor its cDNA has yet been characterized in the lobe-finned fish. The present paper reports for the first time the cloning and sequence of POMC cDNA from the African lungfish.

PCR Amplification A template for PCR was reverse transcribed from the total RNA at 42°C for 60 min using Moloney Murine Leukemia Virus reverse transcriptase and Not I-d(T)18 bifunctional primer accompanied with a First-Strand cDNA Synthesis Kit (Pharmacia) in a thermal cycler (Minicycler; MJ Research). The degenerate forward primer for the amplification was synthesized based on highly conserved amino acid sequences of MSH; primer-A was designed as ATG(GC)(AG)(AG)CA(TC)TTCCG(CT)TGG. Not I primer corresponding to anchor portion of the Not I-d(T)18 bifunctional primer was used as reverse primer. For PCR, 1 µl of the first-strand cDNA solution was aliquoted in 50 µl solution containing Takara Ex Taq (Takara, 2.5 U) or SuperTaq DNA polymerase (Sawady Technology; 2.5 U), buffer solution accompanied with the enzyme, 10 nmol of each dNTP, and 20 pmol of each primer. The condition for PCR were 30 cycles of 40 s at 92°C, 40 s at 51°C, 100 s at 72°C, and a final extension for 5 min at 72°C. The sample was rapidly cooled to 4°C and analyzed by agarose gel electrophoresis.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Northern Blot Analysis Northern blot analysis for detecting lungfish POMC mRNA was performed as described previously (Amemiya et al., 1999) with modifications. Here, the recombinant plasmid containing lungfish POMC cDNA (421– 1114) was linearized with Bam HI and subsequently subjected to the preparation of RNA probe using DIG RNA Labeling kit (Boehringer Mannheim). Hybridization buffer was prepared from a DIG Easy Hyb (Boehringer Mannheim).

RESULTS PCR, using Primer-A and Not I primer, amplified 38-terminal region of POMC cDNA including base numbers 439–1114 from lungfish pituitary cDNA (Fig. 1). The 58-region of lungfish POMC cDNA includ-

Lungfish POMC cDNA

417

FIG. 1. Nucleotide sequence of lungfish POMC cDNA excluding poly-A tail and deduced amino acid sequence. Numbers of nucleotide and amino acid sequences are indicated at both sides. The deduced amino acid sequence of the proposed prePOMC is numbered by designating predicted N-terminus of POMC as 1. Sequences encoding potential ACTH, MSHs, ␤-endorphin, and signal peptide are indicated by underlines (thick). Box (thin) indicates basic amino acids which flank the hormone segment or act as a processing signal. Box (bold) indicates N-glycosylation site. Nucleotide sequence indicated by lowercase shows position of primer. Arrow shows the direction of the primer. Underline (thin) in 38 noncoding region shows the polyadenylation signal. ***Stop codon.

ing base numbers 1–459 was amplified by PCR using primers C and abridged anchor primer (Fig. 1). Overlapping of these two PCR-amplified cDNAs provided the entire sequence of lungfish POMC cDNA. The resulting cDNA consisted of 1114 bp excluding a poly-A tail and an open reading frame was encoded in POMC cDNA (16–780) (Fig. 1). Five polyadenylation signals consisting of AATAAA were observed in the 38

noncoding region. Northern blot analysis detected a 1.3-kb signal of lungfish POMC mRNA. This is a reasonable value considering the additional base pairs of the poly-A tail. An open reading frame of lungfish POMC cDNA encodes 255 amino acid residues (Fig. 1). Sequence comparison with prePOMCs from ray-finned fishes (Kitahara et al., 1988; Salbert et al., 1992; Okuta et al.,

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

418

1996; Amemiya et al., 1997; Dores et al., 1997; Arends et al., 1998) and from amphibians (Martens, 1986; Pan and Chang, 1989; Hilario et al., 1990) reveals that the first 25-amino-acid sequence of lungfish prePOMC is a signal peptide (Figs. 1 and 2). Accordingly, lungfish POMC is composed of 230 amino acid residues and has ␥-MSH, ACTH, ␣-MSH, ␤-MSH, and ␤-endorphin at positions (50–61), (108–146), (108–120), (178–194), and (197–230), respectively.

DISCUSSION According to Nelson (1994), teleostomes are divided into two groups: sarcopterygians (lobe-finned fishes) and actinopterygians (ray-finned fishes). Sarcopterygians include dipnoans (lungfish) and actinistians (coelacanth) and have evolved into tetrapods. The recent molecular phylogenetic studies support these phylogenetic relationships, i.e., complete mitochondrial gene (Zardoya et al., 1998), nuclear 28S rRNA (Zardoya and Meyer, 1996), pituitary hormones such as prolactin (Noso et al., 1993), growth hormone (May et al., 1999), and neurohypophysial hormones (Hyodo et al., 1997) in lungfish are closely related to those of tetrapods. The present study demonstrated that the lungfish POMC has the same molecular architecture as tetrapod POMCs. Lungfish POMC shows the same extent of sequence identity with amphibians and the ancient ray-finned fishes (Table 1). However, these ray-finned fish POMCs have a remnant of ␥-MSH which may not be functional due to the mutation in the MSH core sequence. The apparent low sequence identity of lungfish POMC with other fish POMCs is due mainly to (i) the absence of ␥-MSH segment in teleostean POMCs, (ii) the insertion of ␦-MSH segment in elasmobranch POMCs, and (iii) the absence of ␤-MSH and ␥-MSH segments in lamprey proopiocortin (POC) and the

Amemiya et al.

absence of ␥-MSH segment in lamprey proopiomelanotropin (POM) (Fig. 2). Sequence identity of each functional segment is compared in Table 1. The lungfish ␥-MSH is more similar to those of tetrapods than to those of elasmobranchs. All ␥-MSH segments including its remnant in the ancient ray-finned fishes have one N-glycosylation consensus sequence (Fig. 2). Joss et al. (1990) found positive staining of ACTH- and MSH-cells in the pituitary of Australian lungfish with periodic acid Schiff. These results indicate that lungfish POMC is glycosylated at the site of the ␥-MSH. The lungfish ACTH shows high degree of sequence identity with those of all vertebrate groups excluding cyclostome, the lamprey (Table 1). This relatively strict structural conservation suggests the functional importance of the segment throughout vertebrates. Also lungfish ␤-MSH shows sequence identities in the same order as the lungfish POMC (Table 1). In contrast to MSH-related segments, lungfish ␤-endorphin is most similar to those of the ancient rayfinned fish, followed by teleost, elasmobranch, amphibian, mammal, and least similar to those of cyclostome (Table 1). The sequence alignment of ␤-endorphins clearly separates lungfish, ray-finned fishes, and elasmobranchs from the tetrapods and agnathans by four consecutive residues after methionine–enkephalin (Fig. 2). In conclusion, we have demonstrated that POMC molecule of African lungfish shows overall similarity with amphibians, ancient ray-finned fishes, and tetrapods based on amino acid sequence identity and the occurrence of hormone segments. However, amino acid sequence of lungfish ␤-endorphin exhibits the property which is specifically observed in the elasmobranchs and the ray-finned fishes including the ancient group and the teleosts. Thus, lungfish POMC has evolved in a distinct way compared to the tetrapods and other fishes.

FIG. 2. Amino acid sequence of lungfish POMC compared with POMCs from bovine (Nakanishi et al., 1979), Xenopus A (Martens, 1986), dogfish (Amemiya et al., 1999), sturgeon (Amemiya et al., 1997), gar (Dores et al., 1997), sockeye salmon A (Okuta et al., 1996), lamprey POC (Heinig et al., 1995, Takahashi et al., 1995), and lamprey POM (Takahashi et al., 1995). Numbers of amino acid sequences are indicated at right sides. Bold letter shows lungfish POMC and amino acid identical to lungfish POMC. Underline in sturgeon and gar POMC indicates ␥-MSH-like sequence. Underlines in lamprey POM are MSH-A and MSH-B. Hyphen shows gap.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Lungfish POMC cDNA

419

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

420

Amemiya et al.

TABLE 1 Sequence Identity on Average (%) with Lungfish POMC and Related Peptides POMC

ACTH

␤-MSH

␥-MSH

␤-Endorphin

62 amphibian 62 ancient rf 52 mammal 49 teleost 46 elasmobranch 31 agnathan

78 ancient rf 77 amphibian 76 mammal 71 teleost 71 elasmobranch 42 agnathan

72 amphibian 65 ancient rf 64 mammal 55 teleost 55 elasmobranch 44 agnathan

79 amphibian 73 mammal 67 elasmobranch 42 ancient rf — teleost — agnathan

88 ancient rf 76 teleost 71 elasmobranch 69 amphibian 67 mammal 37 agnathan

Note. Ancient rf means ‘‘the ancient ray-finned fishes’’ including chondrostean and basal neopteryglan. Amino acid sequences of POMC family were taken from lamprey (Heinig et al., 1995; Takahashi et al., 1995), rainbow trout A (Salbert et al., 1992), sockeye salmon A (Okuta et al., 1996), carp (Arends et al., 1998), gar (Dores et al., 1997), sturgeon (Amemiya et al., 1997), dogfish (Amemiya et al., 1999), Xenopus (Martens, 1986), bullfrog (Pan and Chang, 1989), European green frog (Hilario et al., 1990), bovine (Nakanishi et al., 1979), porcine (Boileau et al., 1983), rat (Drouin et al., 1985), mouse (Uhler and Herbert, 1983), guinea pig (Keightley et al., 1991), macaque (Patal et al., 1988), and human (Takahashi et al., 1983). POMCs of tuna and stingray were taken from the DDBJ, EMBL, and GenBank nucleotide sequence databases with the Accession nos. AB020971 and AB0209072, respectively.

ACKNOWLEDGMENTS We express our gratitude to Mr. Punia Peyush, Kitasato University, for his advice on English usage in the manuscript. This study was supported in part by grants from the Fisheries Agency, Japan, and from the Institute for the Development of Kansei and Welfare, Tohoku Fukushi University.

REFERENCES Amemiya, Y., Takahashi, A., Dores, R. M., and Kawauchi, H. (1997). Sturgeon proopiomelanocortin has a remnant of ␥-melanotropin. Biochem. Biophys. Res. Commun. 230, 452–456. Amemiya, Y., Takahashi, A., Suzuki, N., Sasayama, Y., and Kawauchi, H. (1999). A newly characterized melanotropin in proopiomelanocortin in pituitaries of an elasmobranch, Squalus acanthias. Gen. Comp. Endocrinol. 114, 387–395. Arends, R. J., Vermeer, H., Martens, G. J. M., Leumissen, J. A. M., Wendellar Bonga, S. E., and Flik, G. (1998). Cloning and expression of two proopiomelanocortin mRNAs in the common carp (Cyprinus carpio L.). Mol. Endocrinol. 143, 23–31. Boileau, G., Barbeau, C., Jeannotte, L., Chre´tien, M., and Drouin, J. (1983). Complete structure of the porcine pro-opiomelanocortin mRNA derived from the nucleotide sequence of cloned cDNA. Nucleic Acids Res. 11, 8063–8071. Castro, M. G., and Morrison, E. (1997). Post-translational processing of proopiomelanocortin in the pituitary and in the brain. Critical Rev. 11, 35–57. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Dores, R. M., and Joss, J. M. P. (1988). The isolation of multiple forms of ␤-endorphin from the intermediate pituitary of the Australian lungfish, Neoceratodus forsteri. Peptides 9, 801–808. Dores, R. M., Steveson, T. C., and Joss, J. M. P. (1988). Immunological evidence for multiple forms of ␣-melanotropin (␣-MSH) in the pars intermedia of the Australian lungfish, Neoceratodus forsteri. Gen. Comp. Endocrinol. 71, 468–474. Dores, R. M., Adamczyk, D. L., and Joss, J. M. P. (1990). Analysis of ACTH-related and CLIP-related peptides partially purified from the pituitary of the Australian lungfish, Neoceratodus forsteri. Gen. Comp. Endocrinol. 79, 64–73. Dores, R. M., Smith, R. T., Rubin, D. A., Danielson, P., Marra, L. E., and Youson, J. H. (1997). Deciphering posttranslational processing events in the pituitary of a neopterygian fish: Cloning of a gar proopiomelanocortin cDNA. Gen. Comp. Endocrinol. 107, 401–413. Drouin, J., Chamberland, M., Charron, J., Jeannotte, L., and Nemer, M. (1985). Structure of the rat pro-opiomelanocortin (POMC) gene. FEBS Lett. 193, 54–58. Heinig, J. A., Keeley, F. W., Robson, P., Sower, S. A., and Youson, J. H. (1995). The appearance of proopiomelanocortin early in vertebrate evolution: Cloning and sequencing of POMC from a lamprey pituitary cDNA library. Gen. Comp. Endocrinol. 99, 137–144. Hilario, E., Lihrmann, I., and Vaudry, H. (1990). Characterization of the cDNA encoding proopiomelanocortin in the frog, Rana ridibunda. Biochem. Biophys. Res. Commun. 173, 653–659. Hyodo, S., Ishii, S., and Joss, J. M. P. (1997). Australian lungfish neurohypophysial hormone genes encode vasotocin and [Phe2]mesotocin precursors homologous to tetrapod-type precursors. Proc. Natl. Acad. Sci. USA 94, 13339–13344. Joss, J. M. P., Beshaw, M., Williamson, S., Trimble, J., and Dores, R. M. (1990). The adenohypophysis of the Australian lungfish, Neoceratodus forsteri—An immunocytological study. Gen. Comp. Endocrinol. 80, 274–287. Keightley, M. C., Funder, J. M., and Fuller, P. J. (1991). Molecular cloning and sequencing of a guinea pig pro-opiomelanocortin cDNA. Mol. Cell. Endocrinol. 82, 89–98.

Lungfish POMC cDNA Kitahara, N., Nishizawa, T., Iida, K., Okazaki, H., Andoh, T., and Soma, G. I. (1988). Absence of a ␥-melanocyte-stimulating hormone sequence in proopiomelanocortin mRNA of chum salmon Oncorhynchus keta. Comp. Biochem. Physiol. 91B, 365–370. Martens, G. J. M. (1986). Expression of two proopiomelanocortin genes in the pituitary gland of Xenopus laevis: Complete structures of the two preprohormones. Nucleic Acids Res. 14, 3791–3798. May, D., Alrubaian, J., Patel, S., Dores, R. M., and Rand-Weaver, M. (1999). Studies on the GH/SL gene family: Cloning of African lungfish (Protopterus annectens) growth hormone and somatolactin and toad (Bufo marinus) growth hormone. Gen. Comp. Endocrinol. 113, 121–135. Mierendorf, R. C., and Pfeffer, D. (1987). Direct sequencing of denatured plasmid DNA. In ‘‘Methods in Enzymology’’ (A. I. Berger and A. R. Kimmel, Eds.), Vol. 152, pp. 556–562. Academic Press, San Diego. Nakanishi, S., Inoue, A., Kita, T., Nakamura, M., Chang, A. C. Y., Cohen, S. N., and Numa, S. (1979). Nucleotide sequence of cloned cDNA for bovine corticotropin-␤-lipotropin precursor. Nature 278, 423–427. Nelson, J. S. (1994). ‘‘Fishes of the World,’’ 3rd ed. Wiley, New York. Noso, T., Nicoll, C. S., and Kawauchi, H. (1993). Lungfish prolactin exhibits close tetrapod relationships. Biochim. Biophys. Acta 1164, 159–165. Okuta, A., Ando, H., Ueda, H., and Urano, A. (1996). Two types of cDNAs encoding proopiomelanocortin of sockeye salmon, Oncorhynchus nerka. Zool. Sci. 13, 421–427. Pan, F., and Chang, W. C. (1989). Nucleotide sequence of bullfrog pro-opiomelanocortin cDNA. Nucleic Acids Res. 17, 5843. Patel, P. D., Sherman, T. G., and Watson, S. J. (1988). Characterization

421 of pro-opiomelanocortin cDNA from the old world monkey, Macaca nemestrina. DNA 7, 627–635. Salbert, G., Chauveau, I., Bonnec, G., Valotaire, Y., and Jego, P. (1992). One of the two trout proopiomelanocortin messenger RNAs potentially encodes new peptides. Mol. Endocrinol. 6, 1605–1613. Smith, A. I., and Funder, J. W. (1988). Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocr. Rev. 9, 159–179. Takahashi, H., Hakamata, Y., Watanabe, Y., Kikuno, R., Miyata, T., and Numa, S. (1983). Complete nucleotide sequence of the human corticotropin-␤-lipotropin precursor gene. Nucleic Acids Res. 19, 6847–6858. Takahashi, A., Amemiya, Y., Sarashi, M., Sower, S. A., and Kawauchi, H. (1995). Melanotropin and corticotropin are encoded on two distinct genes in the lamprey, the earliest evolved extant vertebrate. Biochem. Biophys. Res. Commun. 213, 490–498. Uhler, M., and Herbert, E. (1983). Complete amino acid sequence of mouse pro-opiomelanocortin derived from the nucleotide sequence of pro-opiomelanocortin cDNA. J. Biol. Chem. 258, 257–261. Vallarino, M., Bunel, D. T., and Vaudry, H. (1992). Alpha-melanocytestimulating hormone (␣-MSH) in the brain of the African lungfish, Protopterus annectens: Immunohistochemical localization and biochemical characterization. J. Comp. Neurol. 322, 266–274. Zardoya, R., and Meyer, A. (1996). Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene. Proc. Natl. Acad. Sci. USA 93, 5449–5454. Zardoya, R., Cao, Y., Hasegawa, M., and Meyer, A. (1998). Searching for the closest living relative(s) of tetrapods through evolutionary analyses of mitochondrial and nuclear data. Mol. Biol. Evol. 15, 506–517.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.