- Email: [email protected]
Cloning of chicken and mouse α1b adrenergic receptor
Biochimica et Biophysica Acta 1396 Ž1998. 263–266
Short sequence-paper
Cloning of chicken and mouse a 1b adrenergic receptor Ana Alonso-Llamazares, Jesus Manuel del Barrio, Emilio Casanova, ´ Lopez-Alonso, ´ Pedro Calvo, Miguel A. Chinchetru ) Departamento de Bioquımica y Biologıa ´ ´ Molecular, UniÕersidad de Leon, ´ 24007 Leon, ´ Spain Received 11 September 1997; revised 2 December 1997; accepted 10 December 1997
Abstract A partial cDNA encoding most of the third intracellular loop of the chicken a 1b adrenergic receptor subtype, obtained by reverse transcription-polymerase chain reaction ŽRT-PCR. techniques using degenerate primers derived from mammalian sequences, was used to isolate an a 1b adrenergic receptor cDNA from brain. The cDNA encodes a potential protein of 507 amino acids and Northern hybridization of polyŽA.q RNA from chicken brain of different developmental stages detected a single 3.5 kb transcript. Analysis of receptor expression indicated that the a 1b adrenergic receptor is widely distributed in chicken tissues, specially kidney and liver. cDNA and genomic clones encoding sequences of the mouse a 1b adrenergic receptor were also isolated. q 1998 Elsevier Science B.V. Keywords: a 1b Adrenergic receptor; cDNA cloning; Tissue distribution; Brain; ŽChicken.; ŽMouse.
a 1-Adrenergic receptors are widely distributed in mammalian tissues, where they participate in many physiological processes such as the control of smooth and cardiac muscle contraction, blood pressure, muscle growth and liver glycogenolysis. In most cell types, it has been shown that activation of a 1 adrenergic receptors leads to inositol phosphate formation and mobilization of intracellular Ca2q w1x. The adrenergic receptors belong to the large family of membrane proteins which are coupled to guanine nucleotide-binding proteins Ž G proteins. . They are divided into three types Ž a 1, a 2 and b . and several cDNAs encoding a 1 adrenergic receptor subtypes, initially named a 1Ara 1D , a 1B and a 1C , have been isolated by molecular cloning w2,3x. The current nomenclature w4x designates the three recombinant a 1 )
Corresponding author. Fax: q34-87-291226.
adrenergic receptors with lower case subscripts Ž a 1a , a 1b , a 1d . and the pharmacologically defined receptors with upper case subscripts Ž a 1A , a 1B .. Most molecular studies about the a 1 adrenergic receptors have been carried out in mammals. In birds, only a b adrenergic receptor subtype has been studied w5x. In this report, we present the molecular cloning, tissue distribution and brain developmental expression of chicken a 1b adrenergic receptor subtype. We also describe the isolation of cDNA and genomic sequences of the mouse receptor. A cDNA fragment Ž 215 bp. of the chicken a 1b adrenergic receptor subtype was isolated by RT-PCR techniques. Degenerate primers derived from rat, hamster and human a 1b adrenergic receptor sequences were designed to amplify a fragment encoding amino acid sequences of the third intracellular loop of the chicken receptor w6–9x. The sense primer was 5X-GTŽ G,C. ATGTAŽT,C.TGŽ T,C.ŽA,C.GŽG,A,
0167-4781r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 7 . 0 0 2 3 0 - 3
264
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
T,C. GTŽG,A,T,C.TA-3X , and the antisense primer was 5X-GCCTTCTT ŽT,C . TC Ž G,A,T,C . C Ž G,T.Ž G,A,T,C. ŽG,C.ŽA,T.ŽG,A.AA-3X. Total RNA was prepared from chicken brain by the RNAzol B method ŽTelTest. and cDNAs were synthesized using 20 m g of total RNA, 1 m g of oligodT primer, 1 m g of random hexamers and 20 units of M-MuLV reverse transcriptase, in a final volume of 50 m l. The cDNA fragment was amplified under the following conditions: 3 min at 948C, followed by 1 min at 948C, 1 min at 478C and 30 s at 728C, for 35 cycles, using 1 m l of the cDNA solution and 1.25 units of Taq DNA polymerase Ž Boehringer Mannheim. . The products of the PCR reactions were resolved on 1% low-melting point agarose, cloned into pGEM vector and sequenced. A similar protocol was used to isolate an a 1b adrenergic receptor cDNA fragment Ž181 bp. from mouse brain as previously w10x. 4 = 10 5 recombinants from a chicken brain cDNA library in lZAP II vector ŽStratagene. were screened with the cDNA fragment obtained by RT-PCR. The cDNA fragment was labeled with w a 32 PxdATP using the Megaprime kit ŽAmersham. . Duplicated filters were hybridized with the 32 P-labeled probe in 6 = SSC Ž1 = SSC s 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0., 5 = Denhardt’s solution, 0.1% SDS, 50 m grml denatured salmon sperm DNA, 0.1% sodium pyrophosphate at 608C for 20 h. Filters were washed twice for 20 min in 2 = SSC, 0.1% SDS at 428C. Three positive clones were isolated and the nucleotide sequence of the insert DNAs were determined from overlapping DNA fragments using the Erase a base and the fmol sequencing kits Ž Promega. . Sequence comparisons were performed with the PCrGene system ŽIntelligenetics. . One million recombinants from a mouse brain 5X-STRETCH cDNA library ŽClontech. were screened with the cDNA fragment isolated by RT-PCR, following a protocol similar to that described for the isolation of the mouse a 1b adrenergic receptor w10x. A positive clone was isolated and the nucleotide sequence of the insert DNA Ž1.6 kbp. was determined as described above. A similar protocol was used to isolate a genomic clone Ž15 kbp. from a mouse genomic library Ž Clontech.. The analysis of the expression of the a 1b adrenergic receptor in chicken tissues was carried out by RT-PCR, following a protocol similar to that de-
scribed above, except that the cDNAs were synthesized using random hexamers, annealing was at 508C and that 30 cycles of amplification were performed. Primers were derived from specific sequences of the third intracellular loop of the cloned receptor cDNA. The sense primer was 5X-ATAGTGGCTAGAAGGACTAC-3X , and the antisense primer was 5XGAGAGCTAAGGAGTTTCTGG -3X. The specificity of the amplified DNA fragment Ž 162 bp. was determined by Southern blotting. After transfer of DNA to nylon membranes Ž Hybond N, Amersham. , hybridization was carried out with a specific 32 P-labeled probe as described above. Washes were performed twice in 0.1 = SSC, 0.1% SDS at 678C for 15 min. PolyŽA. q RNA from chicken brain from different developmental stages was prepared with the QuickPrep Micro mRNA Purification system ŽPharmacia.. Approximately 5 m g of polyŽ A.q RNA were separated in 1.2% formaldehyderagarose gel and transferred to nylon membranes Ž Hybond N, Amersham.. Hybridization was carried out with the 32 P-labeled cDNA fragment Ž162 bp. isolated by RT-PCR, in 5 = SSC, 5 = Denhardt’s, 50% formamide, 0.5% SDS, 5 mM EDTA, pH 8.0, 250 m grml salmon sperm DNA at 428C for 24 h. The filter was washed twice for 15 min at room temperature in 2 = SSC, followed by two additional washes for 15 min at 658C in 2 = SSC, 0.1% SDS. Autoradiography was developed after 10 days of exposure at y708C. The same filter was hybridized with a DNA probe from the chicken glyceraldehyde-3-phosphate dehydrogenase Ž GAPDH. . Degenerate primers, based on sequences from the transmembrane segments flanking the third intracellular loop of hamster, rat and human a 1b adrenergic w6–9x, were used to isolate a homologous cDNA fragment from chicken brain by RT-PCR techniques. The amplified cDNA fragment Ž 215 bp. was used to screen a chicken brain cDNA library. Three positive clones, having DNA inserts of about 2.0, 1.8 and 1.0 kbp, were isolated from the analysis of 4 = 10 5 recombinants. A similar protocol was used for the isolation of a mouse a 1b adrenergic receptor cDNA fragment Ž1.6 kbp., using a cDNA fragment obtained by RT-PCR as previously described w10x. As this clone lacked the 5X end of the receptor cDNA, the N-terminal sequence of the protein was deduced from a genomic clone Ž 15 kbp. isolated from a mouse
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
265
Fig. 2. RT-PCR analysis of the distribution of the a 1b adrenergic receptor subtype in chicken tissues. The tissues studied were lung Ž1., brainstem Ž2., kidney Ž3., muscle Ž4., intestine Ž5., brain Ž6., heart Ž7. and liver Ž8.. Lane 9 corresponds to the amplification without cDNA.
Fig. 1. Deduced amino acid sequences of the chicken and mouse a 1b adrenergic receptor subtype. Proposed membrane-spanning segments TM1–TM7 are underlined. Amino acid sequences are shown using the single-letter code. Asterisks indicate identical amino acids in both sequences.
genomic library ŽClontech. . The deduced amino acid sequences indicated that the a 1b adrenergic receptors are proteins of 507 Žchicken. and 514 Žmouse. amino acids ŽFig. 1.. Both proteins share a 70% identity in their amino acid sequences, which is most evident in the seven hydrophobic transmembrane segments, a feature shared by most of the members of the G-protein coupled receptor superfamily. On the contrary, the proteins are more divergent at the N- and Ctermini. The chicken a 1b adrenergic receptor shows an identity of 70, 47 and 45% in its amino acid sequence with the rat a 1b , a 1d and a 1a subtypes, respectively. The similarity to the other adrenergic receptors is lower. The only avian adrenergic receptor cloned to date has been the turkey b adrenergic receptor w5x. It has the typical topology composed of seven transmembrane-spanning segments and a long
cytoplasmic carboxy-terminal tail. It presents 43 and 30% identity in its nucleotide and amino acid sequences, respectively, with the chicken a 1b adrenergic subtype. The homology is higher in the transmembrane-spanning segments, although the a 1b subtype is longer Ž507 amino acids. than the b subtype Ž483 amino acids. . The a 1b adrenergic receptor subtype is widely distributed in mammalian tissues. We have carried out RT-PCR assays to examine the expression of the a 1b adrenergic receptor subtype in chicken tissues ŽFig. 2., indicating that the distribution of this receptor in chicken is similar to that reported for mam-
Fig. 3. Northern blot analysis to determine the expression of the chicken a 1b adrenergic receptor during brain development. Hybridization was carried out with the specific 32 P-labeled probe Ž162 bp. from the a 1b receptor isolated by RT-PCR and with a probe from the chicken GAPDH. Positions of the 28S Ž4.7 kb. and 18S Ž1.9 kb. rRNA markers are indicated on the left. PolyŽA.q RNA was isolated from embryonic days E6 Žlane 1., E8 Žlane 2., E10 Žlane 3., E12 Žlane 4., E14 Žlane 5., E16 Žlane 6., E18 Žlane 7. and postnatal day P1 Žlane 8..
266
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
mals. It is widely expressed in brain and many extracerebral tissues, specially in kidney and liver. We have also found that a single mRNA transcript of about 3.5 kb is detected in chicken brain during development ŽFig. 3., and that there exists a stable expression of this receptor from early developmental stages, a similar result to that obtained during rat ontogeny w11x. The cloning of cDNAs encoding sequences of the chicken and mouse a 1b adrenergic receptor is the first step directed towards the isolation of their respective genes and the study of their regulatory mechanisms. This work was supported by a grant from the Junta de Castilla y Leon ´ ŽLE 24r93.. J.L.A. holds a Universidad de Leon ´ Fellowship. References w1x K.P. Minneman, T.A. Esbenshade, Annu. Rev. Pharmacol. Toxicol. 34 Ž1994. 117–133.
w2x J. Lomasney, S. Cotecchia, R.J. Lefkowitz, M.G. Caron, Biochim. Biophys. Acta 1095 Ž1991. 127–139. w3x D.B. Bylund, FASEB J. 6 Ž1992. 832–839. w4x R.D. Guarino, D.M. Perez, M.T. Piascik, Cell Signal 8 Ž1996. 323–333. w5x Y. Yarden, H. Rodriguez, S.K. Wong, D.R. Brandt, D.C. May, J. Burnier, R.N. Harkins, E.Y. Chen, J. Ramachandran, A. Ullrich, E.M. Ross, Proc. Natl. Acad. Sci. USA 83 Ž1986. 6795–6799. w6x S. Cotecchia, D.A. Schwinn, R.R. Randall, R.J. Lefkowitz, M.G. Caron, B.K. Kobilka, Proc. Natl. Acad. Sci. USA 85 Ž1988. 7159–7163. w7x M.M. Voigt, J. Kispert, H.M. Chin, Nucleic Acid Res. 18 Ž1990. 1053. w8x C.S. Ramarao, J.M. Kincade-Denker, D.M. Perez, R.J. Gaivin, R. Peter-Riek, R.M. Graham, J. Biol. Chem. 267 Ž1992. 21936–21945. w9x D.H. Weinberg, P. Trivedi, C.P. Tan, S. Mitra, A. PerkinsBarrow, D. Borkowski, C.D. Strader, M. Bayne, Biochem. Biophys. Res. Commun. 201 Ž1994. 1296–1304. w10x A. Alonso-Llamazares, D. Zamanillo, E. Casanova, S. Ovalle, P. Calvo, M.A. Chinchetru, J. Neurochem. 65 Ž1995. 2387–2392. w11x S.K. McCune, J.M. Hill, J. Mol. Neurosci. 6 Ž1995. 51–62.
Short sequence-paper
Cloning of chicken and mouse a 1b adrenergic receptor Ana Alonso-Llamazares, Jesus Manuel del Barrio, Emilio Casanova, ´ Lopez-Alonso, ´ Pedro Calvo, Miguel A. Chinchetru ) Departamento de Bioquımica y Biologıa ´ ´ Molecular, UniÕersidad de Leon, ´ 24007 Leon, ´ Spain Received 11 September 1997; revised 2 December 1997; accepted 10 December 1997
Abstract A partial cDNA encoding most of the third intracellular loop of the chicken a 1b adrenergic receptor subtype, obtained by reverse transcription-polymerase chain reaction ŽRT-PCR. techniques using degenerate primers derived from mammalian sequences, was used to isolate an a 1b adrenergic receptor cDNA from brain. The cDNA encodes a potential protein of 507 amino acids and Northern hybridization of polyŽA.q RNA from chicken brain of different developmental stages detected a single 3.5 kb transcript. Analysis of receptor expression indicated that the a 1b adrenergic receptor is widely distributed in chicken tissues, specially kidney and liver. cDNA and genomic clones encoding sequences of the mouse a 1b adrenergic receptor were also isolated. q 1998 Elsevier Science B.V. Keywords: a 1b Adrenergic receptor; cDNA cloning; Tissue distribution; Brain; ŽChicken.; ŽMouse.
a 1-Adrenergic receptors are widely distributed in mammalian tissues, where they participate in many physiological processes such as the control of smooth and cardiac muscle contraction, blood pressure, muscle growth and liver glycogenolysis. In most cell types, it has been shown that activation of a 1 adrenergic receptors leads to inositol phosphate formation and mobilization of intracellular Ca2q w1x. The adrenergic receptors belong to the large family of membrane proteins which are coupled to guanine nucleotide-binding proteins Ž G proteins. . They are divided into three types Ž a 1, a 2 and b . and several cDNAs encoding a 1 adrenergic receptor subtypes, initially named a 1Ara 1D , a 1B and a 1C , have been isolated by molecular cloning w2,3x. The current nomenclature w4x designates the three recombinant a 1 )
Corresponding author. Fax: q34-87-291226.
adrenergic receptors with lower case subscripts Ž a 1a , a 1b , a 1d . and the pharmacologically defined receptors with upper case subscripts Ž a 1A , a 1B .. Most molecular studies about the a 1 adrenergic receptors have been carried out in mammals. In birds, only a b adrenergic receptor subtype has been studied w5x. In this report, we present the molecular cloning, tissue distribution and brain developmental expression of chicken a 1b adrenergic receptor subtype. We also describe the isolation of cDNA and genomic sequences of the mouse receptor. A cDNA fragment Ž 215 bp. of the chicken a 1b adrenergic receptor subtype was isolated by RT-PCR techniques. Degenerate primers derived from rat, hamster and human a 1b adrenergic receptor sequences were designed to amplify a fragment encoding amino acid sequences of the third intracellular loop of the chicken receptor w6–9x. The sense primer was 5X-GTŽ G,C. ATGTAŽT,C.TGŽ T,C.ŽA,C.GŽG,A,
0167-4781r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 7 . 0 0 2 3 0 - 3
264
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
T,C. GTŽG,A,T,C.TA-3X , and the antisense primer was 5X-GCCTTCTT ŽT,C . TC Ž G,A,T,C . C Ž G,T.Ž G,A,T,C. ŽG,C.ŽA,T.ŽG,A.AA-3X. Total RNA was prepared from chicken brain by the RNAzol B method ŽTelTest. and cDNAs were synthesized using 20 m g of total RNA, 1 m g of oligodT primer, 1 m g of random hexamers and 20 units of M-MuLV reverse transcriptase, in a final volume of 50 m l. The cDNA fragment was amplified under the following conditions: 3 min at 948C, followed by 1 min at 948C, 1 min at 478C and 30 s at 728C, for 35 cycles, using 1 m l of the cDNA solution and 1.25 units of Taq DNA polymerase Ž Boehringer Mannheim. . The products of the PCR reactions were resolved on 1% low-melting point agarose, cloned into pGEM vector and sequenced. A similar protocol was used to isolate an a 1b adrenergic receptor cDNA fragment Ž181 bp. from mouse brain as previously w10x. 4 = 10 5 recombinants from a chicken brain cDNA library in lZAP II vector ŽStratagene. were screened with the cDNA fragment obtained by RT-PCR. The cDNA fragment was labeled with w a 32 PxdATP using the Megaprime kit ŽAmersham. . Duplicated filters were hybridized with the 32 P-labeled probe in 6 = SSC Ž1 = SSC s 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0., 5 = Denhardt’s solution, 0.1% SDS, 50 m grml denatured salmon sperm DNA, 0.1% sodium pyrophosphate at 608C for 20 h. Filters were washed twice for 20 min in 2 = SSC, 0.1% SDS at 428C. Three positive clones were isolated and the nucleotide sequence of the insert DNAs were determined from overlapping DNA fragments using the Erase a base and the fmol sequencing kits Ž Promega. . Sequence comparisons were performed with the PCrGene system ŽIntelligenetics. . One million recombinants from a mouse brain 5X-STRETCH cDNA library ŽClontech. were screened with the cDNA fragment isolated by RT-PCR, following a protocol similar to that described for the isolation of the mouse a 1b adrenergic receptor w10x. A positive clone was isolated and the nucleotide sequence of the insert DNA Ž1.6 kbp. was determined as described above. A similar protocol was used to isolate a genomic clone Ž15 kbp. from a mouse genomic library Ž Clontech.. The analysis of the expression of the a 1b adrenergic receptor in chicken tissues was carried out by RT-PCR, following a protocol similar to that de-
scribed above, except that the cDNAs were synthesized using random hexamers, annealing was at 508C and that 30 cycles of amplification were performed. Primers were derived from specific sequences of the third intracellular loop of the cloned receptor cDNA. The sense primer was 5X-ATAGTGGCTAGAAGGACTAC-3X , and the antisense primer was 5XGAGAGCTAAGGAGTTTCTGG -3X. The specificity of the amplified DNA fragment Ž 162 bp. was determined by Southern blotting. After transfer of DNA to nylon membranes Ž Hybond N, Amersham. , hybridization was carried out with a specific 32 P-labeled probe as described above. Washes were performed twice in 0.1 = SSC, 0.1% SDS at 678C for 15 min. PolyŽA. q RNA from chicken brain from different developmental stages was prepared with the QuickPrep Micro mRNA Purification system ŽPharmacia.. Approximately 5 m g of polyŽ A.q RNA were separated in 1.2% formaldehyderagarose gel and transferred to nylon membranes Ž Hybond N, Amersham.. Hybridization was carried out with the 32 P-labeled cDNA fragment Ž162 bp. isolated by RT-PCR, in 5 = SSC, 5 = Denhardt’s, 50% formamide, 0.5% SDS, 5 mM EDTA, pH 8.0, 250 m grml salmon sperm DNA at 428C for 24 h. The filter was washed twice for 15 min at room temperature in 2 = SSC, followed by two additional washes for 15 min at 658C in 2 = SSC, 0.1% SDS. Autoradiography was developed after 10 days of exposure at y708C. The same filter was hybridized with a DNA probe from the chicken glyceraldehyde-3-phosphate dehydrogenase Ž GAPDH. . Degenerate primers, based on sequences from the transmembrane segments flanking the third intracellular loop of hamster, rat and human a 1b adrenergic w6–9x, were used to isolate a homologous cDNA fragment from chicken brain by RT-PCR techniques. The amplified cDNA fragment Ž 215 bp. was used to screen a chicken brain cDNA library. Three positive clones, having DNA inserts of about 2.0, 1.8 and 1.0 kbp, were isolated from the analysis of 4 = 10 5 recombinants. A similar protocol was used for the isolation of a mouse a 1b adrenergic receptor cDNA fragment Ž1.6 kbp., using a cDNA fragment obtained by RT-PCR as previously described w10x. As this clone lacked the 5X end of the receptor cDNA, the N-terminal sequence of the protein was deduced from a genomic clone Ž 15 kbp. isolated from a mouse
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
265
Fig. 2. RT-PCR analysis of the distribution of the a 1b adrenergic receptor subtype in chicken tissues. The tissues studied were lung Ž1., brainstem Ž2., kidney Ž3., muscle Ž4., intestine Ž5., brain Ž6., heart Ž7. and liver Ž8.. Lane 9 corresponds to the amplification without cDNA.
Fig. 1. Deduced amino acid sequences of the chicken and mouse a 1b adrenergic receptor subtype. Proposed membrane-spanning segments TM1–TM7 are underlined. Amino acid sequences are shown using the single-letter code. Asterisks indicate identical amino acids in both sequences.
genomic library ŽClontech. . The deduced amino acid sequences indicated that the a 1b adrenergic receptors are proteins of 507 Žchicken. and 514 Žmouse. amino acids ŽFig. 1.. Both proteins share a 70% identity in their amino acid sequences, which is most evident in the seven hydrophobic transmembrane segments, a feature shared by most of the members of the G-protein coupled receptor superfamily. On the contrary, the proteins are more divergent at the N- and Ctermini. The chicken a 1b adrenergic receptor shows an identity of 70, 47 and 45% in its amino acid sequence with the rat a 1b , a 1d and a 1a subtypes, respectively. The similarity to the other adrenergic receptors is lower. The only avian adrenergic receptor cloned to date has been the turkey b adrenergic receptor w5x. It has the typical topology composed of seven transmembrane-spanning segments and a long
cytoplasmic carboxy-terminal tail. It presents 43 and 30% identity in its nucleotide and amino acid sequences, respectively, with the chicken a 1b adrenergic subtype. The homology is higher in the transmembrane-spanning segments, although the a 1b subtype is longer Ž507 amino acids. than the b subtype Ž483 amino acids. . The a 1b adrenergic receptor subtype is widely distributed in mammalian tissues. We have carried out RT-PCR assays to examine the expression of the a 1b adrenergic receptor subtype in chicken tissues ŽFig. 2., indicating that the distribution of this receptor in chicken is similar to that reported for mam-
Fig. 3. Northern blot analysis to determine the expression of the chicken a 1b adrenergic receptor during brain development. Hybridization was carried out with the specific 32 P-labeled probe Ž162 bp. from the a 1b receptor isolated by RT-PCR and with a probe from the chicken GAPDH. Positions of the 28S Ž4.7 kb. and 18S Ž1.9 kb. rRNA markers are indicated on the left. PolyŽA.q RNA was isolated from embryonic days E6 Žlane 1., E8 Žlane 2., E10 Žlane 3., E12 Žlane 4., E14 Žlane 5., E16 Žlane 6., E18 Žlane 7. and postnatal day P1 Žlane 8..
266
A. Alonso-Llamazares et al.r Biochimica et Biophysica Acta 1396 (1998) 263–266
mals. It is widely expressed in brain and many extracerebral tissues, specially in kidney and liver. We have also found that a single mRNA transcript of about 3.5 kb is detected in chicken brain during development ŽFig. 3., and that there exists a stable expression of this receptor from early developmental stages, a similar result to that obtained during rat ontogeny w11x. The cloning of cDNAs encoding sequences of the chicken and mouse a 1b adrenergic receptor is the first step directed towards the isolation of their respective genes and the study of their regulatory mechanisms. This work was supported by a grant from the Junta de Castilla y Leon ´ ŽLE 24r93.. J.L.A. holds a Universidad de Leon ´ Fellowship. References w1x K.P. Minneman, T.A. Esbenshade, Annu. Rev. Pharmacol. Toxicol. 34 Ž1994. 117–133.
w2x J. Lomasney, S. Cotecchia, R.J. Lefkowitz, M.G. Caron, Biochim. Biophys. Acta 1095 Ž1991. 127–139. w3x D.B. Bylund, FASEB J. 6 Ž1992. 832–839. w4x R.D. Guarino, D.M. Perez, M.T. Piascik, Cell Signal 8 Ž1996. 323–333. w5x Y. Yarden, H. Rodriguez, S.K. Wong, D.R. Brandt, D.C. May, J. Burnier, R.N. Harkins, E.Y. Chen, J. Ramachandran, A. Ullrich, E.M. Ross, Proc. Natl. Acad. Sci. USA 83 Ž1986. 6795–6799. w6x S. Cotecchia, D.A. Schwinn, R.R. Randall, R.J. Lefkowitz, M.G. Caron, B.K. Kobilka, Proc. Natl. Acad. Sci. USA 85 Ž1988. 7159–7163. w7x M.M. Voigt, J. Kispert, H.M. Chin, Nucleic Acid Res. 18 Ž1990. 1053. w8x C.S. Ramarao, J.M. Kincade-Denker, D.M. Perez, R.J. Gaivin, R. Peter-Riek, R.M. Graham, J. Biol. Chem. 267 Ž1992. 21936–21945. w9x D.H. Weinberg, P. Trivedi, C.P. Tan, S. Mitra, A. PerkinsBarrow, D. Borkowski, C.D. Strader, M. Bayne, Biochem. Biophys. Res. Commun. 201 Ž1994. 1296–1304. w10x A. Alonso-Llamazares, D. Zamanillo, E. Casanova, S. Ovalle, P. Calvo, M.A. Chinchetru, J. Neurochem. 65 Ž1995. 2387–2392. w11x S.K. McCune, J.M. Hill, J. Mol. Neurosci. 6 Ž1995. 51–62.