- Email: [email protected]
Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum
Experimental Parasitology 132 (2012) 550–555
Contents lists available at SciVerse ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Research Brief
Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum Yurong Yang ⇑, Jing Zheng, Jiaxin Chen State Key Laboratory of Cellular Stress Biology, School of Life Science, Xiamen University, Xiamen, Fujian 361005, People’s Republic of China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
" A small GTPase cdc-42 was cloned
from parasitic nematode Ancylostoma caninum. " The ORF of Accdc-42 contains 191 amino acids residues with a cdc-42 domain. " Phylogenetic analyses revealed that Accdc-42 was highly conserved. " Accdc-42 was expressed in L1/L2, L3 larvae and adult worm of A. caninum.
a r t i c l e
i n f o
Article history: Received 12 January 2012 Received in revised form 7 September 2012 Accepted 10 September 2012 Available online 21 September 2012 Keywords: Ancylostoma caninum Small GTPase Accdc-42 Cloning Phylogenetic analysis
a b s t r a c t CDC-42 is a member of the Rho GTPase subfamily that is involved in many signaling pathways, including mitosis, cell polarity, cell migration and cytoskeleton remodeling. Here, we present the first characterization of a full-length cDNA encoding the small GTPase cdc-42, designated as Accdc-42, isolated from the parasitic nematode Ancylostoma caninum. The encoded protein contains 191 amino acid residues with a predicted molecular weight of 21 kDa and displays a high level of identity with the Rho-family GTPase protein CDC-42. Phylogenetic analysis revealed that Accdc-42 was most closely related to Caenorhabditis briggsae cdc-42. Comparison with selected sequences from the free-living nematode Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, Danio rerio, Mus musculus and human genomes showed that Accdc-42 is highly conserved. AcCDC-42 demonstrates the highest identity to CDC-42 from C. briggsae (94.2%), and it also exhibits 91.6% identity to CDC-42 from C. elegans and 91.1% from Brugia malayi. Additionally, the transcript of Accdc-42 was analyzed during the different developmental stages of the worm. Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adults of A. caninum. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Small GTPases of the Rho family are key players in cytoskeleton remodeling and cell polarity in different systems (Lundquist, 2006), and they function as GDP/GTP-regulated molecular switches. Signal transduction through GTPases requires regulated ⇑ Corresponding author. Address: Department of Biology, Life Science School, Xiamen University, Xiamen, Fujian 361005, People’s Republic of China. Fax: +86 592 2181792. E-mail address: [email protected] (Y. Yang). 0014-4894/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.exppara.2012.09.005
cycling of the GTPases between the GTP-bound active state and the GDP-bound inactive state. A GTP-bound Rho GTPase can bind to various effectors to elicit different biological activities. Rho GTPases are regulated by two classes of enzymes: the GTP-bound state is activated by guanine nucleotide exchange factors (GEFs) and inactivated by GTPase activating proteins (GAPs), leading to the GDP-bound inactive state. GEFs stimulate the exchange of GDP for GTP on GTPases, whereas GAPs inhibit GTPases by potentiating their intrinsic GTPase activity (Lundquist, 2006). CDC-42 is a member of the Rho GTPase subfamily that is involved in many processes, including cell polarity, cell migration
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
551
Fig. 1. Sequence of the Accdc-42 cDNA from A. caninum. The initiator codon and the stop codon are shown, including the position of the 50 untranslated region (UTR) and the 30 UTR. The amino acid translation of the coding DNA is shown on the upper side in signal letter code.
and cytoskeleton remodeling (Kim, 2000). In Caenorhabditis elegans, CDC-42 interacts with the PAR-3/PAR-6/PKC-3 complex, which is involved in polarity maintenance and cell migration (Aceto et al., 2006). CDC-42 organizes embryonic polarity by controlling the localization and activity of PAR proteins (Kay and Hunter, 2001). The interaction of CDC-42 with the PAR-3/PAR-6/PKC-3 complex is conserved throughout animal evolution (Lin et al., 2000; Noda et al., 2001; Solecki et al., 2006) and allows these proteins to function together in diverse cell types (Welchman et al., 2007). In mammalian cells, CDC-42 localizes to cell-cell junctions and is crucial for apico-basal polarity in epithelial cells (Yamanaka et al., 2001). In developing neurons, the PAR-3/PAR-6/PKC-3/CDC-42 complex is required to specify the fate of neurons and maintain the polarity of axons (Cappello et al., 2006; Schwamborn and Puschel, 2004; Solecki et al., 2006). The function of CDC-42 and its interaction with PAR complex has been investigated thoroughly in mammalian cells, Xenopus, Drosophila and C. elegans. However, unlike the free-living nematode C. elegans, the function of cdc-42 in hookworms remains unknown. Hookworms are important parasitic nematodes that can parasitize in human and animal intestines. The canine hookworm Ancylostoma caninum parasitizes in the intestines of dogs and sucks blood from the intestine wall. In addition to its veterinary importance, A. caninum can also cause zoonotic disease in humans. The larvae of A. caninum hatch from eggs and develop into infective larvae via two moltings. The infective larvae then infect host animals such as dogs and cats, migrate into the intestine and develop into adult worms following two more moltings. If the infective larvae invade humans, they can cause cutaneous larvae migrans (CLM) or ‘‘creeping eruptions,’’ which are hypersensitivity reactions in response to the migration of A. caninum larvae, though they cannot develop into adult worms just by migrating under the skin. Here, we report the isolation of complementary DNA (cDNA) encoding the small GTPase CDC-42 from A. caninum by RT-PCR. The conceptual translation of cdc-42 indicates that this cDNA encodes a protein of 191 amino acids. We also conducted the phylogenetic analysis of cdc-42 from different species. Finally, RT-PCR was performed to detect Accdc-42 in different stages of A. caninum for transcriptional analysis, and we found that Accdc-42 was expressed in L1/L2 larvae, L3 larvae and adult worms of A. caninum.
2. Material and methods 2.1. Parasite infection and recovery A. caninum has been maintained in the lab by serial passages in dogs since 2005. Fecal cultures from infected dogs were incubated at room temperature to recover first-stage larvae after one day of culture in ddH2O, while second–stage larvae (L2) were recovered after 3 days of culture, and infective third stage larvae (L3) were recovered after 6–7 days of culture (Yang et al., 2009, 2011). L3 larvae were used to infect dogs. Adult worms were collected at necropsy from the intestines of infected dogs one month after inoculation with 3000–5000 L3 via the skin. Nematodes at each stage were recovered and resuspended in phosphate-buffered saline (PBS) and were then washed extensively to remove any debris and subsequently frozen at 70 °C before RNA extraction. Dogs were housed in animal rooms according to laboratory animal care guidelines, and the study was approved by XMU (approval No. 2010081808) and conducted with adherence to the guidelines of XMU for animal husbandry. 2.2. RNA extraction Adult worm mRNA was extracted using the Trizol (MRC) method following the protocol of the manufacturer (MRC). The precipitated RNA pellet was resuspended in 30 lL of RNase-free DEPC-treated water. In addition, 5 lL of RNA was run on a 1% agarose gel. Adult worm cDNA was prepared using the RevertAid First Strand cDNA Synthesis Kit (Fermentas) with the oligo (dT) primer following the instructions described by the manufacturer. 2.3. Isolation of a full-length cDNA encoding a small GTPase protein cdc-42 from A. caninum and cloning A small GTPase cdc-42 cDNA fragment of A. caninum was obtained by RT-PCR using the adult worm cDNA as a template. Acdc42F (50 -CCGTTTATGATCAAAGGCAGT) and Acdc42R (50 AGAATAAACAGAAGCCAATTTCC) were designed according to the EST sequence (accession No. FC550695) and, in addition to SL1 (50 -GGTTTAATTACCCAAGTTTGAG-30 ) (Hough et al., 1999), were synthesized (Shanghai Sangon Co.). The PCR mixture consisted of
552
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
Fig. 2. Amino acid sequence alignment of A. caninum CDC-42 protein with 18 CDC-42 proteins from other organisms. Alignment was carried out using ClustalW and analyzed in PAUP. Characters were weighted equally and treated as unordered. Residues that are identical in half or more sequences are shaded red. Those that are similar are shaded light red. The organisms and sequence accession numbers used in the alignment are the following: Caenorhabditis briggsae (accession No. XP_002630566.1), Caenorhabditis elegans (accession No. AAC05600.1), Brugia malayi (accession No. XP_001900006.1), Salmo salar (accession No. ACI34097.1), Danio rerio (accession No. NP_956926.1), Xenopus laevis (accession No.NP_001079368.1), Ixodes scapularis (accession No. XP_002403848.1), Apis mellifera (accession No. XP_394608.2), Homo sapiens (accession No. NP_001782.1), Gallus gallus (accession No. NP_990379.1), Drosophila melanogaster (accession No. NP_523414.1), Acyrthosiphon pisum (accession No. NP_001119678.1), Strongylocentrotus purpuratus (accession No. NP_001229607.1), Rattus norvegicus (accession No. AAN63806.1), Bos taurus (accession No. ACJ06401.1), Mus musculus (accession No. AAH64792.1), Saccoglossus kowalevskii (accession No. NP_001161513.1) and Sus scrofa (accession No. NP_001072148.1). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
0.5 lL of cDNA, 5 lL of 10 PCR buffer (Takara Biotechnology Co., Ltd), 5 lL of 2 mM of each deoxynucleotide triphosphate (MBI Fermentas), 0.25 lL of Taq polymerase (5 U/lL, Takara Biotechnology Co., Ltd.), 2.5 lL of 20 lM for each primer (SL1 and Acdc42R), and 34.25 lL of ddH2O. PCR conditions were as follows: denaturing at 95 °C for 5 min followed by 40 cycles of standard PCR (95 °C for 30 s, 45.1 °C for 30 s and 72 °C for 2 min) and final extension at 72 °C for 8 min. The PCR products were electrophoresed in a 1% agarose gel and visualized under an ultraviolet trans-illuminator after staining with ethidium bromide. The amplified PCR product was purified, cloned into the pMD18TA cloning vector (Takara Inc, Dalian, China), transformed into competent Dh5a E. coli and grown overnight at 37 °C on Luria Bertani (LB) plates containing 50 lg/mL ampicillin. Positive colonies were analyzed for inserts by PCR with the Accdc42F and Accdc42R primers. Plasmids DNA was isolated from positive recombinant clones from overnight
cultures, and, following restriction enzyme digestion, the plasmids were sequenced in both directions using M13 vector-specific primers. Commercial sequencing was performed by Invitrogen (Invitrogen Biotechnology Co., Ltd., Shanghai) to confirm their identities. 2.4. Sequence analysis Sequences were analyzed using sequence utilities at the NCBI, and homology searches were performed using the Basic Local Alignment Sequence Tool (BLAST) program at the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih. gov/BLAST). The conceptual translation of cDNA into amino acid sequences was performed using the ORF Finder program from NCBI (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and we then blasted the inferred translated protein sequence to the gene cdc-42. The ‘‘translate’’ selection is available at http://bioinformatics.org/sms/.
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
553
Fig. 3. Phylogenetic tree of CDC-42 proteins from 19 species. Phylogenetic analysis was conducted using the maximum parsimony (MP) and neighbor-joining (NJ) methods employing PAUP v 4.0b10 (Swofford, 1994). A heuristic search with tree bisection–reconnection (TBR) branch swapping was used to infer the shortest trees. The length and retention index (C.I.), excluding uninformative characters, and retention index (R.I.) of the most parsimonious trees were recorded. A bootstrap analysis (using 1000 replicates) was conducted using heuristic searches and TBR branch swapping with the MulTrees option to determine the relative support for clades in the consensus tree. Numbers indicate the percentage association from bootstrap replication.
Fig. 4. cDNA amplification of Accdc-42 in larval and adult stages of A. caninum (arrow head) compared with the internal standard actin band (arrow) from 25 and 30 cycles of RT-PCR products from the mRNA of L1/L2 larvae (lane 1), L3 larvae (lane 2), female adult worms (lane 3) and male adult worms (lane 4). Lane M: Gene Ruler DNA ladder mixture.
Nucleotide sequences were assembled using the Bioedit program and compared with those in non-redundant databases (GenBank) using the BLASTP suite of programs from the National Center for Biotechnology Information (http://www.nocbi.nlm.nih.gov/ BLAST). Amino acid sequence alignments were carried out using ClustalW. 2.5. Phylogenetic analysis Amino acid sequences derived from the full-length cDNA sequences encoding Accdc-42 from A. caninum (accession No.
JF826240), Caenorhabditis briggsae (accession No. XP_002630566.1), Caenorhabditis elegans (accession No. AAC05600.1), Brugia malayi (accession No. XP_001900006.1), Salmo salar (accession No. ACI34097.1), Danio rerio (accession No. NP_956926.1), Xenopus laevis (accession No. NP_001079368.1), Ixodes scapularis (accession No. XP_002403848.1), Apis mellifera (accession No. XP_394608.2), Homo sapiens (accession No. NP_001782.1), Gallus gallus (accession No. NP_990379.1), Drosophila melanogaster (accession No. NP_523414.1), Acyrthosiphon pisum (accession No. NP_001119678.1), Strongylocentrotus purpuratus (accession No. NP_001229607.1), Rattus norvegicus
554
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
(accession No. AAN63806.1), Bos taurus (accession No. ACJ06401.1), Mus musculus (accession No. AAH64792.1), Saccoglossus kowalevskii (accession No. NP_001161513.1) and Sus scrofa (accession No. NP_001072148.1) were employed in the phylogenetic analyses. The amino acid sequence data from the above species were aligned using ClustalW, and the phylogenetic analysis was conducted using the maximum parsimony (MP) and neighbor-joining (NJ) methods employing PAUP v 4.0b10 (Swofford, 1994). Characters were weighted equally and treated as unordered. A heuristic search with tree bisection–reconnection (TBR) branch swapping was used to infer the shortest trees. The length and retention index (C.I.), excluding uninformative characters, and retention index (R.I.) of the most parsimonious trees were recorded. A bootstrap analysis (using 1000 replicates) was conducted using heuristic searches and TBR branch swapping with the MulTrees option to determine the relative support for clades in the consensus tree. 2.6. Transcriptional analysis of Accdc-42 in different stages of A. caninum In order to evaluate the expression patterns of Accdc-42 transcripts from different stages of A. caninum, the first strand cDNA was synthesized from different stages and both sexes of A. caninum using oligo (dT) primers and RevertAid™ H Minus M-MuLV reverse transcriptase as described above (Fermentas). The synthesized cDNA was subjected to PCR (50 lL reaction volume) in a thermocycler (ICycle, Bio-Rad) under the conditions described above. PCR was performed with the Acdc42R and SL1 primers for Accdc-42 and actin (ActF: 50 -cgtggttactctttcaccaccaccgctg-30 and ActR: 50 catttagaagcacttgcggtgaacgatgg-30 ) designed according to the EST sequence (EX560345) separately. The PCR was performed as following: denature at 94 °C for 5 min, cycle at 94 °C for 30 s, 51.8 °C for 30 s and 72 °C for 1 min for 40 rounds, followed by 1 round of 72 °C for 8 min. A 5 lL quantity of each amplicon was taken after 25 cycles, 30 cycles and 35 cycles. Control samples without cDNA template were included in each PCR run. Following the PCR, 5 lL of each amplicon was loaded and resolved in a 1% (w/v) agarose gel, stained with ethidium bromide, and photographed upon trans-illumination UV light. 3. Results 3.1. Sequence analysis of the small GTPase gene Accdc-42 from A. caninum The cDNA fragment of Accdc-42, which was approximately 1000 bp, was amplified from A. caninum adult mRNA by RT-PCR using SL1 and the Accdc-42 reverse primer; following gel purification, the fragment was then cloned into the pMD-18T vector, and positive colonies were screened by PCR using the Accdc-42 forward and reverse primers. The plasmid DNA was extracted and digested via restriction enzyme and then was sent for commercial sequencing (Invitrogen, Shanghai) using conventional M13 primers. The plasmid sequences were analyzed using BLAST. The sequence analysis revealed that the full length of Accdc-42 cDNA was 893 bp (accession No. JF826240). The ATG start codon is found at 60–62 bp, and the stop codon is found between 633 and 635 bp. The predicted open reading frame is 575 bp, extending from 60 to 635 bp (Fig. 1) and encoding 191 amino acid residues with a predicted molecular weight of 21 kDa. The open reading frame contains the Ras-like GTPase superfamily domain and the CDC-42 protein domain. The 50 untranslated region is approximately 60 bp long, while the 30 untranslated region is about 370 bp.
3.2. Phylogenetic analysis Compared with selected sequences from 18 animals, sequence alignments showed that the predicted amino acid sequence of Accdc-42 is highly conserved. Phylogenetic analysis revealed that AcCDC-42 is most closely related to C. briggsae CDC-42, and the amino acid sequences of CDC-42 from different species are highly conserved (Fig. 2). The highest sequence identity for AcCDC-42 was C. briggsae (94.2%), while AcCDC-42 had 91.6% identity with C. elegans, 91.1% with Brugia malayi, and 89.5% with S. salar and I. scapularis. Additionally, AcCDC-42 had 89% identity with D. melanogaster, Apis mellifera and Xenopus laevis and 88% identity with Homo sapiens. The lowest identity, with Sus scrofa, was 86.4%. The phylogenetic tree of CDC-42 proteins from different species forms three clades (Fig. 3): vertebrates form one clade, and the invertebrates form two clades, arthropods and nematodes. The sequences of CDC-42 from 19 species were highly conserved with high similarity and identity between different species. 3.3. Transcriptional analysis of Accdc-42 from different stages of A. caninum by RT-PCR In order to determine the expression of Accdc-42 in different stages of A. caninum, the transcript of Accdc-42 was analyzed for larval stages and the adult worm using the Accdc-42R and SL1 primers. The specific 1000 bp band was amplified from the cDNA of L1/L2 larvae, L3 larvae, and female and male adult worms (Fig. 4). Actin, an inner control, was amplified at same time; the fragment was approximately 500 bp. This implied that Accdc-42 was highly conserved and expressed in L1/L2 larvae, L3 larvae and adult worms. 4. Discussion Members of the Rho family are important for cell division and cell cycle regulation. In this paper, we report the cloning and phylogenetic analysis of a small GTPase cdc-42 from A. caninum. The full-length sequence of Accdc-42 is 893 bp with an open reading frame of 570 bp, which encodes a 191 amino acid protein with a predicted molecular weight of 21 kDa. Phylogenetic analysis revealed that the deduced amino acid sequence of Accdc-42 was highly conserved and homologous to CDC42 sequences from C. briggsae (94.2% identity), Caenorhabditis elegans (91.6% identity), Brugia malayi (91.1% identity) and human (88% identity). In addition, Accdc-42 was characterized at the mRNA level in different developmental stages of the worm, and we found that Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adult worms of A. caninum. The small GTPase protein CDC-42 functions in cell polarity and has been shown to act by regulating the PAR-3 complex (Lin et al., 2000; Noda et al., 2001). CDC-42 and the PAR-3 complex function together in different organisms (Joberty et al., 2000). In mammalian cells, CDC-42 induces actin polymerization and filopodia formation in conjunction with its regulation of cell polarity (Lin et al., 2000). Additionally, CDC-42 is involved in neuronal migration and cell cycle progression (Solecki et al., 2006). In C. elegans, CDC-42 is required to remove PAR-2 from the cortex at the end of meiosis and to localize PAR-6 to the cortex (Schonegg and Hyman, 2006). CDC-42 controls early cell polarity and spindle orientation in C. elegans, as well (Gotta et al., 2001). Whether CDC-42 is involved in cell polarity and interacts with other proteins in parasitic nematodes remains unknown. There have been some reports about Rho small GTPases in parasites, including Schistosoma (Quack et al., 2009; Vermeire et al., 2003), Entamoeba histolytica (Arias-Romero et al., 2007; Gonzalez De la Rosa et al., 2007;
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
Majumder et al., 2006), Trypanosoma cruzi (De Melo et al., 2006; de Melo et al., 2004) and Trichinella sprialis (Yang et al., 2010a,b), but few studies on small GTPases in parasitic nematodes have been performed. Several reports have indicated that bacterial toxins target Rho proteins in the host (Aktories, 1997). Pathogenic bacteria have evolved virulence factors that are directed towards Rho GTPases (Boquet and Lemichez, 2003). Some bacterial toxins mimic eukaryotic Rho GTPase-activating proteins (GAPs) to inactivate mammalian GTPases, and bacterial toxins may modify the actin cytoskeleton (Barbieri et al., 2002) and act as adenylate cyclases, which directly elevate intracellular cAMP to supra-physiological levels. Inactivation of host Rho GTPases is a widespread strategy employed by bacterial pathogens to manipulate mammalian cellular functions and avoid immune defenses (Colinet et al., 2007). Invasion of target epithelia by Chlamydiae parvum includes host cell membrane alterations, which require a remodeling of the host cell actin cytoskeleton and trigger host cell PI3K/frabin signaling to activate the CDC-42 pathway, resulting in host cell actin remodeling at the host cell-parasite interface (Chen et al., 2004). Depletion of CDC-42 mRNA by short interfering RNA-mediated gene silencing has been shown to inhibit C. parvum invasion. Clostridial Toxin B, which is a known enzymatic inhibitor of Rac, CDC-42 and Rho GTPases, has been shown to significantly reduce chlamydial invasion of HeLa cells (Carabeo et al., 2004). Whether eukaryotic parasites use endogenous GAPs as immune-suppressive toxins to target the same genes as bacterial pathogens remains unknown. Further studies focusing on this question will be able to shed new light on the relationship between the parasite and the host. Acknowledgments This work was supported by the China National Nature Science Foundation (No. 30972181), a Xiamen Science and Technology grant (3502Z20071077) and the New Century Talents Support Program from Xiamen University to YRY. References Aceto, D., Beers, M., Kemphues, K.J., 2006. Interaction of PAR-6 with CDC-42 is required for maintenance but not establishment of PAR asymmetry in C. elegans. Dev. Biol. 299, 386–397. Aktories, K., 1997. Bacterial toxins that target Rho proteins. J. Clin. Invest. 99, 827– 829. Arias-Romero, L.E., de la Rosa, C.H., Almaraz-Barrera Mde, J., Diaz-Valencia, J.D., Sosa-Peinado, A., Vargas, M., 2007. EhGEF3, a novel Dbl family member, regulates EhRacA activation during chemotaxis and capping in Entamoeba histolytica. Cell Motil. Cytoskeleton 64, 390–404. Barbieri, J.T., Riese, M.J., Aktories, K., 2002. Bacterial toxins that modify the actin cytoskeleton. Annu. Rev. Cell Dev. Biol. 18, 315–344. Boquet, P., Lemichez, E., 2003. Bacterial virulence factors targeting Rho GTPases: parasitism or symbiosis? Trends Cell Biol. 13, 238–246. Cappello, S., Attardo, A., Wu, X., Iwasato, T., Itohara, S., Wilsch-Brauninger, M., Eilken, H.M., Rieger, M.A., Schroeder, T.T., Huttner, W.B., Brakebusch, C., Gotz, M., 2006. The Rho-GTPase cdc42 regulates neural progenitor fate at the apical surface. Nat. Neurosci. 9, 1099–1107. Carabeo, R.A., Grieshaber, S.S., Hasenkrug, A., Dooley, C., Hackstadt, T., 2004. Requirement for the Rac GTPase in Chlamydia trachomatis invasion of nonphagocytic cells. Traffic 5, 418–425. Chen, X.M., Splinter, P.L., Tietz, P.S., Huang, B.Q., Billadeau, D.D., LaRusso, N.F., 2004. Phosphatidylinositol 3-kinase and frabin mediate Cryptosporidium parvum cellular invasion via activation of Cdc42. J. Biol. Chem. 279, 31671–31678.
555
Colinet, D., Schmitz, A., Depoix, D., Crochard, D., Poirie, M., 2007. Convergent use of RhoGAP toxins by eukaryotic parasites and bacterial pathogens. PLoS Pathog. 3, e203. De Melo, L.D., Eisele, N., Nepomuceno-Silva, J.L., Lopes, U.G., 2006. TcRho1, the Trypanosoma cruzi Rho homologue, regulates cell-adhesion properties: evidence for a conserved function. Biochem. Biophys. Res. Commun. 345, 617–622. de Melo, L.D., Nepomuceno-Silva, J.L., Sant’Anna, C., Eisele, N., Ferraro, R.B., MeyerFernandes, J.R., de Souza, W., Cunha-e-Silva, N.L., Lopes, U.G., 2004. TcRho1 of Trypanosoma cruzi: role in metacyclogenesis and cellular localization. Biochem. Biophys. Res. Commun. 323, 1009–1016. Gonzalez De la Rosa, C.H., Arias-Romero, L.E., de Jesus Almaraz-Barrera, M., Hernandez-Rivas, R., Sosa-Peinado, A., Rojo-Dominguez, A., Robles-Flores, M., Vargas, M., 2007. EhGEF2, a Dbl-RhoGEF from Entamoeba histolytica has atypical biochemical properties and participates in essential cellular processes. Mol. Biochem. Parasitol. 151, 70–80. Gotta, M., Abraham, M.C., Ahringer, J., 2001. CDC-42 controls early cell polarity and spindle orientation in C. elegans. Curr. Biol. 11, 482–488. Hough, R.F., Lingam, A.T., Bass, B.L., 1999. Caenorhabditis elegans mRNAs that encode a protein similar to ADARs derive from an operon containing six genes. Nucleic Acids Res. 27, 3424–3432. Joberty, G., Petersen, C., Gao, L., Macara, I.G., 2000. The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2, 531–539. Kay, A.J., Hunter, C.P., 2001. CDC-42 regulates PAR protein localization and function to control cellular and embryonic polarity in C. elegans. Curr. Biol. 11, 474–481. Kim, S.K., 2000. Cell polarity: new partners for Cdc42 and Rac. Nat. Cell Biol. 2, E143–E145. Lin, D., Edwards, A.S., Fawcett, J.P., Mbamalu, G., Scott, J.D., Pawson, T., 2000. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat. Cell Biol. 2, 540–547. Lundquist, E.A., 2006. Small GTPases. WormBook, 1–18. Majumder, S., Schmidt, G., Lohia, A., Aktories, K., 2006. EhRho1, a RhoA-like GTPase of Entamoeba histolytica, is modified by clostridial glucosylating cytotoxins. Appl. Environ. Microbiol. 72, 7842–7848. Noda, Y., Takeya, R., Ohno, S., Naito, S., Ito, T., Sumimoto, H., 2001. Human homologues of the Caenorhabditis elegans cell polarity protein PAR6 as an adaptor that links the small GTPases Rac and Cdc42 to atypical protein kinase C. Genes Cells 6, 107–119. Quack, T., Knobloch, J., Beckmann, S., Vicogne, J., Dissous, C., Grevelding, C.G., 2009. The formin-homology protein SmDia interacts with the Src kinase SmTK and the GTPase SmRho1 in the gonads of Schistosoma mansoni. PLoS ONE 4, e6998. Schonegg, S., Hyman, A.A., 2006. CDC-42 and RHO-1 coordinate acto-myosin contractility and PAR protein localization during polarity establishment in C. elegans embryos. Development 133, 3507–3516. Schwamborn, J.C., Puschel, A.W., 2004. The sequential activity of the GTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 7, 923–929. Solecki, D.J., Govek, E.E., Hatten, M.E., 2006. MPar6 alpha controls neuronal migration. J. Neurosci. 26, 10624–10625. Swofford, D.L., 1994. PAUP⁄. Phylogenetic Analysis Using Parsimony (⁄and other methods). Sunderland:Sinauer Associates. Vermeire, J.J., Osman, A., LoVerde, P.T., Williams, D.L., 2003. Characterization of a Rho homologue of Schistosoma mansoni. Int. J. Parasitol. 33, 721–731. Welchman, D.P., Mathies, L.D., Ahringer, J., 2007. Similar requirements for CDC-42 and the PAR-3/PAR-6/PKC-3 complex in diverse cell types. Dev. Biol. 305, 347– 357. Yamanaka, T., Horikoshi, Y., Suzuki, A., Sugiyama, Y., Kitamura, K., Maniwa, R., Nagai, Y., Yamashita, A., Hirose, T., Ishikawa, H., Ohno, S., 2001. PAR-6 regulates aPKC activity in a novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes Cells 6, 721–731. Yang, Y., Jian, W., Qin, W., 2010a. Molecular cloning and phylogenetic analysis of small GTPase protein Tscdc42 from Trichinella spiralis. Parasitol. Res. 106, 801– 808. Yang, Y., Qin, W., Tian, G., Jian, W., 2010b. Expression and functional characterization of a Rho-family small GTPase CDC42 from Trichinella spiralis. Parasitol. Res. 107, 153–162. Yang, Y., Qin, W., Wei, H., Ying, J., Zhen, J., 2011. Characterization of cathepsin B proteinase (AcCP-2) in eggs and larvae stages of hookworm Ancylostoma caninum. Exp. Parasitol. 129, 215–220. Yang, Y., Wei, H., Qin, W., Zheng, J., 2009. Expression and characterization of aspartic protease gene in eggs and larvae stage of Ancylostoma caninum. Parasitol. Res. 104, 1327–1333.
Contents lists available at SciVerse ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Research Brief
Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum Yurong Yang ⇑, Jing Zheng, Jiaxin Chen State Key Laboratory of Cellular Stress Biology, School of Life Science, Xiamen University, Xiamen, Fujian 361005, People’s Republic of China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
" A small GTPase cdc-42 was cloned
from parasitic nematode Ancylostoma caninum. " The ORF of Accdc-42 contains 191 amino acids residues with a cdc-42 domain. " Phylogenetic analyses revealed that Accdc-42 was highly conserved. " Accdc-42 was expressed in L1/L2, L3 larvae and adult worm of A. caninum.
a r t i c l e
i n f o
Article history: Received 12 January 2012 Received in revised form 7 September 2012 Accepted 10 September 2012 Available online 21 September 2012 Keywords: Ancylostoma caninum Small GTPase Accdc-42 Cloning Phylogenetic analysis
a b s t r a c t CDC-42 is a member of the Rho GTPase subfamily that is involved in many signaling pathways, including mitosis, cell polarity, cell migration and cytoskeleton remodeling. Here, we present the first characterization of a full-length cDNA encoding the small GTPase cdc-42, designated as Accdc-42, isolated from the parasitic nematode Ancylostoma caninum. The encoded protein contains 191 amino acid residues with a predicted molecular weight of 21 kDa and displays a high level of identity with the Rho-family GTPase protein CDC-42. Phylogenetic analysis revealed that Accdc-42 was most closely related to Caenorhabditis briggsae cdc-42. Comparison with selected sequences from the free-living nematode Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, Danio rerio, Mus musculus and human genomes showed that Accdc-42 is highly conserved. AcCDC-42 demonstrates the highest identity to CDC-42 from C. briggsae (94.2%), and it also exhibits 91.6% identity to CDC-42 from C. elegans and 91.1% from Brugia malayi. Additionally, the transcript of Accdc-42 was analyzed during the different developmental stages of the worm. Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adults of A. caninum. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Small GTPases of the Rho family are key players in cytoskeleton remodeling and cell polarity in different systems (Lundquist, 2006), and they function as GDP/GTP-regulated molecular switches. Signal transduction through GTPases requires regulated ⇑ Corresponding author. Address: Department of Biology, Life Science School, Xiamen University, Xiamen, Fujian 361005, People’s Republic of China. Fax: +86 592 2181792. E-mail address: [email protected] (Y. Yang). 0014-4894/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.exppara.2012.09.005
cycling of the GTPases between the GTP-bound active state and the GDP-bound inactive state. A GTP-bound Rho GTPase can bind to various effectors to elicit different biological activities. Rho GTPases are regulated by two classes of enzymes: the GTP-bound state is activated by guanine nucleotide exchange factors (GEFs) and inactivated by GTPase activating proteins (GAPs), leading to the GDP-bound inactive state. GEFs stimulate the exchange of GDP for GTP on GTPases, whereas GAPs inhibit GTPases by potentiating their intrinsic GTPase activity (Lundquist, 2006). CDC-42 is a member of the Rho GTPase subfamily that is involved in many processes, including cell polarity, cell migration
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
551
Fig. 1. Sequence of the Accdc-42 cDNA from A. caninum. The initiator codon and the stop codon are shown, including the position of the 50 untranslated region (UTR) and the 30 UTR. The amino acid translation of the coding DNA is shown on the upper side in signal letter code.
and cytoskeleton remodeling (Kim, 2000). In Caenorhabditis elegans, CDC-42 interacts with the PAR-3/PAR-6/PKC-3 complex, which is involved in polarity maintenance and cell migration (Aceto et al., 2006). CDC-42 organizes embryonic polarity by controlling the localization and activity of PAR proteins (Kay and Hunter, 2001). The interaction of CDC-42 with the PAR-3/PAR-6/PKC-3 complex is conserved throughout animal evolution (Lin et al., 2000; Noda et al., 2001; Solecki et al., 2006) and allows these proteins to function together in diverse cell types (Welchman et al., 2007). In mammalian cells, CDC-42 localizes to cell-cell junctions and is crucial for apico-basal polarity in epithelial cells (Yamanaka et al., 2001). In developing neurons, the PAR-3/PAR-6/PKC-3/CDC-42 complex is required to specify the fate of neurons and maintain the polarity of axons (Cappello et al., 2006; Schwamborn and Puschel, 2004; Solecki et al., 2006). The function of CDC-42 and its interaction with PAR complex has been investigated thoroughly in mammalian cells, Xenopus, Drosophila and C. elegans. However, unlike the free-living nematode C. elegans, the function of cdc-42 in hookworms remains unknown. Hookworms are important parasitic nematodes that can parasitize in human and animal intestines. The canine hookworm Ancylostoma caninum parasitizes in the intestines of dogs and sucks blood from the intestine wall. In addition to its veterinary importance, A. caninum can also cause zoonotic disease in humans. The larvae of A. caninum hatch from eggs and develop into infective larvae via two moltings. The infective larvae then infect host animals such as dogs and cats, migrate into the intestine and develop into adult worms following two more moltings. If the infective larvae invade humans, they can cause cutaneous larvae migrans (CLM) or ‘‘creeping eruptions,’’ which are hypersensitivity reactions in response to the migration of A. caninum larvae, though they cannot develop into adult worms just by migrating under the skin. Here, we report the isolation of complementary DNA (cDNA) encoding the small GTPase CDC-42 from A. caninum by RT-PCR. The conceptual translation of cdc-42 indicates that this cDNA encodes a protein of 191 amino acids. We also conducted the phylogenetic analysis of cdc-42 from different species. Finally, RT-PCR was performed to detect Accdc-42 in different stages of A. caninum for transcriptional analysis, and we found that Accdc-42 was expressed in L1/L2 larvae, L3 larvae and adult worms of A. caninum.
2. Material and methods 2.1. Parasite infection and recovery A. caninum has been maintained in the lab by serial passages in dogs since 2005. Fecal cultures from infected dogs were incubated at room temperature to recover first-stage larvae after one day of culture in ddH2O, while second–stage larvae (L2) were recovered after 3 days of culture, and infective third stage larvae (L3) were recovered after 6–7 days of culture (Yang et al., 2009, 2011). L3 larvae were used to infect dogs. Adult worms were collected at necropsy from the intestines of infected dogs one month after inoculation with 3000–5000 L3 via the skin. Nematodes at each stage were recovered and resuspended in phosphate-buffered saline (PBS) and were then washed extensively to remove any debris and subsequently frozen at 70 °C before RNA extraction. Dogs were housed in animal rooms according to laboratory animal care guidelines, and the study was approved by XMU (approval No. 2010081808) and conducted with adherence to the guidelines of XMU for animal husbandry. 2.2. RNA extraction Adult worm mRNA was extracted using the Trizol (MRC) method following the protocol of the manufacturer (MRC). The precipitated RNA pellet was resuspended in 30 lL of RNase-free DEPC-treated water. In addition, 5 lL of RNA was run on a 1% agarose gel. Adult worm cDNA was prepared using the RevertAid First Strand cDNA Synthesis Kit (Fermentas) with the oligo (dT) primer following the instructions described by the manufacturer. 2.3. Isolation of a full-length cDNA encoding a small GTPase protein cdc-42 from A. caninum and cloning A small GTPase cdc-42 cDNA fragment of A. caninum was obtained by RT-PCR using the adult worm cDNA as a template. Acdc42F (50 -CCGTTTATGATCAAAGGCAGT) and Acdc42R (50 AGAATAAACAGAAGCCAATTTCC) were designed according to the EST sequence (accession No. FC550695) and, in addition to SL1 (50 -GGTTTAATTACCCAAGTTTGAG-30 ) (Hough et al., 1999), were synthesized (Shanghai Sangon Co.). The PCR mixture consisted of
552
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
Fig. 2. Amino acid sequence alignment of A. caninum CDC-42 protein with 18 CDC-42 proteins from other organisms. Alignment was carried out using ClustalW and analyzed in PAUP. Characters were weighted equally and treated as unordered. Residues that are identical in half or more sequences are shaded red. Those that are similar are shaded light red. The organisms and sequence accession numbers used in the alignment are the following: Caenorhabditis briggsae (accession No. XP_002630566.1), Caenorhabditis elegans (accession No. AAC05600.1), Brugia malayi (accession No. XP_001900006.1), Salmo salar (accession No. ACI34097.1), Danio rerio (accession No. NP_956926.1), Xenopus laevis (accession No.NP_001079368.1), Ixodes scapularis (accession No. XP_002403848.1), Apis mellifera (accession No. XP_394608.2), Homo sapiens (accession No. NP_001782.1), Gallus gallus (accession No. NP_990379.1), Drosophila melanogaster (accession No. NP_523414.1), Acyrthosiphon pisum (accession No. NP_001119678.1), Strongylocentrotus purpuratus (accession No. NP_001229607.1), Rattus norvegicus (accession No. AAN63806.1), Bos taurus (accession No. ACJ06401.1), Mus musculus (accession No. AAH64792.1), Saccoglossus kowalevskii (accession No. NP_001161513.1) and Sus scrofa (accession No. NP_001072148.1). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
0.5 lL of cDNA, 5 lL of 10 PCR buffer (Takara Biotechnology Co., Ltd), 5 lL of 2 mM of each deoxynucleotide triphosphate (MBI Fermentas), 0.25 lL of Taq polymerase (5 U/lL, Takara Biotechnology Co., Ltd.), 2.5 lL of 20 lM for each primer (SL1 and Acdc42R), and 34.25 lL of ddH2O. PCR conditions were as follows: denaturing at 95 °C for 5 min followed by 40 cycles of standard PCR (95 °C for 30 s, 45.1 °C for 30 s and 72 °C for 2 min) and final extension at 72 °C for 8 min. The PCR products were electrophoresed in a 1% agarose gel and visualized under an ultraviolet trans-illuminator after staining with ethidium bromide. The amplified PCR product was purified, cloned into the pMD18TA cloning vector (Takara Inc, Dalian, China), transformed into competent Dh5a E. coli and grown overnight at 37 °C on Luria Bertani (LB) plates containing 50 lg/mL ampicillin. Positive colonies were analyzed for inserts by PCR with the Accdc42F and Accdc42R primers. Plasmids DNA was isolated from positive recombinant clones from overnight
cultures, and, following restriction enzyme digestion, the plasmids were sequenced in both directions using M13 vector-specific primers. Commercial sequencing was performed by Invitrogen (Invitrogen Biotechnology Co., Ltd., Shanghai) to confirm their identities. 2.4. Sequence analysis Sequences were analyzed using sequence utilities at the NCBI, and homology searches were performed using the Basic Local Alignment Sequence Tool (BLAST) program at the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih. gov/BLAST). The conceptual translation of cDNA into amino acid sequences was performed using the ORF Finder program from NCBI (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and we then blasted the inferred translated protein sequence to the gene cdc-42. The ‘‘translate’’ selection is available at http://bioinformatics.org/sms/.
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
553
Fig. 3. Phylogenetic tree of CDC-42 proteins from 19 species. Phylogenetic analysis was conducted using the maximum parsimony (MP) and neighbor-joining (NJ) methods employing PAUP v 4.0b10 (Swofford, 1994). A heuristic search with tree bisection–reconnection (TBR) branch swapping was used to infer the shortest trees. The length and retention index (C.I.), excluding uninformative characters, and retention index (R.I.) of the most parsimonious trees were recorded. A bootstrap analysis (using 1000 replicates) was conducted using heuristic searches and TBR branch swapping with the MulTrees option to determine the relative support for clades in the consensus tree. Numbers indicate the percentage association from bootstrap replication.
Fig. 4. cDNA amplification of Accdc-42 in larval and adult stages of A. caninum (arrow head) compared with the internal standard actin band (arrow) from 25 and 30 cycles of RT-PCR products from the mRNA of L1/L2 larvae (lane 1), L3 larvae (lane 2), female adult worms (lane 3) and male adult worms (lane 4). Lane M: Gene Ruler DNA ladder mixture.
Nucleotide sequences were assembled using the Bioedit program and compared with those in non-redundant databases (GenBank) using the BLASTP suite of programs from the National Center for Biotechnology Information (http://www.nocbi.nlm.nih.gov/ BLAST). Amino acid sequence alignments were carried out using ClustalW. 2.5. Phylogenetic analysis Amino acid sequences derived from the full-length cDNA sequences encoding Accdc-42 from A. caninum (accession No.
JF826240), Caenorhabditis briggsae (accession No. XP_002630566.1), Caenorhabditis elegans (accession No. AAC05600.1), Brugia malayi (accession No. XP_001900006.1), Salmo salar (accession No. ACI34097.1), Danio rerio (accession No. NP_956926.1), Xenopus laevis (accession No. NP_001079368.1), Ixodes scapularis (accession No. XP_002403848.1), Apis mellifera (accession No. XP_394608.2), Homo sapiens (accession No. NP_001782.1), Gallus gallus (accession No. NP_990379.1), Drosophila melanogaster (accession No. NP_523414.1), Acyrthosiphon pisum (accession No. NP_001119678.1), Strongylocentrotus purpuratus (accession No. NP_001229607.1), Rattus norvegicus
554
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
(accession No. AAN63806.1), Bos taurus (accession No. ACJ06401.1), Mus musculus (accession No. AAH64792.1), Saccoglossus kowalevskii (accession No. NP_001161513.1) and Sus scrofa (accession No. NP_001072148.1) were employed in the phylogenetic analyses. The amino acid sequence data from the above species were aligned using ClustalW, and the phylogenetic analysis was conducted using the maximum parsimony (MP) and neighbor-joining (NJ) methods employing PAUP v 4.0b10 (Swofford, 1994). Characters were weighted equally and treated as unordered. A heuristic search with tree bisection–reconnection (TBR) branch swapping was used to infer the shortest trees. The length and retention index (C.I.), excluding uninformative characters, and retention index (R.I.) of the most parsimonious trees were recorded. A bootstrap analysis (using 1000 replicates) was conducted using heuristic searches and TBR branch swapping with the MulTrees option to determine the relative support for clades in the consensus tree. 2.6. Transcriptional analysis of Accdc-42 in different stages of A. caninum In order to evaluate the expression patterns of Accdc-42 transcripts from different stages of A. caninum, the first strand cDNA was synthesized from different stages and both sexes of A. caninum using oligo (dT) primers and RevertAid™ H Minus M-MuLV reverse transcriptase as described above (Fermentas). The synthesized cDNA was subjected to PCR (50 lL reaction volume) in a thermocycler (ICycle, Bio-Rad) under the conditions described above. PCR was performed with the Acdc42R and SL1 primers for Accdc-42 and actin (ActF: 50 -cgtggttactctttcaccaccaccgctg-30 and ActR: 50 catttagaagcacttgcggtgaacgatgg-30 ) designed according to the EST sequence (EX560345) separately. The PCR was performed as following: denature at 94 °C for 5 min, cycle at 94 °C for 30 s, 51.8 °C for 30 s and 72 °C for 1 min for 40 rounds, followed by 1 round of 72 °C for 8 min. A 5 lL quantity of each amplicon was taken after 25 cycles, 30 cycles and 35 cycles. Control samples without cDNA template were included in each PCR run. Following the PCR, 5 lL of each amplicon was loaded and resolved in a 1% (w/v) agarose gel, stained with ethidium bromide, and photographed upon trans-illumination UV light. 3. Results 3.1. Sequence analysis of the small GTPase gene Accdc-42 from A. caninum The cDNA fragment of Accdc-42, which was approximately 1000 bp, was amplified from A. caninum adult mRNA by RT-PCR using SL1 and the Accdc-42 reverse primer; following gel purification, the fragment was then cloned into the pMD-18T vector, and positive colonies were screened by PCR using the Accdc-42 forward and reverse primers. The plasmid DNA was extracted and digested via restriction enzyme and then was sent for commercial sequencing (Invitrogen, Shanghai) using conventional M13 primers. The plasmid sequences were analyzed using BLAST. The sequence analysis revealed that the full length of Accdc-42 cDNA was 893 bp (accession No. JF826240). The ATG start codon is found at 60–62 bp, and the stop codon is found between 633 and 635 bp. The predicted open reading frame is 575 bp, extending from 60 to 635 bp (Fig. 1) and encoding 191 amino acid residues with a predicted molecular weight of 21 kDa. The open reading frame contains the Ras-like GTPase superfamily domain and the CDC-42 protein domain. The 50 untranslated region is approximately 60 bp long, while the 30 untranslated region is about 370 bp.
3.2. Phylogenetic analysis Compared with selected sequences from 18 animals, sequence alignments showed that the predicted amino acid sequence of Accdc-42 is highly conserved. Phylogenetic analysis revealed that AcCDC-42 is most closely related to C. briggsae CDC-42, and the amino acid sequences of CDC-42 from different species are highly conserved (Fig. 2). The highest sequence identity for AcCDC-42 was C. briggsae (94.2%), while AcCDC-42 had 91.6% identity with C. elegans, 91.1% with Brugia malayi, and 89.5% with S. salar and I. scapularis. Additionally, AcCDC-42 had 89% identity with D. melanogaster, Apis mellifera and Xenopus laevis and 88% identity with Homo sapiens. The lowest identity, with Sus scrofa, was 86.4%. The phylogenetic tree of CDC-42 proteins from different species forms three clades (Fig. 3): vertebrates form one clade, and the invertebrates form two clades, arthropods and nematodes. The sequences of CDC-42 from 19 species were highly conserved with high similarity and identity between different species. 3.3. Transcriptional analysis of Accdc-42 from different stages of A. caninum by RT-PCR In order to determine the expression of Accdc-42 in different stages of A. caninum, the transcript of Accdc-42 was analyzed for larval stages and the adult worm using the Accdc-42R and SL1 primers. The specific 1000 bp band was amplified from the cDNA of L1/L2 larvae, L3 larvae, and female and male adult worms (Fig. 4). Actin, an inner control, was amplified at same time; the fragment was approximately 500 bp. This implied that Accdc-42 was highly conserved and expressed in L1/L2 larvae, L3 larvae and adult worms. 4. Discussion Members of the Rho family are important for cell division and cell cycle regulation. In this paper, we report the cloning and phylogenetic analysis of a small GTPase cdc-42 from A. caninum. The full-length sequence of Accdc-42 is 893 bp with an open reading frame of 570 bp, which encodes a 191 amino acid protein with a predicted molecular weight of 21 kDa. Phylogenetic analysis revealed that the deduced amino acid sequence of Accdc-42 was highly conserved and homologous to CDC42 sequences from C. briggsae (94.2% identity), Caenorhabditis elegans (91.6% identity), Brugia malayi (91.1% identity) and human (88% identity). In addition, Accdc-42 was characterized at the mRNA level in different developmental stages of the worm, and we found that Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adult worms of A. caninum. The small GTPase protein CDC-42 functions in cell polarity and has been shown to act by regulating the PAR-3 complex (Lin et al., 2000; Noda et al., 2001). CDC-42 and the PAR-3 complex function together in different organisms (Joberty et al., 2000). In mammalian cells, CDC-42 induces actin polymerization and filopodia formation in conjunction with its regulation of cell polarity (Lin et al., 2000). Additionally, CDC-42 is involved in neuronal migration and cell cycle progression (Solecki et al., 2006). In C. elegans, CDC-42 is required to remove PAR-2 from the cortex at the end of meiosis and to localize PAR-6 to the cortex (Schonegg and Hyman, 2006). CDC-42 controls early cell polarity and spindle orientation in C. elegans, as well (Gotta et al., 2001). Whether CDC-42 is involved in cell polarity and interacts with other proteins in parasitic nematodes remains unknown. There have been some reports about Rho small GTPases in parasites, including Schistosoma (Quack et al., 2009; Vermeire et al., 2003), Entamoeba histolytica (Arias-Romero et al., 2007; Gonzalez De la Rosa et al., 2007;
Y. Yang et al. / Experimental Parasitology 132 (2012) 550–555
Majumder et al., 2006), Trypanosoma cruzi (De Melo et al., 2006; de Melo et al., 2004) and Trichinella sprialis (Yang et al., 2010a,b), but few studies on small GTPases in parasitic nematodes have been performed. Several reports have indicated that bacterial toxins target Rho proteins in the host (Aktories, 1997). Pathogenic bacteria have evolved virulence factors that are directed towards Rho GTPases (Boquet and Lemichez, 2003). Some bacterial toxins mimic eukaryotic Rho GTPase-activating proteins (GAPs) to inactivate mammalian GTPases, and bacterial toxins may modify the actin cytoskeleton (Barbieri et al., 2002) and act as adenylate cyclases, which directly elevate intracellular cAMP to supra-physiological levels. Inactivation of host Rho GTPases is a widespread strategy employed by bacterial pathogens to manipulate mammalian cellular functions and avoid immune defenses (Colinet et al., 2007). Invasion of target epithelia by Chlamydiae parvum includes host cell membrane alterations, which require a remodeling of the host cell actin cytoskeleton and trigger host cell PI3K/frabin signaling to activate the CDC-42 pathway, resulting in host cell actin remodeling at the host cell-parasite interface (Chen et al., 2004). Depletion of CDC-42 mRNA by short interfering RNA-mediated gene silencing has been shown to inhibit C. parvum invasion. Clostridial Toxin B, which is a known enzymatic inhibitor of Rac, CDC-42 and Rho GTPases, has been shown to significantly reduce chlamydial invasion of HeLa cells (Carabeo et al., 2004). Whether eukaryotic parasites use endogenous GAPs as immune-suppressive toxins to target the same genes as bacterial pathogens remains unknown. Further studies focusing on this question will be able to shed new light on the relationship between the parasite and the host. Acknowledgments This work was supported by the China National Nature Science Foundation (No. 30972181), a Xiamen Science and Technology grant (3502Z20071077) and the New Century Talents Support Program from Xiamen University to YRY. References Aceto, D., Beers, M., Kemphues, K.J., 2006. Interaction of PAR-6 with CDC-42 is required for maintenance but not establishment of PAR asymmetry in C. elegans. Dev. Biol. 299, 386–397. Aktories, K., 1997. Bacterial toxins that target Rho proteins. J. Clin. Invest. 99, 827– 829. Arias-Romero, L.E., de la Rosa, C.H., Almaraz-Barrera Mde, J., Diaz-Valencia, J.D., Sosa-Peinado, A., Vargas, M., 2007. EhGEF3, a novel Dbl family member, regulates EhRacA activation during chemotaxis and capping in Entamoeba histolytica. Cell Motil. Cytoskeleton 64, 390–404. Barbieri, J.T., Riese, M.J., Aktories, K., 2002. Bacterial toxins that modify the actin cytoskeleton. Annu. Rev. Cell Dev. Biol. 18, 315–344. Boquet, P., Lemichez, E., 2003. Bacterial virulence factors targeting Rho GTPases: parasitism or symbiosis? Trends Cell Biol. 13, 238–246. Cappello, S., Attardo, A., Wu, X., Iwasato, T., Itohara, S., Wilsch-Brauninger, M., Eilken, H.M., Rieger, M.A., Schroeder, T.T., Huttner, W.B., Brakebusch, C., Gotz, M., 2006. The Rho-GTPase cdc42 regulates neural progenitor fate at the apical surface. Nat. Neurosci. 9, 1099–1107. Carabeo, R.A., Grieshaber, S.S., Hasenkrug, A., Dooley, C., Hackstadt, T., 2004. Requirement for the Rac GTPase in Chlamydia trachomatis invasion of nonphagocytic cells. Traffic 5, 418–425. Chen, X.M., Splinter, P.L., Tietz, P.S., Huang, B.Q., Billadeau, D.D., LaRusso, N.F., 2004. Phosphatidylinositol 3-kinase and frabin mediate Cryptosporidium parvum cellular invasion via activation of Cdc42. J. Biol. Chem. 279, 31671–31678.
555
Colinet, D., Schmitz, A., Depoix, D., Crochard, D., Poirie, M., 2007. Convergent use of RhoGAP toxins by eukaryotic parasites and bacterial pathogens. PLoS Pathog. 3, e203. De Melo, L.D., Eisele, N., Nepomuceno-Silva, J.L., Lopes, U.G., 2006. TcRho1, the Trypanosoma cruzi Rho homologue, regulates cell-adhesion properties: evidence for a conserved function. Biochem. Biophys. Res. Commun. 345, 617–622. de Melo, L.D., Nepomuceno-Silva, J.L., Sant’Anna, C., Eisele, N., Ferraro, R.B., MeyerFernandes, J.R., de Souza, W., Cunha-e-Silva, N.L., Lopes, U.G., 2004. TcRho1 of Trypanosoma cruzi: role in metacyclogenesis and cellular localization. Biochem. Biophys. Res. Commun. 323, 1009–1016. Gonzalez De la Rosa, C.H., Arias-Romero, L.E., de Jesus Almaraz-Barrera, M., Hernandez-Rivas, R., Sosa-Peinado, A., Rojo-Dominguez, A., Robles-Flores, M., Vargas, M., 2007. EhGEF2, a Dbl-RhoGEF from Entamoeba histolytica has atypical biochemical properties and participates in essential cellular processes. Mol. Biochem. Parasitol. 151, 70–80. Gotta, M., Abraham, M.C., Ahringer, J., 2001. CDC-42 controls early cell polarity and spindle orientation in C. elegans. Curr. Biol. 11, 482–488. Hough, R.F., Lingam, A.T., Bass, B.L., 1999. Caenorhabditis elegans mRNAs that encode a protein similar to ADARs derive from an operon containing six genes. Nucleic Acids Res. 27, 3424–3432. Joberty, G., Petersen, C., Gao, L., Macara, I.G., 2000. The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2, 531–539. Kay, A.J., Hunter, C.P., 2001. CDC-42 regulates PAR protein localization and function to control cellular and embryonic polarity in C. elegans. Curr. Biol. 11, 474–481. Kim, S.K., 2000. Cell polarity: new partners for Cdc42 and Rac. Nat. Cell Biol. 2, E143–E145. Lin, D., Edwards, A.S., Fawcett, J.P., Mbamalu, G., Scott, J.D., Pawson, T., 2000. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat. Cell Biol. 2, 540–547. Lundquist, E.A., 2006. Small GTPases. WormBook, 1–18. Majumder, S., Schmidt, G., Lohia, A., Aktories, K., 2006. EhRho1, a RhoA-like GTPase of Entamoeba histolytica, is modified by clostridial glucosylating cytotoxins. Appl. Environ. Microbiol. 72, 7842–7848. Noda, Y., Takeya, R., Ohno, S., Naito, S., Ito, T., Sumimoto, H., 2001. Human homologues of the Caenorhabditis elegans cell polarity protein PAR6 as an adaptor that links the small GTPases Rac and Cdc42 to atypical protein kinase C. Genes Cells 6, 107–119. Quack, T., Knobloch, J., Beckmann, S., Vicogne, J., Dissous, C., Grevelding, C.G., 2009. The formin-homology protein SmDia interacts with the Src kinase SmTK and the GTPase SmRho1 in the gonads of Schistosoma mansoni. PLoS ONE 4, e6998. Schonegg, S., Hyman, A.A., 2006. CDC-42 and RHO-1 coordinate acto-myosin contractility and PAR protein localization during polarity establishment in C. elegans embryos. Development 133, 3507–3516. Schwamborn, J.C., Puschel, A.W., 2004. The sequential activity of the GTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 7, 923–929. Solecki, D.J., Govek, E.E., Hatten, M.E., 2006. MPar6 alpha controls neuronal migration. J. Neurosci. 26, 10624–10625. Swofford, D.L., 1994. PAUP⁄. Phylogenetic Analysis Using Parsimony (⁄and other methods). Sunderland:Sinauer Associates. Vermeire, J.J., Osman, A., LoVerde, P.T., Williams, D.L., 2003. Characterization of a Rho homologue of Schistosoma mansoni. Int. J. Parasitol. 33, 721–731. Welchman, D.P., Mathies, L.D., Ahringer, J., 2007. Similar requirements for CDC-42 and the PAR-3/PAR-6/PKC-3 complex in diverse cell types. Dev. Biol. 305, 347– 357. Yamanaka, T., Horikoshi, Y., Suzuki, A., Sugiyama, Y., Kitamura, K., Maniwa, R., Nagai, Y., Yamashita, A., Hirose, T., Ishikawa, H., Ohno, S., 2001. PAR-6 regulates aPKC activity in a novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes Cells 6, 721–731. Yang, Y., Jian, W., Qin, W., 2010a. Molecular cloning and phylogenetic analysis of small GTPase protein Tscdc42 from Trichinella spiralis. Parasitol. Res. 106, 801– 808. Yang, Y., Qin, W., Tian, G., Jian, W., 2010b. Expression and functional characterization of a Rho-family small GTPase CDC42 from Trichinella spiralis. Parasitol. Res. 107, 153–162. Yang, Y., Qin, W., Wei, H., Ying, J., Zhen, J., 2011. Characterization of cathepsin B proteinase (AcCP-2) in eggs and larvae stages of hookworm Ancylostoma caninum. Exp. Parasitol. 129, 215–220. Yang, Y., Wei, H., Qin, W., Zheng, J., 2009. Expression and characterization of aspartic protease gene in eggs and larvae stage of Ancylostoma caninum. Parasitol. Res. 104, 1327–1333.