- Email: [email protected]
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
FEMS Microbiology Letters 183 (2000) 15^21
www.fems-microbiology.org
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis Tina Mygind a
a;c
, Iben Zeuthen SÖgaard a;c , Renata Melkova b , Thomas Boesen a , Svend Birkelund a , Gunna Christiansen a; *
Department of Medical Microbiology and Immunology, The Bartholin Building, University of Aarhus, DK-8000 Aarhus C, Denmark b Institute of Preventive and Clinical Medicine, Limbova 14, 83301 Bratislava, Slovak Republic c Department of Molecular and Structural Biology, C.F. MÖllers Alle, Building 130, DK-8000 Aarhus C, Denmark Received 21 October 1999; received in revised form 25 November 1999; accepted 25 November 1999
Abstract The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21T . The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21T showed reaction to a 104-kDa band in addition to the expected 36-kDa band. The protein reacting at 104 kDa is a M. hominis protein with either an epitope similar to one on GAPDH, or it is an immunoglobulin binding protein. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Intraspecies variability; Glyceraldehyde 3-phosphate dehydrogenase ; Mycoplasma hominis
1. Introduction The mycoplasmas are distinct from other eubacteria in their lack of a cell wall, their tendency to form fried-egg colonies on solid medium and their often AT rich genome. Mycoplasmas are considered to be among the smallest prokaryotes because of their small cells with a diameter of approximately 300 nm [1] and their small genome sizes, which range from 580 kbp in Mycoplasma genitalium [2] to 1300 kbp in Mycoplasma iowae [3]. Mycoplasma hominis is considered to be a highly variable species [4]. It is part of the normal £ora of human genitals, but it has been associated with various infections, e.g. isolation of M. hominis from the brain tissue and cerebrospinal £uid of a full-term newborn with meningitis has been reported [5]. However, M. hominis is usually isolated from the lower genitals of both males and females,
* Corresponding author. Tel.: +45 (8942) 1749; Fax: +45 (8619) 6128; E-mail : [email protected]
where it often causes no infection [6]. Nonetheless, it has been found that women colonized with M. hominis who show signs of bacterial vaginosis have an increased risk of preterm delivery and low birth-weight infants [7]. So far, no speci¢c pathogenicity factors have been discovered for M. hominis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) reversibly catalyzes the oxidation and phosphorylation of D-glyceraldehyde 3-phosphate to 1,3-diphosphoglycerate, a reaction which is part of glycolysis. In the SwissProt Protein Database, there are approximately 168 entries for EC 1.2.1.12. Included are also GAPDH sequences from the two mycoplasmas Mycoplasma pneumoniae and M. genitalium [8,2]. The genome sequences of M. genitalium and M. pneumoniae revealed that they carry all enzymes participating in glycolysis, but the second pathway for metabolizing glucose, the pentose phosphate pathway, is incomplete [2,8,9]. The gap gene was cloned and sequenced in M. hominis PG21T . The intraspecies variability of the gap gene was investigated by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) and some
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 6 2 2 - 9
FEMSLE 9196 18-1-00
16
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
variation seemed to be present. A polyclonal antibody (PAb) was produced against part of GAPDH, and the PAb was tested against 15 M. hominis strains to observe whether the gene was expressed. 2. Materials and methods 2.1. M. hominis strains and cultivation The M. hominis strains selected for this study are shown in Table 1 [10^15]. The strains are isolated from a wide variety of geographical and di¡erent anatomical sites. The strains were cultivated in BEa medium [4] and genomic DNA was isolated as described by McClenaghan et al. [16]. 2.2. Cloning, sequencing and computer analysis Cloning was accomplished essentially as described by Nyvold et al. [17]. Sequencing was carried out as described by Mygind et al. [18] with the primers P33^P39 and P42^ P45 in Table 2. Computer analysis was carried out as described by Nyvold et al. [17] unless otherwise stated. The sequences were submitted to the EMBL database with the accession numbers: AJ243692^AJ243700. 2.3. PCR PCR was carried out on puri¢ed genomic DNA from the 15 M. hominis strains using the primers P33 and P36 (909-bp PCR product). PCR was performed as described by Mygind et al. [18], except that only 2.5 U AmpliTaq (R) DNA polymerase was used. PCR products for sequencing were puri¢ed as described by Mygind et al. [18]. The PCR products and the puri¢cations were analyzed in a 0.7% agarose gel. 2.4. Restriction enzyme cleavage For REA of the PCR products from the 15 M. hominis strains, the PCR products were cleaved with AluI (Roche, Mannheim, Germany), MboII (New England Biolabs, Herts, UK) and NlaIII (New England Biolabs) in accordance with the manufacturer's instructions. The restriction fragments were analyzed in 2% agarose gels.
pression vector. Furthermore, a stop codon was added just before the XhoI site in the 3P end. The restriction sites and the stop codon are indicated in the primers P40 and P41 in Table 2. High ¢delity PCR (Expand1 High Fidelity PCR System from Roche) was carried out in a total volume of 50 Wl with 0.75 Wl enzyme mix (3.5U103 U ml31 ), 0.2 mM of each of dATP, dTTP, dGTP and dCTP, 15 pmol of each primer, 5 Wl Expand HF bu¡er with 15 mM MgCl2 , 1.0 Wl puri¢ed genomic DNA and ddH2 0 up to 50 Wl. The following cycling conditions were used: denaturation at 92³C for 1 min, 30 cycles of 92³C for 1 min, 55³C for 30 s, 72³C for 3 min and at last elongation for 10 min at 72³C. The PCR product was analyzed in a 2% agarose gel. The high ¢delity PCR product was cloned into the pCR12.1 vector (TA-cloning kit, Invitrogen, Carlsbad, CA, USA) and then subcloned to the pGEX-4T-1 vector as described by Nyvold et al. [17]. The fusion protein was expressed and puri¢ed as described by Nyvold et al. [17]. The fusion protein is denoted GST-GAPDH. 2.6. Production of a PAb A New Zealand white rabbit was immunized intramuscularly with approximately 50 Wg fusion protein emulsi¢ed in Freunds incomplete adjuvant (Difco laboratories, Detroit, MI, USA) on days 1, 7 and 14. On day 21, a 10-ml blood sample was drawn and tested for presence of antibodies by immunoblotting. The rabbit was immunized intravenously on days 35 and 42 with 50 Wg fusion protein. On day 56, the rabbit was killed and bled. 2.7. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting M. hominis cultures were harvested in the late exponential growth phase and the pellets resuspended in SDS sample bu¡er (62.5 mM Tris^HCl pH 6.8, 10% (v/v) glycerol, 2.3% (w/v) SDS, 5% (v/v) L-mercaptoethanol and 0.05% (w/v) bromophenol blue), heated to 100³C for 5 min, separated by SDS-PAGE (4^20% gradient) and then electrotransferred to nitrocellulose membranes (Schleicher p Schu«ll, Dassel, Germany). Coomassie blue staining and immunoblottings were performed as described by Birkelund and Andersen [19].
2.5. Generation of fusion protein
2.8. Pulsed-¢eld gel electrophoresis and Southern hybridization
High ¢delity PCR was carried out on genomic DNA from the strain PG21T with the primers P40 and P41, which amplify bp 259^912 corresponding to amino acids (aa) 87^304. These primers were designed to have overhang ends which added a BamHI and a XhoI site to the 5P and 3P ends, respectively, of the PCR product and to produce an in-frame PCR product for expression in an ex-
The gap gene was mapped to existing genome maps of ¢ve M. hominis strains ; PG21T , 132, 4195, 93 and 7488. This was done by pulsed-¢eld gel electrophoresis and Southern hybridization as described by Ladefoged et al. [20]. The probe was ampli¢ed by PCR as described in Section 2.3 and it was labelled with [K-32 P]dATP by nick translation [21].
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
3. Results and discussion 3.1. Cloning, sequencing and mapping of the gap gene The gap gene was found on a 2-kbp BglII clone by unspeci¢c hybridization to a probe speci¢c for the p75 gene (Mygind, T., Birkelund, S. and Christiansen, G., unpublished). The gap gene is a 1005-bp (32% G+C) open reading frame translating into 335 aa, which gives a calculated molecular mass of 36.9 kDa. A putative Pribnow box, a putative Shine^Dalgarno sequence and a putative stem-loop transcriptional termination structure were found (vG = 33.95 kcal mol31 ) [22]. The gap/GAPDH sequences are shown in Fig. 1. The active site of GAPDH was identi¢ed using the program MOTIFS. The aa and DNA sequence by FASTA database search showed homology to the M. pneumoniae (63.9% aa identity, 62.5% DNA identity) and M. genitalium (60.4% aa identity, 65.0% DNA identity) sequences. No other mycoplasma gap genes have been sequenced. M. hominis has a gap G+C content of 32% compared to a genomic G+C content of 28%, but lower than the G+C content of gap from Escherichia coli which is 48%. As the G+C content of the M. hominis gap gene is not as low as the overall genomic G+C content, it probably re£ects that there are constraints on mutation of the gap gene in order to maintain the function of GAPDH. The low genomic G+C content and the fact that the G+C content in M. hominis gap is lower than in E. coli gap is a result of an AT pressure on the M. hominis genome, which causes the GC pairs to mutate into AT pairs [23]. By pulsed-¢eld gel electrophoresis and Southern hybridization, the gap gene was positioned on existing genome maps [20] of ¢ve M. hominis strains: PG21T , 132, 4195, 93
17
and 7488. In all these strains, the gap gene was found to be positioned between the unc gene and the ftsY gene. The gap gene was placed on the maps with resolutions between 35 kbp (strain 132) and 130 kbp (strain 93), which means that there are more genes to be identi¢ed on this fragment. 3.2. Intraspecies variability of gap investigated by PCR-RFLP Part of the gap gene was ampli¢ed by PCR with primers P33 and P36 (Table 2) on genomic DNA from the 15 M. hominis strains and cleaved with the restriction enzymes AluI, MboII and NlaIII to investigate the intraspecies variability. PCR products of the expected size of 909 bp were obtained for all 15 strains. The restriction enzyme cleavages are shown in Fig. 2A. It was possible to divide the strains into RFLP groups on the basis of their band patterns. The resulting RFLP groups are shown in Table 1. A varying number of groups appeared for the di¡erent enzymes. AluI displayed the highest number of groups: four, MboII displayed two groups and NlaIII displayed only one group. 3.3. Intraspecies variability of gap/GAPDH investigated by DNA sequencing By REA, some intraspecies variation seemed to be present in the gap gene. This was investigated further by DNA sequencing. Eight strains were chosen for sequencing of part of gap: 7488, 132, 5503, 1621, 1630, 2101, 2126 and 3105. From each of the strains, 811 bp of DNA sequence, which translated into 269 aa, was obtained. The DNA and protein sequences were compared using the program PILEUP and the following results were obtained. At
Table 1 M. hominis strains and RFLP groups Strain
Anatomical site of isolation
Reference
Geographical site of isolation
AluI RFLP group
MboII RFLP group
PG21T 7488
Lower genital tract Cervix
England Aarhus, Denmark
1 2
1 2
SC4 P2 183 10 DC63
Male urethra Upper urinary tract Vagina Vagina Oral cavity
[10] This laboratory [11] [12] [13] [13] [14]
England Aarhus, Denmark USA USA England
3 3 3 2 3
1 1 1 2 1
V2785 5503
Oral cavity Cervix
England Aarhus, Denmark
1 3
2 1
3105
Cervix
Aarhus, Denmark
4
1
132 1621 1630 2101 2126
Vagina Synovial Synovial Synovial Synovial
[14] This laboratory This laboratory [13] [15] [15] [15] [15]
USA USA USA USA USA
3 3 3 3 3
1 1 1 1 1
£uid, £uid, £uid, £uid,
knee knee knee knee
FEMSLE 9196 18-1-00
NlaIII RFLP group
All strains had identical cleavage patterns
18
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
Fig. 1. The DNA and protein sequence of the PG21T gap/GAPDH sequence. The putative Pribnow box and 335 region are indicated by underlining and boldface text. The putative Shine^Dalgarno sequence is indicated by SD. The active site is indicated by underlining of the protein sequence. Downstream the stop codon, the putative stem-loop structure is indicated.
the DNA level, there were 4.3 polymorphic sites per 100 bp, and at the protein level, there were 2.2 polymorphic sites per 100 aa. 20% of the nucleotide substitutions were non-synonymous. Fig. 2B shows the dendrogram output from PILEUP of the DNA sequences. The tree does not contain phylogenetic information, but it demonstrates the relatedness of the sequences by e.g. consideration of informative polymorphic sites. Here, it is seen that the isolates 1621, 1630, 2101 and 2126 have identical sequences, and interestingly, strain 132 has a sequence identical to the sequences of these four strains. The gap sequences of the strains 5503 and 3105 are not as closely related to any of the other sequences, but they are in the same cluster as 1621, 1630, 2101, 2126 and 132. The strains PG21T and 7488 are in a cluster di¡erent from the above-mentioned strains. The early branch formed by isolate 5503 suggests monophyly, therefore the AluI RFLP groups are in overall
agreement with the dendrogram (Fig. 2B). The MboII and NlaIII RFLP groups display less resolution of the isolates and are therefore less informative. The extent of variation in gap is larger than in one of the other hitherto investigated house-keeping genes in M. hominis, 16S rRNA [18]. This gene, which is involved in translation, a more fundamental process in the cell, has only two polymorphic sites of the 1612 bp sequenced (0.12 polymorphic sites per 100 bp). The intraspecies variation of gapA (encoding GAPDH) in E. coli has been studied [24]. When gapA sequences from 18 E. coli strains were compared, 1.3 polymorphic sites per 100 bp were found. Only two of the nucleotide substitutions were non-synonymous (16%). It is apparent that M. hominis allows a greater extent of variation in its gap gene than E. coli. It should be kept in mind though that Guttman and Dykhuizen [24] concluded that the ho-
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
19
Fig. 2. A: PCR products ampli¢ed with primers P33 and P36 cleaved with, AluI, MboII and NlaIII (2% agarose gels). B: The dendrogram output ¢le from a PILEUP multiple alignment of the gap DNA sequences. The strains 132, 1621, 1630, 2101 and 2126 are shown on a vertical line because they have identical DNA sequences.
mogeneity of the gap genes in E. coli strains was due to a selective sweep [24]. The intraspecies heterogeneity of the gap gene of M. hominis can probably not be interpreted as a result of an incomplete species designation, but may re£ect a higher degree of species variation within M. hominis. The fact that incomplete species designation is not the case is validated by the fact that 16S rDNA sequences in ¢ve di¡erent M. hominis strains were found to have maximally two nucleotide di¡erences by pair-wise sequence comparison [18]. 3.4. Expression of GAPDH in M. hominis A PAb was produced in order to verify that the gap
gene is expressed in M. hominis. A rabbit was immunized with the puri¢ed fusion protein GST-GAPDH (aa 87^ 304), and PAb GAPDH was produced. PAb GAPDH was tested against whole cell proteins from the 15 M. hominis strains. In Fig. 3, this immunoblotting is shown. The strain PG21T reacts only with a band of 36 kDa. This corresponds well with the molecular mass of 36.9 kDa calculated from the aa sequence. From this observation, it is clear that the gap gene is expressed in all the strains investigated. However, all strains but PG21T reacted with a band of 104 kDa in addition to the 36-kDa band, which is not readily explainable. PAb GAPDH must therefore react with an epitope on another protein. When the preserum of the immunized rabbit was probed
FEMSLE 9196 18-1-00
20
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
Table 2 List of primers for sequencing and PCR Name
Position in gap or vector
Sequence 5P to 3P
P33 (R) P34 (F) P35 P36 (F) P37 (R) P38 (F) P39 (F) P40 (F)a P41 (R)a P42 (R) P43b P44b P45b
bp 907^935 bp 3766^(3737) bp 3395^(3373) bp 27^47 bp 289^317 bp 571^596 bp 874^907 bp 259^296 bp 880^912 bp 571^596 MCS pCR2.1 MCS pCR2.1 MCS pGEX-4T-1
CATGCATAAACTTTGTATAGTTTTTTGCC CATAATCCTTAGCCTTGCCTATTAATCTTA GCGGGAAAAAGACCAATTGAAAG CGGTTTTGGTGGAATTGGTCG CCTTCTTTTGTTACATATCTTCCAGTTCC GCTCCACACAAAGATTTAAGAAGAGC GACTCACTTTTAACAAGTGTGTTAGAAGTAGAAG GTGGATCCAAAGAACTAAACGTAGATTAGTTATTGAAGGAACTGG GTCTCGAGTCATTTGCCTTCTACTTCTAACACACTTGTTAAAAG GCTCTTCTTAAATCTTTGTGTGGAGC CCAAGCTTGGTACCGAGCTCG GTAATACGACTCACTATAGGGCGAATTGGG GGTGGTGGCGACC
The letters after the primer names indicate direction in the gene; F: forward, R: reverse. a These primers are designed for producing a PCR product with restriction enzyme sites (in bold) added at the ends. The stop codon is indicated by underlining. b The primer is located in the MCS of the pGEX-4T-1 vector.
against the 15 M. hominis strains, the 104-kDa band was not observed (results not shown), therefore the crossreaction should be toward a M. hominis protein possibly with an epitope similar to one on GAPDH. To ¢nd a possible M. hominis protein with homology to GAPDH, the Genpept database at NCBI (http://www.ncbi.nlm.nih.gov/) was searched. A search was performed with the advanced version of BLAST (http://www.ncbi.nlm.nih.gov/BLAST/), with the GAPDH sequence (aa 87^304) from M. hominis as input. Furthermore, the search was limited to M. hominis or E. coli sequences. By this search, two other gap genes in E. coli were encountered: gapB (epd) and gapC (EMBL accession numbers: X14436 and L09067), they are believed to encode proteins with functions di¡erent from GAPDH. No M. hominis proteins with signi¢cant homology were encountered. As the proteins encoded by gapB and gapC have sizes equal to or smaller than GAPDH, they are probably not the ones crossreacting in M. hominis. That the protein crossreacting is present in the Genpept database is far from certain, as only 38 di¡erent M. hominis protein sequences are in this database, which
is only a small proportion of the expected proteome. The M. hominis genome with its size of approximately 700 kbp probably has about 600 open reading frames. The 104-kDa protein crossreacting might be an immunoglobulin binding protein. In M. hominis, such a protein, which has a size of 105 kDa, has been identi¢ed. This immunoglobulin binding protein binds immunoglobulins from various organisms including rabbits [25]. Consequently, the immunoglobulin binding protein matches the size of the crossreacting protein in the present study. It remains to be determined whether the protein crossreacting is the immunoglobulin binding protein. Acknowledgements This work was supported by the Danish Health Research Council (Grants 12-0850-1 and 12-1620-1), Aarhus University Foundation, Novo Foundation and Fonden til L×gevidenskabens Fremme. We thank Karin S. SÖrensen and Inger Andersen for excellent technical assistance and Lisbet Wellejus Pedersen for linguistic assistance. References
Fig. 3. Whole cell proteins from 15 M. hominis strains separated by SDS-PAGE (10% gel) and immunostained with PAb GAPDH. The lane labelled GST-GAPDH contains puri¢ed fusion protein. The approximate band sizes calculated from a molecular mass marker (not shown) are indicated.
[1] International Committee on Systematic Bacteriology SotToM (1995) Revised minimum standards for description of new species of the class mollicutes (Division Tenericutes). Int. J. Syst. Bacteriol. 45, 605^612. [2] Fraser, C.M., Gocayne, J.D., White, O., Adams, M.D., Clayton, R.A., Fleischmann, R.D., Bult, C.J., Kerlavage, A.R., Sutton, G. and Kelley, J.M. et al. (1995) The minimal gene complement of Mycoplasma genitalium. Science 270, 397^403. [3] Grau, O., Laigret, F., Carle, P., Tully, J.G., Rose, D.L. and Bove, J.M. (1991) Identi¢cation of a plant-derived mollicute as a strain of an avian pathogen, Mycoplasma iowae, and its implications for mollicute taxonomy. Int. J. Syst. Bacteriol. 41, 473^478.
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21 [4] Christiansen, G. and Andersen, H. (1988) Heterogeneity among Mycoplasma hominis strains as detected by probes containing parts of ribosomal ribonucleic acid genes. Int. J. Syst. Bacteriol. 38, 108^115. [5] Alonso-Vega, C., Wauters, N., Vermeylen, D., Muller, M.F. and Serruys, E. (1997) A fatal case of Mycoplasma hominis meningoencephalitis in a full-term newborn. J. Clin. Microbiol. 35, 286^287. [6] Tully, J.G. (1993) Current status of the mollicute £ora of humans. Clin. Infect. Dis. 17 (Suppl. 1), S2^S9. [7] Hillier, S.L., Nugent, R.P., Eschenbach, D.A., Krohn, M.A., Gibbs, R.S., Martin, D.H., Cotch, M.F., Edelman, R., Pastorek, J.G. and Rao, A.V. (1995) Association between bacterial vaginosis and preterm delivery of a low-birth-weight infant. N. Engl. J. Med. 333, 1737^1742. [8] Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B.C. and Herrmann, R. (1996) Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24, 4420^ 4449. [9] Razin, S., Yogev, D. and Naot, Y. (1998) Molecular biology and pathogenicity of Mycoplasmas. Microbiol. Mol. Biol. Rev. 62, 1094^1156. [10] Nicol, C.S. and Edward, D. (1953) Role of organisms of the Pleuropneumoniae group in human genital infections. Vener. Dis. 29, 141^ 150. [11] Hollingdale, M.R. and Lemcke, R.M. (1969) The antigens of Mycoplasma hominis. J. Hyg. (Lond.) 67, 585^602. [12] Thomsen, A.C. (1978) Mycoplasmas in human pyelonephritis: demonstration of antibodies in serum and urine. J. Clin. Microbiol. 8, 197^202. [13] Lin, J.S. and Kass, E.H. (1974) Serological reactions of Mycoplasma hominis : di¡erences among mycoplasmacidal, metabolic inhibition, and growth agglutination tests. Infect. Immun. 10, 535^540. [14] Taylor-Robinson, D., Somersom, N.L., Turner, H.C. and Chanock, R.M. (1963) Serological relationships among human mycoplasmas as shown by complement ¢xation and gel di¡usion. J. Bacteriol. 85, 1261^1273.
21
[15] Olson, L.D., Renshaw, C.A., Shane, S.W. and Barile, M.F. (1991) Successive synovial Mycoplasma hominis isolates exhibit apparent antigenic variation. Infect. Immun. 59, 3327^3329. [16] McClenaghan, M., Herring, A.J. and Aitken, I.D. (1984) Comparison of Chlamydia psittaci isolates by DNA restriction endonuclease analysis. Infect. Immun. 45, 384^389. [17] Nyvold, C., Birkelund, S. and Christiansen, G. (1997) The Mycoplasma hominis P120 membrane protein contains a 216 amino acid hypervariable domain that is recognized by the human humoral immune response. Microbiology 143, 675^688. [18] Mygind, T., Birkelund, S. and Christiansen, G. (1998) DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among ¢ve Mycoplasma hominis isolates. Int. J. Syst. Bacteriol. 48 (3), 1067^1071. [19] Birkelund, S. and Andersen, H. (1988) Comparative studies of mycoplasma antigens and corresponding antibodies. In: Handbook of Immunoblotting of Proteins (Bjerrum, O.J. and Heegaard, N.H.H., Eds.), pp 25^33. CRC Press. [20] Ladefoged, S.A. and Christiansen, G. (1992) Physical and genetic mapping of the genomes of ¢ve Mycoplasma hominis strains by pulsed-¢eld gel electrophoresis. J. Bacteriol. 174, 2199^2207. [21] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY. [22] Tinoco, I., Uhlenbeck, O.C. and Levine, M.D. (1971) Estimation of secondary structure in ribonucleic acids. Nature 230, 362^367. [23] Muto, A. and Osawa, S. (1987) The guanine and cytosine content of genomic DNA and bacterial evolution. Proc. Natl. Acad. Sci. USA 84, 166^169. [24] Guttman, D.S. and Dykhuizen, D.E. (1994) Detecting selective sweeps in naturally occurring Escherichia coli. Genetics 138, 993^ 1003. [25] Alexander, A.G., Lowes, H.R. and Kenny, G.E. (1991) Identi¢cation of a mycoplasmal protein which binds immunoglobulin nonimmunologically. Infect. Immun. 59, 2147^2151.
FEMSLE 9196 18-1-00
www.fems-microbiology.org
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis Tina Mygind a
a;c
, Iben Zeuthen SÖgaard a;c , Renata Melkova b , Thomas Boesen a , Svend Birkelund a , Gunna Christiansen a; *
Department of Medical Microbiology and Immunology, The Bartholin Building, University of Aarhus, DK-8000 Aarhus C, Denmark b Institute of Preventive and Clinical Medicine, Limbova 14, 83301 Bratislava, Slovak Republic c Department of Molecular and Structural Biology, C.F. MÖllers Alle, Building 130, DK-8000 Aarhus C, Denmark Received 21 October 1999; received in revised form 25 November 1999; accepted 25 November 1999
Abstract The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21T . The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21T showed reaction to a 104-kDa band in addition to the expected 36-kDa band. The protein reacting at 104 kDa is a M. hominis protein with either an epitope similar to one on GAPDH, or it is an immunoglobulin binding protein. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Intraspecies variability; Glyceraldehyde 3-phosphate dehydrogenase ; Mycoplasma hominis
1. Introduction The mycoplasmas are distinct from other eubacteria in their lack of a cell wall, their tendency to form fried-egg colonies on solid medium and their often AT rich genome. Mycoplasmas are considered to be among the smallest prokaryotes because of their small cells with a diameter of approximately 300 nm [1] and their small genome sizes, which range from 580 kbp in Mycoplasma genitalium [2] to 1300 kbp in Mycoplasma iowae [3]. Mycoplasma hominis is considered to be a highly variable species [4]. It is part of the normal £ora of human genitals, but it has been associated with various infections, e.g. isolation of M. hominis from the brain tissue and cerebrospinal £uid of a full-term newborn with meningitis has been reported [5]. However, M. hominis is usually isolated from the lower genitals of both males and females,
* Corresponding author. Tel.: +45 (8942) 1749; Fax: +45 (8619) 6128; E-mail : [email protected]
where it often causes no infection [6]. Nonetheless, it has been found that women colonized with M. hominis who show signs of bacterial vaginosis have an increased risk of preterm delivery and low birth-weight infants [7]. So far, no speci¢c pathogenicity factors have been discovered for M. hominis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) reversibly catalyzes the oxidation and phosphorylation of D-glyceraldehyde 3-phosphate to 1,3-diphosphoglycerate, a reaction which is part of glycolysis. In the SwissProt Protein Database, there are approximately 168 entries for EC 1.2.1.12. Included are also GAPDH sequences from the two mycoplasmas Mycoplasma pneumoniae and M. genitalium [8,2]. The genome sequences of M. genitalium and M. pneumoniae revealed that they carry all enzymes participating in glycolysis, but the second pathway for metabolizing glucose, the pentose phosphate pathway, is incomplete [2,8,9]. The gap gene was cloned and sequenced in M. hominis PG21T . The intraspecies variability of the gap gene was investigated by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) and some
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 6 2 2 - 9
FEMSLE 9196 18-1-00
16
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
variation seemed to be present. A polyclonal antibody (PAb) was produced against part of GAPDH, and the PAb was tested against 15 M. hominis strains to observe whether the gene was expressed. 2. Materials and methods 2.1. M. hominis strains and cultivation The M. hominis strains selected for this study are shown in Table 1 [10^15]. The strains are isolated from a wide variety of geographical and di¡erent anatomical sites. The strains were cultivated in BEa medium [4] and genomic DNA was isolated as described by McClenaghan et al. [16]. 2.2. Cloning, sequencing and computer analysis Cloning was accomplished essentially as described by Nyvold et al. [17]. Sequencing was carried out as described by Mygind et al. [18] with the primers P33^P39 and P42^ P45 in Table 2. Computer analysis was carried out as described by Nyvold et al. [17] unless otherwise stated. The sequences were submitted to the EMBL database with the accession numbers: AJ243692^AJ243700. 2.3. PCR PCR was carried out on puri¢ed genomic DNA from the 15 M. hominis strains using the primers P33 and P36 (909-bp PCR product). PCR was performed as described by Mygind et al. [18], except that only 2.5 U AmpliTaq (R) DNA polymerase was used. PCR products for sequencing were puri¢ed as described by Mygind et al. [18]. The PCR products and the puri¢cations were analyzed in a 0.7% agarose gel. 2.4. Restriction enzyme cleavage For REA of the PCR products from the 15 M. hominis strains, the PCR products were cleaved with AluI (Roche, Mannheim, Germany), MboII (New England Biolabs, Herts, UK) and NlaIII (New England Biolabs) in accordance with the manufacturer's instructions. The restriction fragments were analyzed in 2% agarose gels.
pression vector. Furthermore, a stop codon was added just before the XhoI site in the 3P end. The restriction sites and the stop codon are indicated in the primers P40 and P41 in Table 2. High ¢delity PCR (Expand1 High Fidelity PCR System from Roche) was carried out in a total volume of 50 Wl with 0.75 Wl enzyme mix (3.5U103 U ml31 ), 0.2 mM of each of dATP, dTTP, dGTP and dCTP, 15 pmol of each primer, 5 Wl Expand HF bu¡er with 15 mM MgCl2 , 1.0 Wl puri¢ed genomic DNA and ddH2 0 up to 50 Wl. The following cycling conditions were used: denaturation at 92³C for 1 min, 30 cycles of 92³C for 1 min, 55³C for 30 s, 72³C for 3 min and at last elongation for 10 min at 72³C. The PCR product was analyzed in a 2% agarose gel. The high ¢delity PCR product was cloned into the pCR12.1 vector (TA-cloning kit, Invitrogen, Carlsbad, CA, USA) and then subcloned to the pGEX-4T-1 vector as described by Nyvold et al. [17]. The fusion protein was expressed and puri¢ed as described by Nyvold et al. [17]. The fusion protein is denoted GST-GAPDH. 2.6. Production of a PAb A New Zealand white rabbit was immunized intramuscularly with approximately 50 Wg fusion protein emulsi¢ed in Freunds incomplete adjuvant (Difco laboratories, Detroit, MI, USA) on days 1, 7 and 14. On day 21, a 10-ml blood sample was drawn and tested for presence of antibodies by immunoblotting. The rabbit was immunized intravenously on days 35 and 42 with 50 Wg fusion protein. On day 56, the rabbit was killed and bled. 2.7. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting M. hominis cultures were harvested in the late exponential growth phase and the pellets resuspended in SDS sample bu¡er (62.5 mM Tris^HCl pH 6.8, 10% (v/v) glycerol, 2.3% (w/v) SDS, 5% (v/v) L-mercaptoethanol and 0.05% (w/v) bromophenol blue), heated to 100³C for 5 min, separated by SDS-PAGE (4^20% gradient) and then electrotransferred to nitrocellulose membranes (Schleicher p Schu«ll, Dassel, Germany). Coomassie blue staining and immunoblottings were performed as described by Birkelund and Andersen [19].
2.5. Generation of fusion protein
2.8. Pulsed-¢eld gel electrophoresis and Southern hybridization
High ¢delity PCR was carried out on genomic DNA from the strain PG21T with the primers P40 and P41, which amplify bp 259^912 corresponding to amino acids (aa) 87^304. These primers were designed to have overhang ends which added a BamHI and a XhoI site to the 5P and 3P ends, respectively, of the PCR product and to produce an in-frame PCR product for expression in an ex-
The gap gene was mapped to existing genome maps of ¢ve M. hominis strains ; PG21T , 132, 4195, 93 and 7488. This was done by pulsed-¢eld gel electrophoresis and Southern hybridization as described by Ladefoged et al. [20]. The probe was ampli¢ed by PCR as described in Section 2.3 and it was labelled with [K-32 P]dATP by nick translation [21].
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
3. Results and discussion 3.1. Cloning, sequencing and mapping of the gap gene The gap gene was found on a 2-kbp BglII clone by unspeci¢c hybridization to a probe speci¢c for the p75 gene (Mygind, T., Birkelund, S. and Christiansen, G., unpublished). The gap gene is a 1005-bp (32% G+C) open reading frame translating into 335 aa, which gives a calculated molecular mass of 36.9 kDa. A putative Pribnow box, a putative Shine^Dalgarno sequence and a putative stem-loop transcriptional termination structure were found (vG = 33.95 kcal mol31 ) [22]. The gap/GAPDH sequences are shown in Fig. 1. The active site of GAPDH was identi¢ed using the program MOTIFS. The aa and DNA sequence by FASTA database search showed homology to the M. pneumoniae (63.9% aa identity, 62.5% DNA identity) and M. genitalium (60.4% aa identity, 65.0% DNA identity) sequences. No other mycoplasma gap genes have been sequenced. M. hominis has a gap G+C content of 32% compared to a genomic G+C content of 28%, but lower than the G+C content of gap from Escherichia coli which is 48%. As the G+C content of the M. hominis gap gene is not as low as the overall genomic G+C content, it probably re£ects that there are constraints on mutation of the gap gene in order to maintain the function of GAPDH. The low genomic G+C content and the fact that the G+C content in M. hominis gap is lower than in E. coli gap is a result of an AT pressure on the M. hominis genome, which causes the GC pairs to mutate into AT pairs [23]. By pulsed-¢eld gel electrophoresis and Southern hybridization, the gap gene was positioned on existing genome maps [20] of ¢ve M. hominis strains: PG21T , 132, 4195, 93
17
and 7488. In all these strains, the gap gene was found to be positioned between the unc gene and the ftsY gene. The gap gene was placed on the maps with resolutions between 35 kbp (strain 132) and 130 kbp (strain 93), which means that there are more genes to be identi¢ed on this fragment. 3.2. Intraspecies variability of gap investigated by PCR-RFLP Part of the gap gene was ampli¢ed by PCR with primers P33 and P36 (Table 2) on genomic DNA from the 15 M. hominis strains and cleaved with the restriction enzymes AluI, MboII and NlaIII to investigate the intraspecies variability. PCR products of the expected size of 909 bp were obtained for all 15 strains. The restriction enzyme cleavages are shown in Fig. 2A. It was possible to divide the strains into RFLP groups on the basis of their band patterns. The resulting RFLP groups are shown in Table 1. A varying number of groups appeared for the di¡erent enzymes. AluI displayed the highest number of groups: four, MboII displayed two groups and NlaIII displayed only one group. 3.3. Intraspecies variability of gap/GAPDH investigated by DNA sequencing By REA, some intraspecies variation seemed to be present in the gap gene. This was investigated further by DNA sequencing. Eight strains were chosen for sequencing of part of gap: 7488, 132, 5503, 1621, 1630, 2101, 2126 and 3105. From each of the strains, 811 bp of DNA sequence, which translated into 269 aa, was obtained. The DNA and protein sequences were compared using the program PILEUP and the following results were obtained. At
Table 1 M. hominis strains and RFLP groups Strain
Anatomical site of isolation
Reference
Geographical site of isolation
AluI RFLP group
MboII RFLP group
PG21T 7488
Lower genital tract Cervix
England Aarhus, Denmark
1 2
1 2
SC4 P2 183 10 DC63
Male urethra Upper urinary tract Vagina Vagina Oral cavity
[10] This laboratory [11] [12] [13] [13] [14]
England Aarhus, Denmark USA USA England
3 3 3 2 3
1 1 1 2 1
V2785 5503
Oral cavity Cervix
England Aarhus, Denmark
1 3
2 1
3105
Cervix
Aarhus, Denmark
4
1
132 1621 1630 2101 2126
Vagina Synovial Synovial Synovial Synovial
[14] This laboratory This laboratory [13] [15] [15] [15] [15]
USA USA USA USA USA
3 3 3 3 3
1 1 1 1 1
£uid, £uid, £uid, £uid,
knee knee knee knee
FEMSLE 9196 18-1-00
NlaIII RFLP group
All strains had identical cleavage patterns
18
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
Fig. 1. The DNA and protein sequence of the PG21T gap/GAPDH sequence. The putative Pribnow box and 335 region are indicated by underlining and boldface text. The putative Shine^Dalgarno sequence is indicated by SD. The active site is indicated by underlining of the protein sequence. Downstream the stop codon, the putative stem-loop structure is indicated.
the DNA level, there were 4.3 polymorphic sites per 100 bp, and at the protein level, there were 2.2 polymorphic sites per 100 aa. 20% of the nucleotide substitutions were non-synonymous. Fig. 2B shows the dendrogram output from PILEUP of the DNA sequences. The tree does not contain phylogenetic information, but it demonstrates the relatedness of the sequences by e.g. consideration of informative polymorphic sites. Here, it is seen that the isolates 1621, 1630, 2101 and 2126 have identical sequences, and interestingly, strain 132 has a sequence identical to the sequences of these four strains. The gap sequences of the strains 5503 and 3105 are not as closely related to any of the other sequences, but they are in the same cluster as 1621, 1630, 2101, 2126 and 132. The strains PG21T and 7488 are in a cluster di¡erent from the above-mentioned strains. The early branch formed by isolate 5503 suggests monophyly, therefore the AluI RFLP groups are in overall
agreement with the dendrogram (Fig. 2B). The MboII and NlaIII RFLP groups display less resolution of the isolates and are therefore less informative. The extent of variation in gap is larger than in one of the other hitherto investigated house-keeping genes in M. hominis, 16S rRNA [18]. This gene, which is involved in translation, a more fundamental process in the cell, has only two polymorphic sites of the 1612 bp sequenced (0.12 polymorphic sites per 100 bp). The intraspecies variation of gapA (encoding GAPDH) in E. coli has been studied [24]. When gapA sequences from 18 E. coli strains were compared, 1.3 polymorphic sites per 100 bp were found. Only two of the nucleotide substitutions were non-synonymous (16%). It is apparent that M. hominis allows a greater extent of variation in its gap gene than E. coli. It should be kept in mind though that Guttman and Dykhuizen [24] concluded that the ho-
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
19
Fig. 2. A: PCR products ampli¢ed with primers P33 and P36 cleaved with, AluI, MboII and NlaIII (2% agarose gels). B: The dendrogram output ¢le from a PILEUP multiple alignment of the gap DNA sequences. The strains 132, 1621, 1630, 2101 and 2126 are shown on a vertical line because they have identical DNA sequences.
mogeneity of the gap genes in E. coli strains was due to a selective sweep [24]. The intraspecies heterogeneity of the gap gene of M. hominis can probably not be interpreted as a result of an incomplete species designation, but may re£ect a higher degree of species variation within M. hominis. The fact that incomplete species designation is not the case is validated by the fact that 16S rDNA sequences in ¢ve di¡erent M. hominis strains were found to have maximally two nucleotide di¡erences by pair-wise sequence comparison [18]. 3.4. Expression of GAPDH in M. hominis A PAb was produced in order to verify that the gap
gene is expressed in M. hominis. A rabbit was immunized with the puri¢ed fusion protein GST-GAPDH (aa 87^ 304), and PAb GAPDH was produced. PAb GAPDH was tested against whole cell proteins from the 15 M. hominis strains. In Fig. 3, this immunoblotting is shown. The strain PG21T reacts only with a band of 36 kDa. This corresponds well with the molecular mass of 36.9 kDa calculated from the aa sequence. From this observation, it is clear that the gap gene is expressed in all the strains investigated. However, all strains but PG21T reacted with a band of 104 kDa in addition to the 36-kDa band, which is not readily explainable. PAb GAPDH must therefore react with an epitope on another protein. When the preserum of the immunized rabbit was probed
FEMSLE 9196 18-1-00
20
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21
Table 2 List of primers for sequencing and PCR Name
Position in gap or vector
Sequence 5P to 3P
P33 (R) P34 (F) P35 P36 (F) P37 (R) P38 (F) P39 (F) P40 (F)a P41 (R)a P42 (R) P43b P44b P45b
bp 907^935 bp 3766^(3737) bp 3395^(3373) bp 27^47 bp 289^317 bp 571^596 bp 874^907 bp 259^296 bp 880^912 bp 571^596 MCS pCR2.1 MCS pCR2.1 MCS pGEX-4T-1
CATGCATAAACTTTGTATAGTTTTTTGCC CATAATCCTTAGCCTTGCCTATTAATCTTA GCGGGAAAAAGACCAATTGAAAG CGGTTTTGGTGGAATTGGTCG CCTTCTTTTGTTACATATCTTCCAGTTCC GCTCCACACAAAGATTTAAGAAGAGC GACTCACTTTTAACAAGTGTGTTAGAAGTAGAAG GTGGATCCAAAGAACTAAACGTAGATTAGTTATTGAAGGAACTGG GTCTCGAGTCATTTGCCTTCTACTTCTAACACACTTGTTAAAAG GCTCTTCTTAAATCTTTGTGTGGAGC CCAAGCTTGGTACCGAGCTCG GTAATACGACTCACTATAGGGCGAATTGGG GGTGGTGGCGACC
The letters after the primer names indicate direction in the gene; F: forward, R: reverse. a These primers are designed for producing a PCR product with restriction enzyme sites (in bold) added at the ends. The stop codon is indicated by underlining. b The primer is located in the MCS of the pGEX-4T-1 vector.
against the 15 M. hominis strains, the 104-kDa band was not observed (results not shown), therefore the crossreaction should be toward a M. hominis protein possibly with an epitope similar to one on GAPDH. To ¢nd a possible M. hominis protein with homology to GAPDH, the Genpept database at NCBI (http://www.ncbi.nlm.nih.gov/) was searched. A search was performed with the advanced version of BLAST (http://www.ncbi.nlm.nih.gov/BLAST/), with the GAPDH sequence (aa 87^304) from M. hominis as input. Furthermore, the search was limited to M. hominis or E. coli sequences. By this search, two other gap genes in E. coli were encountered: gapB (epd) and gapC (EMBL accession numbers: X14436 and L09067), they are believed to encode proteins with functions di¡erent from GAPDH. No M. hominis proteins with signi¢cant homology were encountered. As the proteins encoded by gapB and gapC have sizes equal to or smaller than GAPDH, they are probably not the ones crossreacting in M. hominis. That the protein crossreacting is present in the Genpept database is far from certain, as only 38 di¡erent M. hominis protein sequences are in this database, which
is only a small proportion of the expected proteome. The M. hominis genome with its size of approximately 700 kbp probably has about 600 open reading frames. The 104-kDa protein crossreacting might be an immunoglobulin binding protein. In M. hominis, such a protein, which has a size of 105 kDa, has been identi¢ed. This immunoglobulin binding protein binds immunoglobulins from various organisms including rabbits [25]. Consequently, the immunoglobulin binding protein matches the size of the crossreacting protein in the present study. It remains to be determined whether the protein crossreacting is the immunoglobulin binding protein. Acknowledgements This work was supported by the Danish Health Research Council (Grants 12-0850-1 and 12-1620-1), Aarhus University Foundation, Novo Foundation and Fonden til L×gevidenskabens Fremme. We thank Karin S. SÖrensen and Inger Andersen for excellent technical assistance and Lisbet Wellejus Pedersen for linguistic assistance. References
Fig. 3. Whole cell proteins from 15 M. hominis strains separated by SDS-PAGE (10% gel) and immunostained with PAb GAPDH. The lane labelled GST-GAPDH contains puri¢ed fusion protein. The approximate band sizes calculated from a molecular mass marker (not shown) are indicated.
[1] International Committee on Systematic Bacteriology SotToM (1995) Revised minimum standards for description of new species of the class mollicutes (Division Tenericutes). Int. J. Syst. Bacteriol. 45, 605^612. [2] Fraser, C.M., Gocayne, J.D., White, O., Adams, M.D., Clayton, R.A., Fleischmann, R.D., Bult, C.J., Kerlavage, A.R., Sutton, G. and Kelley, J.M. et al. (1995) The minimal gene complement of Mycoplasma genitalium. Science 270, 397^403. [3] Grau, O., Laigret, F., Carle, P., Tully, J.G., Rose, D.L. and Bove, J.M. (1991) Identi¢cation of a plant-derived mollicute as a strain of an avian pathogen, Mycoplasma iowae, and its implications for mollicute taxonomy. Int. J. Syst. Bacteriol. 41, 473^478.
FEMSLE 9196 18-1-00
T. Mygind et al. / FEMS Microbiology Letters 183 (2000) 15^21 [4] Christiansen, G. and Andersen, H. (1988) Heterogeneity among Mycoplasma hominis strains as detected by probes containing parts of ribosomal ribonucleic acid genes. Int. J. Syst. Bacteriol. 38, 108^115. [5] Alonso-Vega, C., Wauters, N., Vermeylen, D., Muller, M.F. and Serruys, E. (1997) A fatal case of Mycoplasma hominis meningoencephalitis in a full-term newborn. J. Clin. Microbiol. 35, 286^287. [6] Tully, J.G. (1993) Current status of the mollicute £ora of humans. Clin. Infect. Dis. 17 (Suppl. 1), S2^S9. [7] Hillier, S.L., Nugent, R.P., Eschenbach, D.A., Krohn, M.A., Gibbs, R.S., Martin, D.H., Cotch, M.F., Edelman, R., Pastorek, J.G. and Rao, A.V. (1995) Association between bacterial vaginosis and preterm delivery of a low-birth-weight infant. N. Engl. J. Med. 333, 1737^1742. [8] Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B.C. and Herrmann, R. (1996) Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24, 4420^ 4449. [9] Razin, S., Yogev, D. and Naot, Y. (1998) Molecular biology and pathogenicity of Mycoplasmas. Microbiol. Mol. Biol. Rev. 62, 1094^1156. [10] Nicol, C.S. and Edward, D. (1953) Role of organisms of the Pleuropneumoniae group in human genital infections. Vener. Dis. 29, 141^ 150. [11] Hollingdale, M.R. and Lemcke, R.M. (1969) The antigens of Mycoplasma hominis. J. Hyg. (Lond.) 67, 585^602. [12] Thomsen, A.C. (1978) Mycoplasmas in human pyelonephritis: demonstration of antibodies in serum and urine. J. Clin. Microbiol. 8, 197^202. [13] Lin, J.S. and Kass, E.H. (1974) Serological reactions of Mycoplasma hominis : di¡erences among mycoplasmacidal, metabolic inhibition, and growth agglutination tests. Infect. Immun. 10, 535^540. [14] Taylor-Robinson, D., Somersom, N.L., Turner, H.C. and Chanock, R.M. (1963) Serological relationships among human mycoplasmas as shown by complement ¢xation and gel di¡usion. J. Bacteriol. 85, 1261^1273.
21
[15] Olson, L.D., Renshaw, C.A., Shane, S.W. and Barile, M.F. (1991) Successive synovial Mycoplasma hominis isolates exhibit apparent antigenic variation. Infect. Immun. 59, 3327^3329. [16] McClenaghan, M., Herring, A.J. and Aitken, I.D. (1984) Comparison of Chlamydia psittaci isolates by DNA restriction endonuclease analysis. Infect. Immun. 45, 384^389. [17] Nyvold, C., Birkelund, S. and Christiansen, G. (1997) The Mycoplasma hominis P120 membrane protein contains a 216 amino acid hypervariable domain that is recognized by the human humoral immune response. Microbiology 143, 675^688. [18] Mygind, T., Birkelund, S. and Christiansen, G. (1998) DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among ¢ve Mycoplasma hominis isolates. Int. J. Syst. Bacteriol. 48 (3), 1067^1071. [19] Birkelund, S. and Andersen, H. (1988) Comparative studies of mycoplasma antigens and corresponding antibodies. In: Handbook of Immunoblotting of Proteins (Bjerrum, O.J. and Heegaard, N.H.H., Eds.), pp 25^33. CRC Press. [20] Ladefoged, S.A. and Christiansen, G. (1992) Physical and genetic mapping of the genomes of ¢ve Mycoplasma hominis strains by pulsed-¢eld gel electrophoresis. J. Bacteriol. 174, 2199^2207. [21] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY. [22] Tinoco, I., Uhlenbeck, O.C. and Levine, M.D. (1971) Estimation of secondary structure in ribonucleic acids. Nature 230, 362^367. [23] Muto, A. and Osawa, S. (1987) The guanine and cytosine content of genomic DNA and bacterial evolution. Proc. Natl. Acad. Sci. USA 84, 166^169. [24] Guttman, D.S. and Dykhuizen, D.E. (1994) Detecting selective sweeps in naturally occurring Escherichia coli. Genetics 138, 993^ 1003. [25] Alexander, A.G., Lowes, H.R. and Kenny, G.E. (1991) Identi¢cation of a mycoplasmal protein which binds immunoglobulin nonimmunologically. Infect. Immun. 59, 2147^2151.
FEMSLE 9196 18-1-00