CO2 fixation for succinic acid production by engineered Escherichia coli co-expressing pyruvate carboxylase and nicotinic acid phosphoribosyltransferase

Biochemical Engineering Journal 79 (2013) 77–83

Contents lists available at ScienceDirect

Biochemical Engineering Journal journal homepage: www.elsevier.com/locate/bej

CO2 fixation for succinic acid production by engineered Escherichia coli co-expressing pyruvate carboxylase and nicotinic acid phosphoribosyltransferase Rongming Liu a , Liya Liang a , Mingke Wu a , Kequan Chen a , Min Jiang a,∗ , Jiangfeng Ma b,∗∗ , Ping Wei a , Pingkai Ouyang a a State Key Laboratory of Materials-Oriented Chemical Engineering, College of Biotechnology and Pharmaceutical Engineering, Nanjing University of Technology, Nanjing 211816, People’s Republic of China b Nanjing Research Institute of Sinopec Yangzi Petrochemical Company Limited, Nanjing 210048, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 7 May 2013 Received in revised form 9 June 2013 Accepted 8 July 2013 Available online 17 July 2013 Keywords: Anaerobic processes Fermentation Enzymes Glucose CO2 fixation Succinic acid

a b s t r a c t In wild-type Escherichia coli, 1 mol of CO2 was fixated in 1 mol of succinic acid generation anaerobically. The key reaction in this sequence, catalyzed by phosphoenolpyruvate carboxylase (PPC), is carboxylation of phosphoenolpyruvate to oxaloacetate. Although inactivation of pyruvate formate-lyase and lactate dehydrogenase is found to enhance the PPC pathway for succinic acid production, it results in excessive pyruvic acid accumulation and limits regeneration of NAD+ from NADH formed in glycolysis. In other organisms, oxaloacetate is synthesized by carboxylation of pyruvic acid by pyruvate carboxylase (PYC) during glucose metabolism, and in E. coli, nicotinic acid phosphoribosyltransferase (NAPRTase) is a ratelimiting enzyme of the NAD(H) synthesis system. To achieve the NADH/NAD+ ratio decrease as well as carbon flux redistribution, co-expression of NAPRTase and PYC in a pflB, ldhA, and ppc deletion strain resulted in a significant increase in cell mass and succinic acid production under anaerobic conditions. After 72 h, 14.5 g L−1 of glucose was consumed to generate 12.08 g L−1 of succinic acid. Furthermore, under optimized condition of CO2 supply, the succinic acid productivity and the CO2 fixation rate reached 223.88 mg L−1 h−1 and 83.48 mg L−1 h−1 , respectively. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Succinic acid is a common natural organic acid often found in humans, animals, plants, and microorganisms, and plays an important role in biological metabolism [1]. Recent studies have shown that succinic acid can also be used as a C4 platform chemical for the synthesis of 1,4-butanediol, tetrahydrofuran, ␥-butyrolacetone, and other bulk chemicals [2,3]. Because of the depletion of fossil fuel resources and strong demand for environmental-friendly energy, the biological production of succinic acid has attracted great interest. A wide variety of strains have been used for succinic acid production, and the most studied strains are Mannheimia succiniciproducens [4,5], Actinobacillus succinogenes [6], Anaerobiospirillum succiniciproducens [7], and Escherichia coli [8,9]. In mixed-acid fermentation of glucose by E. coli, succinic acid is formed via the reductive arm of the tricarboxylic acid cycle, a

∗ Corresponding author. Tel.: +86 25 58139927; fax: +86 25 58139927. ∗∗ Corresponding author. Tel.: +86 25 57782065; fax: +86 25 57782065. E-mail addresses: [email protected], [email protected] (M. Jiang), [email protected] (J. Ma). 1369-703X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bej.2013.07.004

pathway which includes the fixation of 1 mol of CO2 per mol of succinic acid generated [10]. The key reaction in this sequence is the carboxylation of three-carbon intermediates such as phosphoenolpyruvate (PEP) to four-carbon oxaloacetate (OAA). The principal PEP-carboxylating enzyme found in E. coli is phosphoenolpyruvate carboxylase (PPC), and the CO2 levels could regulate the PPC pathway used for succinic acid production [11,12]. In E. coli, the use of HCO3 − , such as MgCO3 and NaHCO3 , could improve the activity of PPC from 0.20 to 1.13 U mg−1 protein to further increase succinic acid production [13]. However, PEP in E. coli may also be converted to pyruvate, which leads to the formation of lactic acid, formic acid, acetic acid, and ethanol during anaerobic growth [14]. In other prokaryotes and many eukaryotes, during glucose metabolism, OAA is synthesized by carboxylation of pyruvate by pyruvate carboxylase (PYC) (EC 6.4.1.1), another enzyme which can fix CO2 besides PPC [15,16]. In wild-type E. coli W1485, succinic acid is not the dominant fermentation product of glucose under anaerobic conditions. Therefore, in a previous study, to enhance the PPC pathway for succinic acid production, pyruvate formate-lyase (PFL) and lactate dehydrogenase (LDH), encoded by pflB and ldhA genes, were inactivated [9]. However, the resultant E. coli NZN111, the ldhA and

78

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

Fig. 1. Pathways of anaerobic mixed acid fermentation for Escherichia coli BA207. Note: the rectangular squares are the inactivated enzymes and the dotted line is the new introduced pathway.

pflB deletion strain, could not utilize glucose anaerobically because NAD+ regeneration was blocked by the disruption of PFL and LDH [14]. It has been reported that the pncB gene encodes nicotinic acid phosphoribosyltransferase (NAPRTase) (EC 2.4.2.11), a ratelimiting enzyme of the NAD(H) synthesis system [17]. Through overexpression of the pncB gene in NZN111, the NAD(H) pool size was enhanced and the ratio of NADH/NAD+ decreased from 0.64 to 0.13, which resulted in a substantial increase in cell mass and succinic acid production [18]. However, the strain still produced high levels of pyruvic acid because the phosphoenolpyruvate transport system (PTS) was found to consume 50% of the available PEP when glucose was used as the carbon source [19]. In the present study, we investigated whether cell growth and glucose utilization were restored in E. coli BA207, a pflB, ldhA, and ppc deletion strain co-expressing NAPRTase and PYC, under anaerobic conditions. Furthermore, the effects of PPC and PYC on CO2 fixation for succinic acid production in different engineered E. coli strains under various environmental conditions were compared. Fig. 1 shows the anaerobic glucose metabolism in BA207 for maximal succinic acid production.

2. Materials and methods 2.1. Strains and plasmids The E. coli strains BA002 (pflB, ldhA) and BA203 (pflB, ldhA, ppc) were obtained from our laboratory [20]. The pncB gene encoding NAPRTase was amplified from E. coli K12 genomic

DNA. The pyc gene encoding PYC was amplified from the genomic DNA of Lactococcus lactis subsp. cremoris NZ9000. The plasmid pTrc99a [21] was provided by Prof. Shao of Nanjing Normal University. All strains were stored in 20% (w/v) glycerol at −80 ◦ C (Table 1). 2.2. Media Luria-Bertani (LB) medium contained the following (L−1 ): 10 g of tryptone (Oxoid, UK), 5 g of yeast extract (Oxoid, UK), and 5 g of NaCl. Ampicillin (100 mg mL−1 ) was added when needed. 2.3. Cloning and co-expression of the genes encoding NAPRTase and PYC The plasmid pTrc99a-pncB was previously constructed in our laboratory [18]. The plasmid pTrc99a-pyc was constructed by digesting the purified DNA with NcoI and PstI, and ligating it into pTrc99a digested with the same enzymes. The pyc gene was amplified with primers pyc-1 and pyc-2 (Table 1) using L. lactis subsp. cremoris NZ9000 genomic DNA as the template, which encodes PYC that converts pyruvic acid to OAA. The plasmid pTrc99a-pncBpyc was constructed by digesting the purified DNA with NcoI and ligating it into pTrc99a-pyc digested with the same enzyme. These plasmids were then transformed into engineered E. coli to generate the strains presented in Table 1. The strains were grown in a 500-mL flask containing 100 mL of LB medium at 37 ◦ C and 200 rpm until an optical density of 0.6 measured at 600 nm (OD600 ; dry cell weight (DCW) = 0.24 g L−1 ) was reached. The strains with single expression or co-expression

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

79

Table 1 Bacterial strains, plasmids, and primers used in this study. Strains

Relevant description

Source/restriction site

E. coli K12 BA002 BA014 BA203 BA206 BA207 NZ9000 Plasmids pTrc99a pTrc-pncB pTrc-pyc pTrc-pncB-pyc

Wild type, F+ rpoS (AM) rph-l, providing pncB gene E. coli K12, pflB, ldhA E. coli K12, pflB, ldhA, pTrc-pncB E. coli K12, pflB, ldhA, ppc E. coli K12, pflB, ldhA, ppc, pTrc-pyc E. coli K12, pflB, ldhA, ppc, pTrc-pncB-pyc Lactococcus lactis subsp. cremoris NZ9000, providing pyc gene

CGSC 4401 [20] This study [20] This study This study CICIM B1366

Expression vector with Trc promoter pncB gene cloned from E.coli K12 under the Trc promoter of pTrc99a pyc gene cloned from Lactococcus lactis subsp. cremoris NZ9000 under the Trc promoter of pTrc99a pncB gene cloned from E. coli K12 under the Trc promoter of pTrc99a-pyc

This study [18] This study This study

Primers pyc expression pyc-1 pyc-2

CATGCCATGGTCAGCTGATGAGAAACGTCGAGAAG AAAACTGCAGAGGTCATCTCTTCAAAGCCAAAACG

NcoI Pst I

pncB and pyc co-expression pncB-pyc-1 pncB-pyc-1

CATGCCATGGGAAAGGTGGCATATGGTGTGATCGG CATGCCATGG CGGCTACAGGCACAACGCTCATAAT

NcoI NcoI

of NAPRTase and PYC were induced with 0.5 mM isopropyl-␤-dthiogalactoside (IPTG) and cultivated at 30 ◦ C and 170 rpm for 8 h. Nicotinic acid (NA, 0.5 mM) was added when the pncB gene was overexpressed. The concentrations of IPTG and NA had been previously determined to be optimal.

2.4. Exclusively anaerobic fermentations A 1-mL seed inoculum from an overnight 5-mL LB culture was added to a 500-mL flask containing 50 mL of LB medium for aerobic growth at 37 ◦ C and 200 rpm. After 8 h, 3 mL of the aerobic culture was used as inoculum for anaerobic fermentation. The anaerobic cultures were incubated at 30 ◦ C and 170 rpm for 72 h in 100-mL sealed bottles containing 30 mL of LB medium supplemented with 20 g L−1 of glucose. MgCO3 (16 g L−1 ) was added to maintain the pH above 6.8, and 0.5 mM IPTG was added to induce overexpression of pncB and pyc genes. The headspace in the sealed bottles was filled via a gassing manifold with oxygen-free CO2 for at least 2 min. Anaerobic fermentation was carried out in a 3-L bioreactor (Bioflo 110, USA) containing 1.5 L of LB medium. During anaerobic fermentations, a seed inoculum of 1 mL from an overnight 5-mL LB culture was added to a 1000-mL flask containing 150 mL of LB medium for aerobic culture at 37 ◦ C and 200 rpm. After incubating for 8 h, a 10% inoculum was used to start the anaerobic culture. The anaerobic cultures were supplemented with 20 g L−1 of total glucose, 16 g L−1 of MgCO3 , 0.5 mM IPTG, and 0.5 mM NA. The anaerobic conditions were established by sparging the culture with CO2 at a flow rate of 0.2 L min−1 . The pH was maintained at about 6.8, and temperature and agitation were maintained at 30 ◦ C and 170 rpm, respectively.

2.5. Analytical methods OD600 was used to monitor cell growth and was correlated with the DCW as follows: DCW (g L−1 ) = 0.4 × OD600 . The concentration of glucose was assayed with an enzyme electrode analyzer (Institute of Microbiology, Shandong, China), the organic acids were quantified using high-performance liquid chromatography (HPLC), and the data were analyzed with a Chromeleon data system (Dionex Corporation, USA). The mobile phase was a solution of KH2 PO4 (25 mM, pH 2.5) at a flow rate of 1.0 mL min−1 .

2.6. Enzyme assays The intracellular concentrations of NADH and NAD+ were assayed using a cycling method [22]. To determine the enzyme activities, the cells were harvested by centrifugation at 10,000 × g for 10 min at 4 ◦ C, and washed with the buffer used in the subsequent enzyme assays. The suspended cells were disrupted by sonication on ice at 100 W for 3 min with 3-s intervals. The cell debris was removed by centrifugation at 20,000 × g for 15 min at 4 ◦ C. The supernatant was used to assay the enzyme activity. Protein concentrations were determined using the Bradford method [23]. The activities of NAPRTase [24], PYC [25], and PPC [9] were measured by spectrophotometrically monitoring the disappearance or formation of NADH, for which the wavelength and millimolar extinction coefficients were 340 nm and 6.22 cm−1 mM−1 , respectively. One unit of specific enzyme activity was defined as the amount of enzyme needed to oxidize 1 ␮mol of NADH per minute per milligram of protein. 2.7. Calculation process of CO2 fixation In BA002 and BA014, the reaction of CO2 fixation is catalyzed by PPC and OAA is synthesized by carboxylation of PEP [13]. 1 mol PEP + 1 mol CO2 → 1 mol OAA In BA206 and BA207, the reaction of CO2 fixation is catalyzed by PYC and OAA is synthesized by carboxylation of pyruvate [16]. 1 mol Pyruvate + 1 mol CO2 → 1 mol OAA Then, OAA was transformed to malic acid, fumaric acid, and succinic acid [13]. However, there were no accumulation of malic acid and fumaric acid in the engineered E. coli of this paper. Theoretically, succinic acid can be formed homofermentatively from glucose [12]. 1 mol Glucose + 2 mol CO2 → 2 mol succinic acid Thus, as 1 mol CO2 is theoretically required for the synthesis of 1 mol succinic acid [10], the CO2 fixation rate of engineered E. coli was evaluated based on the following equation: VCO2 =

VSA × MCO2 MSA

where VCO2 is the CO2 fixation rate, VSA is the productivity of succinic acid, MCO2 is the molecular weight of CO2 , and MSA is the molecular weight of succinic acid.

80

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

Table 2 The concentrations of NADH, NAD+ , and NAD(H) and the specific enzyme activities of PYC and NAPRTase in the control strain and in the recombinant strains. Strains BA002 BA014 BA203 BA206 BA207

PYC activity (U mg−1 )a

NAPRTase activity (U mg−1 )a

b

ND ND ND 0.89 ± 0.01 1.03 ± 0.02

1.97 18.45 1.88 2.01 18.84

± ± ± ± ±

NADH (␮mol g−1 )a

0.01 0.02 0.01 0.02 0.02

2.26 3.51 2.01 2.51 2.21

± ± ± ± ±

0.01 0.02 0.01 0.01 0.03

NAD+ (␮mol g−1 )a 8.72 16.91 7.76 9.57 19.02

± ± ± ± ±

NAD(H) (␮mol g−1 )a

0.02 0.04 0.02 0.02 0.05

10.98 20.42 9.77 12.08 21.23

± ± ± ± ±

0.03 0.03 0.03 0.02 0.04

ND: not detected. a Each value is the mean of three parallel replicates ± standard deviation. Table 3 Results of exclusively anaerobic fermentations of the strains after 72 h in LB media. Strains

DCW (g L−1 )a

BA002 BA014 BA206 BA207

0.52 1.73 0.91 2.07

Glucose consumed (g L−1 )a

Fermentation products (g L−1 )a Succinic acid

± ± ± ±

0.51 0.53 0.46 0.52

3.3 9.2 4.5 14.5

± ± ± ±

0.4 0.5 0.4 0.6

1.57 5.45 3.67 12.08

± ± ± ±

0.12 0.23 0.16 0.45

Pyruvic acid

Acetic acid

Malic acid

Fumaric acid

± ± ± ±

ND ND ND 1.37 ± 0.34

ND ND ND ND

ND ND ND ND

1.90 4.71 0.28 0.11

0.11 0.18 0.12 0.23

ND: not detected. a Each value is the mean of three parallel replicates ± standard deviation. Table 4 Effects of PPC and PYC on CO2 fixation for succinic acid production. Strains

PYC activity (U mg−1 )a

PPC activity (U mg−1 )a

CO2 fixation rate (mg L−1 h−1 )a

BA002 BA014 BA206 BA207

ND ND 0.87 ± 0.01 1.71 ± 0.02

0.13 ± 0.01 0.22 ± 0.01 ND ND

8.13 28.23 19.01 62.56

± ± ± ±

Succinic acid productivity (mg L−1 h−1 )a

0.61 1.32 1.02 2.55

21.81 75.69 50.97 167.78

± ± ± ±

1.51 2.02 2.52 3.84

Succinic acid yield (g g−1 )a 0.48 0.59 0.82 0.83

± ± ± ±

0.01 0.02 0.02 0.02

ND: not detected. a Each value is the mean of three parallel replicates ± standard deviation.

3. Results and discussion

3.2. Exclusively anaerobic fermentation with different strains in sealed bottles

3.1. Cloning and co-expression of the genes encoding NAPRTase and PYC The PCR product and pTrc99a were respectively digested with endonuclease, as shown in Table 1. Subsequently, they were ligated by T4 DNA ligase to construct the recombinant strains. The recombinant plasmids were identified by single and double endonuclease digestion. The sequences of the cloned genes were analyzed at Invitrogen Co., Shanghai, China, and the results indicated that these sequences are consistent with the reported data. The specific activities of PYC in BA206 and BA207 were 0.89 and 1.03 U mg−1 , respectively. The results showed that the pyc gene from L. lactis subsp. cremoris NZ9000 was significantly expressed. Furthermore, the specific activity of NAPRTase in BA014 (18.45 U mg−1 ) and BA207 (18.84 U mg−1 ) were obviously higher than those in BA002 (1.97 U mg−1 ) and BA203 cells (1.88 U mg−1 ) (Table 2). In addition, the total amount of NAD(H) in BA014 (20.42 ␮mol g−1 ) and BA207 (21.23 ␮mol g−1 ) was also higher than that in BA002 (10.98 ␮mol g−1 ) and BA203 (9.77 ␮mol g−1 ) (Table 2). These results demonstrated that both PYC and NAPRTase could be efficiently expressed in the engineered E. coli strains.

Destruction of PFL and LDH caused the wild-type E. coli lose its ability to grow in nutrient-rich or minimal media under anaerobic conditions [26,27]. These mutations resulted in accumulation of high levels of pyruvic acid and limited the ways of regeneration of NAD+ from NADH formed in glycolysis [14]. Under exclusively anaerobic fermentation conditions, only 3.3 g L−1 of glucose was metabolized in BA002 producing 1.57 g L−1 of succinic acid and 1.90 g L−1 of pyruvic acid (Table 3). To decrease the ratio of NADH/NAD+ , the pncB gene was overexpressed in BA002, which resulted in a significant increase in cell mass and succinic acid production during anaerobic fermentation. The concentration of succinic acid in the resultant BA014 (5.45 g L−1 ) was 2.47-fold higher than that noted in BA002. However, there was still accumulation of 4.71 g L−1 of pyruvic acid. With the expression of the pyc gene in the ppc deletion strain, the amount of pyruvic acid in BA206 decreased to 0.28 g L−1 and the concentration of succinic acid increased to 3.67 g L−1 . However, the succinic acid productivity was lower than that in BA014. These results demonstrated that the expression of single gene could not solve the problem in BA002. With the co-expression of NAPRTase and PYC, BA207 could achieve both decrease in NADH/NAD+ ratio as well as carbon

Table 5 Specific activities of NAPRTase in crude extracts of the strains and determination of the amount of NADH, NAD+ , and NAD(H). Strains

NAPRTase activity (U mg−1 )a

BA002 BA014 BA206 BA207

0.70 10.54 1.01 12.24

a

± ± ± ±

0.01 0.03 0.02 0.04

NADH (␮mol g−1 )a 1.41 1.95 1.46 1.47

± ± ± ±

0.02 0.03 0.02 0.04

Each value is the mean of three parallel replicates ± standard deviation.

NAD+ (␮mol g−1 )a 2.34 13.61 2.81 24.50

± ± ± ±

0.01 0.02 0.02 0.04

NAD(H) (␮mol g−1 )a 3.75 15.61 4.27 25.97

± ± ± ±

0.01 0.02 0.02 0.04

NADH/NAD+ 0.60 0.14 0.54 0.06

± ± ± ±

0.01 0.02 0.02 0.01

a

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

2.51 62.21 166.91 0.83 10.51 0.05 36.96 0.18 1.72 12.25 24.50 1.47 25.97 0.06 2.52 63.51 170.31 0.81 12.04 0.06 42.73 0.20 1.71 12.24 24.67 1.48 26.15 0.06 0.02 0.53 1.54 0.01 0.34 0.01 1.52 0.03 0.02 0.04 0.04 0.04 0.04 0.01 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 2.17 60.99 163.58 0.80 12.29 0.06 43.67 0.21 1.73 12.11 24.33 1.46 25.79 0.06 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 2.03 48.36 129.69 0.73 11.40 0.06 50.75 0.29 1.46 10.39 17.63 1.41 19.04 0.08

0.20

0.02 0.63 1.14 0.02 0.51 0.01 1.52 0.01 0.03 0.03 0.04 0.04 0.04 0.01 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 2.17 52.78 141.57 0.78 10.76 0.06 41.74 0.23 1.59 10.43 18.63 1.49 20.12 0.08

0.15 0.10 0.10

1.79 23.25 62.33 0.62 7.22 0.07 31.67 0.32 0.95 6.34 11.70 1.17 12.87 0.10 Each value is the mean of three parallel replicates ± standard deviation. a

1.82 24.18 64.82 0.63 7.20 0.07 31.57 0.31 0.97 6.33 11.18 1.23 12.41 0.11 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 0.54 1.21 0.02 0.24 0.02 1.33 0.01 0.01 0.03 0.04 0.04 0.04 0.01

0.15

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.01 0.64 1.33 0.01 0.33 0.01 1.23 0.01 0.01 0.03 0.04 0.04 0.04 0.01

0.20

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.02 0.51 1.23 0.01 0.43 0.02 1.34 0.02 0.01 0.03 0.04 0.04 0.04 0.01

1.54 40.24 107.89 0.65 11.80 0.07 48.00 0.29 1.49 7.14 11.50 1.38 12.88 0.12

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.03 0.52 1.34 0.01 0.54 0.02 1.57 0.01 0.03 0.03 0.04 0.04 0.04 0.01

NaHCO3 (mol L−1 ) CaCO3 (mol L−1 )

2.06 26.43 70.87 0.65 7.63 0.07 31.64 0.29 0.99 6.54 11.42 1.37 12.79 0.12 DCW (g L−1 )a CO2 fixation rate (mg L−1 h−1 )a Succinic acid productivity (mg L−1 h−1 )a Succinic acid yield (g g−1 )a Pyruvic acid productivity (mg L−1 h−1 )a Pyruvic acid yield (g g−1 )a Acetic acid productivity (mg L−1 h−1 )a Acetic acid yield (g g−1 )a PYC activity (U mg−1 )a NAPRTase activity (U mg−1 )a NAD+ (␮mol g−1 )a NADH (␮mol g−1 )a NAD(H) (␮mol g−1 )a NADH/NAD+ a

The CO2 levels could regulate the PPC pathway used for succinic acid production [11,12]. In E. coli, the use of HCO3 − , such as MgCO3 and NaHCO3 , could increase the activity of PPC to further increase succinic acid production [13]. To investigate the effect of CO2 levels on CO2 fixation and succinic acid production by the exogenous PYC pathway, fermentations were carried out with supplementation of

Carbonate

3.4. Effects of supplementation of different carbonates on CO2 fixation and succinic acid production

Table 6 Effects of different carbonate supplement on CO2 fixation by BA207 for succinic acid production.

It has been reported that the dissolved CO2 in the broth is directly related to the supply of intracellular CO2 present as HCO3 − , CO3 2− , and CO2 [28]. As 1 mol CO2 is theoretically required for the synthesis of 1 mol succinic acid, the CO2 fixation rate in BA002 was only 8.13 mg L−1 h−1 after 72 h of anaerobic fermentation (Table 5). With the overexpression of the pncB gene in BA014, the PPC activity was enhanced by the restored cell growth and glucose consumption. The CO2 fixation rate was increased to 28.23 mg L−1 h−1 due to the restored glucose utilization, and the yield of succinic acid was 0.59 g g−1 . As a result of the expression of the pyc gene, the available pyruvic acid was released, and the CO2 fixation rate in BA206 was 19.01 mg L−1 h−1 , which was higher than that observed in BA002. However, the glucose consumption rate and cell growth rate were still low. Furthermore, with the co-expression of NAPRTase and PYC in BA207, the NAD(H) pool size and glucose consumption rate were further increased. As a result, the highest CO2 fixation rate was achieved in BA207 and the yield of succinic acid was increased to 0.83 g g−1 , which was higher than that in BA014 (0.59 g g−1 ). Based on the above-mentioned data, it can be concluded that the amount of CO2 fixation for succinic acid production in BA207 was 6.69-fold higher than that observed in BA002. With gene modification, two pathways of CO2 fixation were noted in engineered E. coli. The key reactions of carboxylation were found to be catalyzed by PPC and PYC. In the PPC pathway, PEP was observed to be an important metabolic node [9]. However, 50% of the available PEP was consumed for glucose transport by PTS regulation and the highest yield of succinic acid in these strains were 1 mol mol−1 in nutrient-rich or minimal media under anaerobic conditions [14]. In the PYC pathway, the available pyruvic acid was released by the expression of the pyc gene in a ppc gene deletion strain and the highest yield of succinic acid was increased to 2 mol mol−1 [16]. This suggests that the PYC pathway has a higher CO2 fixation ability than the PPC pathway under PTS regulation. Furthermore, with the co-expression of NAPRTase and PYC in BA207, succinic acid productivity and CO2 fixation rate were further improved, which were 1.22-fold higher than those observed in BA014. In other words, the CO2 fixation ability could be enhanced by increasing the NAD(H) pool size.

0.02 0.54 1.52 0.01 0.52 0.01 1.33 0.02 0.03 0.03 0.04 0.04 0.04 0.01

3.3. Effects of PPC and PYC on CO2 fixation for succinic acid production

0.10

MgCO3 (mol L−1 )

0.15

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.03 0.54 1.44 0.02 0.63 0.02 1.42 0.01 0.02 0.04 0.04 0.04 0.04 0.01

0.20

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 0.44 1.57 0.01 0.45 0.02 1.34 0.02 0.02 0.04 0.04 0.04 0.04 0.01

flux redistribution. As a result, this strain could regain the ability of cell growth and high yield of succinic acid under anaerobic conditions. After 72 h, 14.5 g L−1 of glucose was consumed to generate 12.08 g L−1 of succinic acid, which was 1.22-fold higher than that observed in BA014. The specific activity of the anaplerotic enzyme PYC in BA206 and BA207 increased substantially to 0.87 and 1.71 U mg−1 , respectively (Table 4), which was the main reason for the decrease in accumulation of pyruvic acid in these two strains. The specific activities of NAPRTase in BA014 or BA207 cells were obviously higher than those in BA002 cells (Table 5). Meanwhile, the amount of NAD+ in BA014 and BA207 increased 4.82and 9.47-fold, respectively, when compared with that in BA002. The ratio of NADH/NAD+ decreased from 0.60 in BA002 to 0.14 in BA014 and to 0.06 in BA207 (Table 4).

81

82

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

Table 7 Effects of different CO2 partial pressures on CO2 fixation by BA207 for succinic acid production. CO2 partial pressures (Ma)

0.00

DCW (g L−1 )a CO2 fixation rate (mg L−1 h−1 )a Succinic acid productivity (mg L−1 h−1 )a Succinic acid yield (g g−1 )a Pyruvic acid productivity (mg L−1 h−1 )a Pyruvic acid yield (g g−1 )a Acetic acid productivity (mg L−1 h−1 )a Acetic acid yield (g g−1 )a PYC activity (U mg−1 )a NAPRTase activity (U mg−1 )a NAD+ (␮mol g−1 )a NADH (␮mol g−1 )a NAD(H) (␮mol g−1 )a NADH/NAD+ a

0.42 20.76 55.67 0.70 5.16 0.06 21.47 0.27 0.97 5.57 15.67 1.41 17.08 0.09

a

0.025 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.01 1.21 1.64 0.09 0.41 0.01 1.31 0.01 0.21 0.64 0.04 0.04 0.04 0.01

0.71 42.21 113.20 0.80 5.61 0.04 33.80 0.24 1.15 6.57 18.88 1.51 20.39 0.08

0.05 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 1.27 1.64 0.14 0.55 0.01 1.22 0.02 0.31 0.64 0.04 0.04 0.04 0.01

0.94 58.27 156.26 0.84 6.45 0.03 40.87 0.22 1.23 8.82 20.13 1.61 21.74 0.08

0.075 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.03 1.24 1.34 0.11 0.43 0.01 1.31 0.01 0.22 0.55 0.04 0.04 0.04 0.01

1.35 69.29 185.82 0.87 6.17 0.03 40.27 0.19 1.51 11.21 23.71 1.66 25.37 0.07

0.10 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 1.33 1.23 0.12 0.32 0.01 1.22 0.02 0.13 0.64 0.04 0.04 0.04 0.01

1.72 83.48 223.88 0.96 3.71 0.02 36.17 0.16 1.82 13.01 32.11 1.84 33.95 0.06

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 1.33 1.44 0.12 0.23 0.01 1.12 0.01 0.11 0.66 0.04 0.04 0.04 0.01

Each value is the mean of three parallel replicates ± standard deviation.

CaCO3 , NaHCO3 , and MgCO3 in the medium. In three carbonates, the solubility of NaHCO3 in pure water reaches 1.5 mol L−1 (39 ◦ C) which was higher than that in other carbonates [29]. Furthermore, although CaCO3 is a slightly soluble compound, its solubility is only 0.0053 mol L−1 at 39 ◦ C, while the maximum solubility of MgCO3 in water at 40 ◦ C is reported to be 139 mM [30,31]. As shown in Table 6, when the concentration of CaCO3 was increased from 0.10 to 0.20 mol L−1 , no significant effects on CO2 fixation and succinic acid production were observed. In contrast, when NaHCO3 was supplemented, CO2 fixation and succinic acid production improved. When 0.15 mol L−1 of NaHCO3 was supplemented, the CO2 fixation rate and succinic acid productivity were 1.18-fold higher than those observed in fermentation supplemented with 0.15 mol L−1 of CaCO3 . However, although the high solubility of NaHCO3 resulted in an increased level of dissolved CO2 in the medium, the CO2 fixation ability was not improved. Moreover, although supplementation of different concentrations of MgCO3 had little influence on the CO2 fixation rate and yield of succinic acid, the CO2 fixation rate was still 20% higher than that noted in fermentation supplemented with 0.15 mol L−1 of NaHCO3 . In addition, the formation of byproducts was also investigated with supplementation of different carbonates. The concentrations of pyruvic acid and acetic acid with supplementation of MgCO3 were higher than those with supplementation of other carbonates. However, the glucose consumption rate and the yield of succinic acid were the highest. Meanwhile, the yields of pyruvic acid and acetic acid were lower than those with supplementation of other carbonates. It means that the strain could distribute the more metabolic flux to succinic acid and decrease the pyruvic acid and acetic acid generation with supplementation of MgCO3 . Previous studies have demonstrated the effects of sodium ions on succinic acid production [32], and it has been reported that the presence of high level of sodium ions may have an impact on cell osmolarity [33]. Thus, the indistinct influence of NaHCO3 supplementation on succinic acid production, when compared with the increased level of dissolved CO2 , might be due to the high

content of sodium ions in the medium. Meanwhile, enzyme activity assay revealed that supplementation of CaCO3 , NaHCO3 , and MgCO3 elicited different PYC and NAPRTase activities. The highest PYC activity was reached in the fermentation supplemented with MgCO3 . Moreover, the highest NAD(H) concentration was also achieved due to the highest NAPRTase activity, and the lowest ratio of NADH/NAD+ was obtained in the fermentation with MgCO3 .

3.5. Exclusively anaerobic fermentation by BA207 at different CO2 partial pressures Different gas partial pressures dissolve different gases. Therefore, the effects of different CO2 partial pressures ranging from 0.00 to 0.10 MPa (CO2 and N2 are mixed in proportion) on CO2 fixation and succinic acid production were investigated (Table 7). As shown in Table 7, when CO2 gas was not supplied to the medium, succinic acid production was obviously inhibited. By increasing the partial pressure of CO2 , the CO2 fixation rate was increased. Furthermore, the yield of succinic acid also increased, indicating an increase in the succinic acid metabolic pathway flux and decrease in the byproduct (pyruvic acid and acetic acid) flux. When the CO2 partial pressure reached 0.10 MPa, the CO2 fixation rate and succinic acid productivity were 98% higher than those observed when the CO2 partial pressure was 0.025 MPa. Meanwhile, the yields of pyruvic acid and acetic acid in 0.10 MPa of CO2 partial pressure were 200% and 69% lower than those in 0.025 MPa of CO2 partial pressure. In addition, as the maximum gas partial pressure of the bioreactor used in this study was 0.10 MPa, higher CO2 partial pressures were not considered. The specific activity of NAPRTase and PYC in BA207 cells was positively correlated with the CO2 partial pressures. Furthermore, the ratios of NADH/NAD+ were decreased at different CO2 partial pressures ranging from 0.025 to 0.10 MPa, and higher NAD(H) concentration and succinic acid yield were obtained at higher CO2 partial pressures. These results demonstrated that both PYC and

Table 8 Succinic acid production in the published strains with different gene modification. Strains

Succinic acid productivity (mg L−1 h−1 )

Pyruvic acid productivity (mg L−1 h−1 )

Acetic acid productivity (mg L−1 h−1 )

Malic acid productivity (mg L−1 h−1 )

CO2 fixation rate (mg L−1 h−1 )

Ethanol productivity (mg L−1 h−1 )

Succinic acid yield (g g−1 )

NZN111 NZN111/pTrc99a-pyc NZN111/pTrc99a-mdh NZN111/pTrcML NZN111/pTrc99a-pncB

8.3 55.6 78.8 28.8 147.9

13.9 16.7 12.6 ND 150.0

0.9 6.5 8.7 ND ND

NDa ND ND 87.5 ND

3.1 20.7 29.4 39.5 55.1

0.9 2.2 9.2 ND ND

0.53 0.77 0.75 0.30 0.51

a

ND: not detected.

References

[13] [13] [34] [35] [18]

R. Liu et al. / Biochemical Engineering Journal 79 (2013) 77–83

NAPRTase could be efficiently enhanced by the high CO2 partial pressures. Single overexpression of PYC and NAPRTase can partially recover glucose utilization and succinic acid production in NZN111 [13,18] (Table 8). Furthermore, other enzymes capable of catalyzing the reactions to regenerate NAD+ from NADH exist, including fumarate reductase (FRD), malate dehydrogenase (MDH), and malic enzyme (ME). To restore succinic acid production under the PTS regulation, overexpression of MDH in NZN111/pTrc99a-mdh enhanced NAD+ regeneration and restored the recombinant strain’s ability to grow and utilize glucose [34] (Table 8). NZN111/pTrcML, a ME overexpression strain, was cultured in LB medium, and the CO2 fixation rate of 39.5 mg L−1 h−1 was obtained under a CO2 atmosphere [35] (Table 8). However, under optimized condition of CO2 supply, the succinic acid productivity and the CO2 fixation rate in BA207 reached 223.88 mg L−1 h−1 and 83.48 mg L−1 h−1 , which is clear higher than those in the published strains (Table 7). Meanwhile, the highest yield of succinic acid in BA207 also showed that the PYC pathway had a higher CO2 fixation ability than the PPC pathway under PTS regulation. 4. Conclusion With gene modification, two pathways of CO2 fixation were noted in engineered E. coli, and the PYC pathway showed a higher CO2 fixation ability than the PPC pathway under PTS regulation. Furthermore, co-expression of NAPRTase and PYC in a pflB, ldhA, and ppc deletion strain resulted in a significant increase in cell mass and succinic acid production under anaerobic conditions. In addition, under optimized condition of CO2 supply, the CO2 fixation rate and succinic acid productivity with the co-expression of NAPRTase and PYC could be further increased significantly than those noted in the PPC pathway. Acknowledgments This study was supported by the National Natural Science Foundation of China (Grant Nos. 21076105 and 21106066), the “973” Program of China (Grant No. 2009CB724701), Innovation Scholars Climbing Program (SBK200910195), the “863” Program of China (Grant No. 2011AA02A203), “Qinglan project” of Jiangsu province, “The six talent summit” of Jiangsu province, Program for Changjiang Scholars and Innovative Research Team in University, Natural Science Foundation of the Higher Education Institutions of Jiangsu Province, China (11KJB530003), Program for New Century Excellent Talents in University (NCET), and the PAPD Project of Jiangsu Province, a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. References [1] J.G. Zeikus, M.K. Jain, P. Elankovan, Biotechnology of succinic acid production and markets for derived industrial products, Appl. Microbiol. Biotechnol. 51 (1999) 545–552. [2] I. Bechthold, K. Bretz, S. Kabasci, R. Kopitzky, A. Springer, Succinic acid: a new platform chemical for biobased polymers from renewable resources, Chem. Eng. Technol. 31 (2008) 647–654. [3] H. Song, S.Y. Lee, Production of succinic acid by bacterial fermentation, Enzyme Microb. Technol. 39 (2006) 352–361. [4] P.C. Lee, S.Y. Lee, S.H. Hong, H.N. Chang, Isolation and characterization of a new succinic acid-producing bacterium, Mannheimia succiniciproducens MBEL55E, from bovine rumen, Appl. Microbiol. Biotechnol. 58 (2002) 663–668. [5] I.J. Oh, H.W. Lee, C.H. Park, S.Y. Lee, J. Lee, Succinic acid production by continuous fermentation process using Mannheimia succiniciproducens LPK7, J. Microbiol. Biotechnol. 18 (2008) 908–912. [6] M.V. Guettler, D. Rumler, M.K. Jain, Actinobacillus succinogenes sp. nov., a novel succinic-acid-producing strain from the bovine rumen, Int. J. Syst. Bacteriol. 49 (1999) 207–216.

83

[7] N.P. Nghiem, B.H. Davison, B.E. Suttle, G.R. Richardson, Production of succinic acid by Anaerobiospirillum succiniciproducens, Appl. Biochem. Biotechnol. 63–65 (1997) 565–576. [8] H. Lin, G.N. Bennett, K.-Y. San, Genetic reconstruction of the aerobic central metabolism in Escherichia coli for the absolute aerobic production of succinate, Biotechnol. Bioeng. 89 (2005) 148–156. [9] H. Wu, Z.M. Li, L. Zhou, Q. Ye, Improved succinic acid production in the anaerobic culture of an Escherichia coli pflB ldhA double mutant as a result of enhanced anaplerotic activities in the preceding aerobic culture, Appl. Environ. Microbiol. 73 (2007) 7837–7843. [10] N.S. Samuelov, R. Lamed, S. Lowe, J.G. Zeikus, Influence of CO2 –HCO3 − levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum Succiniciproducens, Appl. Environ. Microbiol. 57 (1991) 3013–3019. [11] H. Song, J.W. Lee, S. Choi, J.K. You, W.H. Hong, S.Y. Lee, Effects of dissolved CO2 levels on the growth of Mannheimia succiniciproducens and succinic acid production, Biotechnol. Bioeng. 98 (2007) 1296–1304. [12] M.J. Van der Werf, M.V. Guettler, M.K. Jain, J.G. Zeikus, Environmental and physiological factors affecting the succinate product ratio during carbohydrate fermentation by Actinobacillus sp. 130Z, Arch. Microbiol. 167 (1997) 332–342. [13] G.N. Vemuri, M.A. Eiteman, E. Altman, Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of Escherichia coli, Appl. Environ. Microbiol. 68 (2002) 1715–1727. [14] D. Wang, Q. Li, W.L. Li, J.M. Xing, Z.G. Su, Improvement of succinate production by overexpression of a cyanobacterial carbonic anhydrase in Escherichia coli, Enzyme Microb. Technol. 45 (2009) 491–497. [15] P.V. Attwood, The structure and the mechanism of action of pyruvate carboxylase, Int. J. Biochem. Cell Biol. 27 (1995) 231–249. [16] R.R. Gokarn, M.A. Eiteman, E. Altman, Expression of pyruvate carboxylase enhances succinate production in Escherichia coli without affecting glucose uptake, Biotechnol. Lett. 20 (1998) 795–798. [17] F. Heuser, K. Schroer, S. Lütz, S. Bringer-Meyer, H. Sahm, Enhancement of the NAD(P)(H) pool in Escherichia coli for biotransformation, Eng. Life Sci. 7 (2007) 343–353. [18] L.Y. Liang, R.M. Liu, G.M. Wang, D.M. Gou, J.F. Ma, K.Q. Chen, M. Jiang, P. Wei, P.K. Ouyang, Regulation of NAD(H) pool and NADH/NAD+ ratio by overexpression of nicotinic acid phosphoribosyltransferase for succinic acid production in Escherichia coli NZN111, Enzyme Microb. Technol. 51 (2012) 286–293. [19] G. Gosset, Improvement of Escherichia coli production strains by modification of the phosphoenolpyruvate: sugar phosphotransferase system, Microb. Cell Fact. 4 (2005) 14. [20] R.M. Liu, L.Y. Liang, K.Q. Chen, J.F. Ma, M. Jiang, P. Wei, P.K. Ouyang, Fermentation of xylose to succinate by enhancement of ATP supply in metabolically engineered Escherichia coli, Appl. Microbiol. Biotechnol. 94 (2012) 959–968. [21] E. Amann, B. Ochs, K.J. Abel, Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli, Gene 69 (1988) 301–315. [22] M.R. Leonardo, Y. Dailly, D.P. Clark, Role of NAD in regulating the adhE gene of Escherichia coli, J. Bacteriol. 178 (1996) 6013–6018. [23] M.M. Bradford, A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principles of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [24] A. Vinitsky, C. Grubmeyer, A new paradigm for biochemical energy coupling: Salmonella typhimurium nicotinate phosphoribosytransferase, J. Biol. Chem. 268 (1993) 26004–26010. [25] J. Payne, J.G. Morris, Pyruvate carboxylase in Rhodopseudomonas spheroides, J. Gen. Microbiol. 59 (1969) 97–101. [26] P.K. Bunch, F. Mat-Jan, N. Lee, D.P. Clark, The ldhA gene encoding the fermentative lactate dehydrogenase of Escherichia coli, Microbiology 143 (1997) 187–195. [27] L. Stols, M.I. Donnelly, Production of succinic acid through overexpression of NAD+ -dependent malic enzyme in an Escherichia coli mutant, Appl. Environ. Microbiol. 63 (1997) 2695–2701. [28] A. Baez, N. Flores, F. Bolívar, O.T. Ramírez, Metabolic and transcriptional response of recombinant Escherichia coli to elevated dissolved carbon dioxide concentrations, Biotechnol. Bioeng. 104 (2009) 102–110. [29] J.G. Speight, Lange’s Handbook of Chemistry, 16th ed., McGraw-Hill, NewYork, 2005. [30] A. Mucci, The solubility of calcite and aragonite in seawater at various salinities, temperatures, and one atmosphere total pressure, Am. J. Sci. 283 (1983) 780–799. [31] H.F. Mark, D.F. Othmer, C.G. Overberger, G.T. Seaborg (Eds.), Kirk-Othmer Encyclopedia of Chemical Technology, 3rd ed., Wiley, New York, 1981. [32] S.M. Podkovyrov, J.G. Zeikus, Purification and characterization of phosphoenolpyruvate carboxykinase, a catabolic CO2 -fixing enzyme, from Anaerobiospirillum Succiniciproducens, J. Gen. Microbiol. 139 (1993) 223–228. [33] C. Andersson, J. Helmerius, D. Hodge, K.A. Berglund, U. Rova, Inhibition of succinic acid production in metabolically engineered Escherichia coli by neutralizing agent, organic acids, and osmolarity, Biotechnol. Prog. 25 (2009) 116–123. [34] W. Wang, Z.M. Li, J.L. Xie, Q. Ye, Production of succinate by a pflB ldhA double mutant of Escherichia coli overexpressing malate dehydrogenase, Bioprocess Biosyst. Eng. 32 (2009) 737–745. [35] S.H. Hong, S.Y. Lee, Importance of redox balance on the production of succinic acid by metabolically engineered Escherichia coli, Appl. Microbiol. Biotechnol. 58 (2002) 286–290.