Efficient succinic acid production from lignocellulosic biomass by simultaneous utilization of glucose and xylose in engineered Escherichia coli

Bioresource Technology 149 (2013) 84–91

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Efficient succinic acid production from lignocellulosic biomass by simultaneous utilization of glucose and xylose in engineered Escherichia coli Rongming Liu, Liya Liang, Feng Li, Mingke Wu, Kequan Chen, Jiangfeng Ma, Min Jiang ⇑, Ping Wei, Pingkai Ouyang State Key Laboratory of Materials-Oriented Chemical Engineering, College of Biotechnology and Pharmaceutical Engineering, Nanjing University of Technology, Nanjing 211816, China

h i g h l i g h t s  We constructed a recombinant Escherichia coli strain named BA305.  BA305 improved utilization of glucose and xylose anaerobically.  BA305 consumed sugar mixture simultaneously during anaerobic fermentations.  Fed-batch fermentation of sugarcane bagasse hydrolysate was achieved in BA305.  39.3 g L

1

succinic acid was generated by BA305 in the hydrolysate fermentation.

a r t i c l e

i n f o

Article history: Received 15 August 2013 Received in revised form 7 September 2013 Accepted 11 September 2013 Available online 20 September 2013 Keywords: ATP Escherichia coli Succinic acid Simultaneous utilization Lignocellulosic hydrolysate

a b s t r a c t To enhance succinic acid formation during xylose fermentation in Escherichia coli, overexpression of ATP-forming phosphoenolpyruvate carboxykinase (PEPCK) from Bacillus subtilis 168 in an ldhA, pflB, and ppc deletion strain resulted in a significant increase in cell mass and succinic acid production. However, BA204 displays a low yield of glucose fermentation and sequential glucose–xylose utilization under regulation by the phosphotransferase system (PTS). To improve the capability of glucose fermentation and simultaneously consume sugar mixture for succinic acid production, a pflB, ldhA, ppc, and ptsG deletion strain overexpressing ATP-forming PEPCK, named E. coli BA305, was constructed. As a result, after 120 h fed-batch fermentation of sugarcane bagasse hydrolysate, the dry cell weight and succinic acid concentration in BA305 were 4.58 g L1 and 39.3 g L1, respectively. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction Succinic acid is a member of the C4-dicarboxylic acid family. It has attracted much interest because it is the precursor of many important chemicals in the food, chemical, and pharmaceutical industries (Zeikus et al., 1999; Werpy and Petersen, 2004). To develop a bio-based industrial production of succinic acid, the producing organism must be able to utilize a wide range of sugar feedstocks in order to make use of the cheapest available raw material. Lignocellulosic materials are the most abundant renewable resource on the planet and have great potential as substrates for fermentation (Fan et al., 2006; Guo et al., 2012). After the pretreatment of lignocellulosic materials such as sugarcane bagasse and

⇑ Corresponding author. Tel./fax: +86 25 58139927. E-mail address: [email protected] (M. Jiang). 0960-8524/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biortech.2013.09.052

corn stalk, glucose and xylose are the major constituents of the hydrolysates (Sun et al., 2004; Zhang et al., 2007). To improve the efficiency of succinic acid production during glucose and xylose fermentation in E. coli, one strategy is to block the competition pathways to succinic acid, such as by inactivation of pyruvate:formate lyase (PFL) and lactate dehydrogenase (LDH) (Vemuri et al., 2002), the protein EIICBglc in the PTS (Chatterjee et al., 2001; Donnelly et al., 1998). AFP111 and AFP184 were both strains where the three mutations described above. AFP111 can metabolize glucose but not xylose under anaerobic conditions. However, AFP184 can ferment both five- and six-carbon sugars and has strong growth characteristics (Andersson et al., 2007). In E. coli K12 and W1485 (the parent strain of AFP111), xylose is transported mainly by the periplasmic protein which is driven by ATP (Jeffries, 1983). In other words, one molecule of xylose requires one (each) ATP molecule for xylose transport and xylulose phosphorylation. Xylose metabolism in AFP184 differs from the

85

R. Liu et al. / Bioresource Technology 149 (2013) 84–91

two other strains. Uptake of xylose is instead governed by chemiosmotic effects, and only 1/3 of the amount of ATP is used for xylose transportation (Jeffries, 1983; Lam et al., 1980). Because of the low ATP demand for xylose transportation, the xylose utilization can be achieved in AFP184. To restore the xylose utilization in the strains created in the parental strain K12, overexpression of ATP-forming PEPCK from Bacillus subtilis 168 in an ldhA, pflB, and ppc deletion strain, E. coli BA204, supplied additional ATP and resulted in a significant increase in cell mass with xylose as the carbon source (Liu et al., 2012). In BA204, the net yield of ATP per xylose increased to 0.67 mol mol1 when succinic acid was the sole fermentation product. Moreover, the net yield of ATP per glucose increased to 2 mol mol1 when succinic acid reached the maximum possible yield. However, the strain still produced high levels of pyruvic acid when glucose was used as the carbon source because PTS consumed 50% of the available PEP (Orencio-Trejo et al., 2010; Vemuri et al., 2002). Furthermore, simultaneous consumption of the sugars for succinic acid production is still a major problem for hydrolysate fermentation by engineered E. coli. In this study, we investigated whether the strain BA305, a pflB, ldhA, ppc, and ptsG deletion strain overexpressing the ATP-forming PEPCK from Bacillus subtilis 168, could display restored cell growth, consume the sugars simultaneously, and produce a high yield of succinic acid from the lignocellulosic hydrolysate fermentation under anaerobic conditions. Furthermore, we explored whether simultaneous consumption of sugars in BA305 would further improve xylose utilization.

2. Methods 2.1. Strains and plasmids All strains, plasmids, and primers used in this study are listed in Table 1. All genetic modifications were made in E. coli K12. The deletion strains were constructed following the one-step inactivation of chromosomal genes method developed earlier (Datsenko and Wanner, 2000). The apramycin resistance cassette was amplified from plasmid pIJ773 by PCR with two long primers (Table 1). The purified PCR product was electroporated into derivatives of K12 harboring pIJ790 (k-Red recombination plasmid). The apramycin-resistant colonies were screened for the desired gene

knockout by PCR amplification and subsequent sequencing. Primers for this confirmation step were designed to bind 300–400 bp upstream and downstream of the target gene. Plasmid pCP20 carrying FLP-recombinase was subsequently used to excise the apramycin selection marker from the mutant strain. All plasmids were cured by propagating the strains at 42 °C before preparing for deletion of the next target gene. The recombinant plasmid pTrc-Bspck was constructed in our laboratory (Liu et al., 2012). Then the plasmid pTrc-Bspck was introduced into BA304 to form a recombinant strain designated as BA305. The parental strain BA304 carrying the corresponding backbone plasmid pTrc99a was constructed and designated as BA305a. 2.2. Media The Lysogeny broth (LB) medium contained tryptone (Oxoid, United Kingdom) (10 g L1), yeast extract (Oxoid, United Kingdom) (5 g L1), and NaCl (10 g L1). The chemically defined (CD) medium contained citric acid (3.0 g L1), Na2HPO4  7H2O (3.0 g L1), KH2PO4 (8.0 g L1), (NH4)2HPO4 (8.0 g L1), NH4Cl (0.2 g L1), (NH4)2SO4 (0.75 g L1), MgSO4  7H2O (1.0 g L1), CaCl2  2H2O (10.0 mg L1), ZnSO4  7H2O (0.5 mg L1), CuCl2  2H2O (0.25 mg L1), MnSO4  H2O (2.5 mg L1), CoCl2  6H2O (1.75 mg L1), H3BO3 (0.12 mg L1), Al2(SO4)3  5H2O (1.77 mg L1), Na2MoO4  2H2O (0.5 mg L1), Fe(III) citrate (16.1 mg L1), thiamine (20 mg L1), and biotin (2 mg L1) (Jiang et al., 2010). The CD-Y medium contained yeast extract (2 g L1) which was added to the CD medium without (NH4)2HPO4, NH4Cl, and (NH4)2SO4. When needed, the following antibiotics were added: 100 lg mL1 ampicillin and 50 lg mL1 apramycin. The sugarcane bagasse hydrolysate was obtained from the State Key Laboratory of Materials-Oriented Chemical Engineering, and the hydrolysates contained 2.1 g L1 total soluble phenolic compounds (TPC), and 50.7 g L1 reducing sugars which mainly comprised of 30.7 g L1 glucose and 15.5 g L1 xylose. 2.3. Fermentation conditions A seed inoculum of 200 lL from an overnight 5-mL LB culture was added to a 500-mL flask containing 50 mL LB medium for aerobic growth at 37 °C and 200 rpm. After incubating for 8 h, a

Table 1 Bacterial strains, plasmids, and primers used in this study.

Strains E.coli K12 BA002 BA102 BA203 BA204 BA204a BA304 BA305 BA305a 168 Plasmids pTrc99a pTrc-Bspck Primers ptsG deletion ptsG-upstream ptsG-downstream ptsG-confirm-1 ptsG-confirm-2

Relevant description

Source/restriction site

Wild type, F+ rpoS (AM) rph-l E.coli K12, 4pflB, 4ldhA E.coli K12, 4pflB, 4ldhA, 4ptsG E.coli K12, 4pflB, 4ldhA, 4ppc E.coli K12, 4pflB, 4ldhA, 4ppc, pTrc-Bspck BA203 harboring pTrc99a, control strain for BA204 E.coli K12, 4pflB, 4ldhA, 4ppc, 4ptsG E.coli K12, 4pflB, 4ldhA, 4ppc, 4ptsG, pTrc-Bspck BA304 harboring pTrc99a, control strain for BA305 Bacillus subtilis 168, providing pck gene

CGSC 4401 Liu et al. (2012) Liu et al. (2012) Liu et al. (2012) Liu et al. (2012) Liu et al. (2012) This study This study This study ATCC 23857

Expression vector with Trc promoter pck gene cloned from Bacillus subtilis 168 under the Trc promoter of pTrc99a

This study Liu et al. (2012)

ATGTTTAAGAATGCATTTGCTAACCTGCAAAAGGTCGGTAAATCGCTGATTCCGGGGATCCGTCGACC TTAGTGGTTACGGATGTACTCATCCATCTCGGTTTTCAGGTTATCGGATGTAGGCTGGAGCTGCTTC GTGTAGGCTGGAGCTGCTTCGAAGT ATCCGTCGACCTGCAGTTCGAAG

This This This This

study study study study

86

R. Liu et al. / Bioresource Technology 149 (2013) 84–91

10% inoculum was used to start the anaerobic culture. The anaerobic cultures were carried out at 170 rpm and 30 °C for 96 h in 100mL sealed bottles containing 30 mL CD medium supplemented with 20 g L1 total reductive sugar and 16 g L1 magnesium carbonate hydroxide to maintain the pH at 6.6–7.0 plus 0.3 mM isopropyl-b-D-thiogalactopyranoside (IPTG) to induce overexpression of the pck gene. The headspace in the sealed bottles was filled via a gassing manifold with oxygen-free CO2 for at least 2 min. Anaerobic fermentation of the sugar mixture and hydrolysate were carried out in a 3-L bioreactor (Bioflo 110, USA) containing 1.5 L CD medium. The culture conditions were the same as those in the sealed bottles described above, supplemented with 15– 18 g L1 total reductive sugar, 16 g L1 magnesium carbonate hydroxide, and 0.3 mM IPTG. Anaerobic conditions were established by sparging the culture with CO2 at a flow rate of 0.2 L min1. The pH, temperature, and agitation rate were maintained at 6.6–7.0, 30 °C, and 170 rpm, respectively. Fed-batch fermentation of the hydrolysate was also carried out in a 3-L bioreactor (Bioflo 110, USA) containing 1.5 L CD-Y medium. The culture conditions were the same as those in the anaerobic fermentation of the sugar mixture, supplemented with 20 g L1 total reductive sugar. When total reductive sugar was almost consumed, 20 g L1 total reductive sugar of hydrolysate was supplemented and 16 g L1 magnesium carbonate hydroxide was supplemented to maintain the pH at 6.6–7.0.

2.4. Analytical methods The OD600 was measured to monitor cell growth and was correlated to the DCW: DCW (g L1) = 0.4  OD600. The total reducing sugar concentration was measured by the 3, 5-dinitrosalicylic acid method (Breuil and Saddler, 1985). Glucose, xylose, and the organic acids were quantified by highperformance liquid chromatography (Chromeleon server monitor, P680 pump, Dionex, USA). To determine the amount of glucose and xylose, a refractive index detector, RI101 (Shodex, USA), and an ion exchange chromatographic column (Aminex HPX-87H, 7.8 mm  300 mm, Biorad, USA) were used, and the mobile phase was 5 mM H2SO4 with a flow rate of 0.6 mL min1 at 55 °C. To determine the organic acids, a UV detector, UVD 170U, and an ion exchange chromatographic column (Prevail Organic Acid 5 l, 250 mm  4.6 mm, Grace, USA) were used at a wavelength of 215 nm, and 25 mM KH2PO4 (adjusted to a pH of 2.5 by H3PO4) was used as the mobile phase with a flow rate of 1 mL min1. To measure the intracellular ATP concentration, 1 mL of cold 30% (w/v) trichloroacetic acid was added to the samples (4 mL) and mixed thoroughly. The ATP concentrations were then measured using the BacTiter-Glo™ Microbial Cell Viability assay kit on the GloMaxÒ-Multi + Detection System (Promega, Madison, WI, USA). The intracellular concentrations of NADH and NAD+ were assayed using a cycling method (Liang et al., 2012).

2.5. Enzyme assays Cells harvested by centrifugation at 6080g for 10 min were washed twice with 100 mM Tris–HCl (pH 7.5) and then resuspended in the same buffer containing 1 mM TPP. The suspension obtained was stored at 80 °C until use. Cells were sonicated on ice for 10 min (a working period of 3 s in a 3-s interval for each cycle) at a power output of 300 W by an ultrasonic disruptor (GA92-IID, Shangjia, Wuxi, China). The cell debris were removed by centrifugation (16,060g for 60 min at 4 °C), and the crude cell extracts were immediately used to determine enzyme activities. The activities of PEPCK and PPC were measured by monitoring spectrophotometrically the disappearance of NADH, which has a millimolar extinction coefficient of 6.22 cm1  mM1, at 340 nm (Wu et al., 2007; Liu et al., 2012). One unit of specific activity was defined as the amount of enzyme needed to oxidize 1 lmol of NADH per minute per milligram of protein. The total protein concentration in the crude cell extracts was measured by Bradford’s method with bovine serum albumin as a standard. To compare different samples, the same amount of protein was added for the measurement of enzyme activity, and each measurement was performed in triplicate. 3. Results and discussion 3.1. Xylose utilization for succinic acid production in BA305 during anaerobic fermentation Under anaerobic conditions, xylose could not be utilized by BA102 which was a ldhA, pflB, and ptsG genes deletion strain (Table 2). However, BA204 and BA305, which overexpressed the ATPforming PEPCK in BA203 and BA304, displayed significant increases in cell mass and succinic acid production during xylose fermentations (Kim et al., 2004; Laivenieks et al., 1997). At the end of the fermentation, the cell mass and succinic acid concentration were 0.66 g L1 and 5.2 g L1 in BA204 and 0.57 g L1 and 5.2 g L1 in BA305, respectively (Table 2). The high PEPCK activity in BA204 and BA305 showed that the both strains can obtain more ATP during anaerobic fermentation (Table 3). The concentration of ATP in BA305 was 60% higher than that in BA102 during the xylose fermentation (Table 2). As a result, although BA305 and BA102 are both ptsG deletion strains, the higher ATP supply in BA305 can restore the xylose utilization, whereas in BA102, the cell growth and xylose utilization were eliminated. During anaerobic bacterial growth, organic intermediates, such as pyruvic acid, serve as electron acceptors to maintain the overall redox balance. Under these conditions, the ATP needed for cell growth is derived from substrate-level phosphorylation (Hasona et al., 2004). In BA102, the net yield of ATP per xylose is 1 mol mol1 during the conversion of xylose to succinic acid when succinic acid is the sole fermentation product. However, after overexpression of ATP-forming PEPCK in E. coli BA204 and BA305, the net yield of ATP per xylose increased to 0.67 mol mol1

Table 2 Anaerobic fermentations of the strains after 96 h in CD media supplemented with 20 g L1 xylose.a

a b

Strains

DCW (g L1)

Succinic acid (g L1)

Formic acid (g L1)

Acetic acid (g L1)

Pyruvic acid (g L1)

Lactic acid (g L1)

Malic acid (g L1)

Ethanol (g L1)

Xylose consumed (g L1)

Succinic acid yield (mol mol1)

Experimental data of ATP (nmol g1 DCW)

BA102 BA204 BA305

0.30 ± 0.01 0.66 ± 0.04 0.57 ± 0.05

0.9 ± 0.1 5.2 ± 0.2 5.2 ± 0.3

NDb ND ND

0.7 ± 0.1 1.8 ± 0.1 1.1 ± 0.1

0.9 ± 0.1 0.8 ± 0.1 0.9 ± 0.1

ND ND ND

ND ND ND

ND ND ND

2.5 ± 0.1 7.8 ± 0.1 7.2 ± 0.1

0.56 ± 0.04 1.02 ± 0.08 1.10 ± 0.09

500 ± 36 899 ± 37 800 ± 42

Each value is the mean of three parallel replicates ± standard deviation. ND Not Detected.

87

R. Liu et al. / Bioresource Technology 149 (2013) 84–91 Table 3 Specific activities of PPC and PEPCK in crude extracts of the strains during anaerobic fermentations.a Strains

Xylose fermenatation 1

PPC activity (U mg BA102 BA204 BA305 a

)

0.34 ± 0.05 0.03 ± 0.01 0.01 ± 0.01

Glucose fermentation PEPCK activity (U mg

1

)

0.05 ± 0.02 1.49 ± 0.02 1.47 ± 0.03

PPC activity (U mg1)

PEPCK activity (U mg1)

0.32 ± 0.02 0.02 ± 0.01 0.01 ± 0.01

0.04 ± 0.02 1.56 ± 0.02 1.58 ± 0.05

Each value is the mean of three parallel replicates ± standard deviation.

(Liu et al., 2012). In these strains the increase of ATP supply restored the xylose utilization. The ATP measurements also show that, when more ATP is supplied by the strains, higher sugar consumption rate and growth rate can be obtained.

fermentation, the concentrations of ATP in BA204 and BA305 were higher than those in the other engineered strains due to the higher PEPCK activity (Tables 3 and 4). The concentration of ATP in BA305 was 1.14-fold higher than that in BA102 during the glucose fermentation. Although BA305 and BA102 are both ptsG deletion strains, the sugar consumption rate and the cell growth rate in BA305 were higher than those in BA102. These results showed that the sugar consumption rate and the cell growth rate during glucose or xylose fermentation were positively correlated with the experimental data for ATP. When more ATP was supplied by the strains, higher sugar consumption rate and growth rate were obtained.

3.2. Glucose utilization for succinic acid production by the engineered E. coli strains during anaerobic fermentations Under anaerobic conditions, wild-type E. coli K12 grew rapidly during glucose fermentation. After 96 h, 13.6 g L1 glucose was metabolized with 1.12 g L1 DCW (Table 4). Succinic acid was not the dominant fermentation product from glucose and the yield of succinic acid was only 0.14 mol mol1. Unlike the xylose utilization, glucose is transported into the K12 cells by PTS and pyruvic acid is generated from PEP, which is the phosphate donor for PTS (Gonzalez et al., 2002). Disruption of ldhA and pflB genes increases the pyruvic acid accumulation, limiting the ways in which NAD+ may be regenerated from NADH during glycolysis, and thus affects the redox balance and enhances the NADH/NAD+ ratio (Singh et al., 2009). As a result, BA002 was unable to grow anaerobically on glucose. After deletion of the ptsG gene, the NADH/NAD+ ratio decreased, and the ability to ferment glucose was recovered in BA102 with succinic acid as the major product (Chatterjee et al., 2001). For the strains in which the ppc gene was deleted, there was still no cell growth or succinic acid accumulation in BA203, BA204a, BA304, and BA305a (not shown in Table 4). With the overexpression of PEPCK, BA204 displayed a significant increase in cell mass (0.74 g L1) and succinic acid production (5.5 g L1) at the end of glucose fermentation. There was also pyruvic acid accumulation in BA204 due to regulation by PTS, but overexpression of PEPCK in BA204 increased the carbon flux towards succinic acid, relieved the pyruvic acid accumulation, and partially decreased the NADH/NAD+ ratio. Hence, BA204 partially recovered glucose utilization. After deletion of the ptsG gene, a higher succinic acid yield was obtained from the glucose fermentation in BA305. The yield of succinic acid in BA305 (1.04 mol mol1) was 1.35-fold of that in BA204 (0.77 mol mol1) because inactivation of PTS can further increase the carbon flux towards succinic acid and reduce pyruvic acid accumulation during the glucose fermentation (Chatterjee et al., 2001). The ATP supply also affects succinic acid production during the glucose fermentation (Andersson et al., 2009). Similar to xylose

3.3. Fermentation of a sugar mixture by the engineered E. coli strains during anaerobic fermentation The sugar mixture contained about 9.0 g L1 glucose and 9.0 g L1 xylose, and the total sugar concentration was about 18.0 g L1. During anaerobic fermentation, BA204 still displayed sequential glucose–xylose utilization, the succinic acid concentration reached 5.6 g L1, but more pyruvic acid (7.0 g L1) was generated for glucose transport (Fig. 1A). While in BA305, simultaneous consumption of the sugars in the mixture was achieved. After 120 h of anaerobic fermentation in BA305, the DCW and succinic acid concentration were 0.72 g L1 and 10.6 g L1, respectively (Fig. 1B). Compared to BA204, the diauxic growth (Nichols et al., 2001) was eliminated in BA305, and the DCW was 71% higher than that in BA204 (0.42 g L1). Furthermore, the succinic acid concentration was 88% higher than that in BA204. Besides, simultaneous consumption of the sugars in the mixture further improved xylose utilization. The glucose was entirely consumed in both strains, but 7.0 g L1 xylose was consumed in BA305 which was 2.0-fold higher than that in BA204 (3.5 g L1). During anaerobic fermentation of the sugar mixture, sugar utilization was different in BA204 and BA305. During the anaerobic stage, sugar utilization in BA204 was selective due to regulation by PTS. The ATP curve also illustrates the difference between glucose and xylose fermentation. An inflection point was obtained when the glucose had been entirely consumed and the slope, k1, of the trend line of the ATP curve during glucose fermentation was clearly higher than the slope, k2, during xylose fermentation in BA204 (Fig. 2). This means that the ATP supply decreased from the period of glucose fermentation to the period of xylose fermen-

Table 4 Anaerobic fermentations of the strains after 96 h in CD media supplemented with 20 g L1 glucose.a

a b

Strains DCW (g L1)

Succinic acid (g L1)

Formic acid (g L1)

Acetic acid (g L1)

Pyruvic acid (g L1)

Lactic acid (g L1)

Malic acid (g L1)

Ethanol (g L1)

Glucose consumed (g L1)

Succinic acid yield (mol mol1)

Experimental NADH/ data of ATP NAD+ (nmol g1 DCW)

K12 BA002 BA102 BA204 BA305

1.3 ± 0.1 0.8 ± 0.1 4.2 ± 0.3 5.5 ± 0.2 8.4 ± 0.3

0.3 ± 0.1 NDb ND ND ND

2.0 ± 0.2 0.1 ± 0.1 0.8 ± 0.1 0.1 ± 0.1 1.4 ± 0.1

ND 1.0 ± 0.1 0.6 ± 0.1 5.3 ± 0.2 1.5 ± 0.1

6.1 ± 0.3 ND ND ND ND

ND ND ND ND ND

2.9 ± 0.2 ND ND ND ND

13.6 ± 0.5 1.7 ± 0.2 5.4 ± 0.3 11.0 ± 0.4 12.3 ± 0.5

0.14 ± 0.01 0.66 ± 0.02 1.19 ± 0.31 0.77 ± 0.02 1.04 ± 0.12

1500 ± 37 513 ± 40 570 ± 43 1054 ± 35 1219 ± 43

1.12 ± 0.08 0.20 ± 0.04 0.43 ± 0.02 0.74 ± 0.05 0.94 ± 0.04

Each value is the mean of three parallel replicates ± standard deviation. ND Not Detected.

0.10 ± 0.01 0.60 ± 0.05 0.22 ± 0.02 0.22 ± 0.02 0.13 ± 0.01

88

R. Liu et al. / Bioresource Technology 149 (2013) 84–91

Fig. 1. Anaerobic fermentation of sugar mixture by engineered E. coli (A) BA204 and (B) BA305. Symbols used in the figure: DCW (filled triangle up), xylose (empty circle), glucose (empty square), succinic acid (filled square), pyruvic acid (filled circle), acetic acid (filled triangle down), ATP (empty triangle down).

cell growth and sugar consumption rate were both higher in BA305 than those in BA204 during the entirely anaerobic fermentation process. 3.4. Fermentation of hydrolysate by the engineered E. coli strains during anaerobic fermentation

Fig. 2. The trend line of ATP during the anaerobic fermentations of sugar mixture by BA204 and BA305. Symbols used in the figure: ATP in BA305 (filled circle), ATP in BA204 (filled square).

tation. Simultaneous consumption of sugars of a mixture in BA305 further improved xylose utilization and the higher concentration of ATP derived from glucose fermentation can be used to complement xylose fermentation. The slope, k3, of the trend line of the ATP curve in BA305 was clearly higher than the slope, k2, of the trend line during xylose fermentation in BA204 (Fig. 2). As a result, the

Sugarcane bagasse hydrolysate is a mixture of multiple sugars. Xylose accounts for almost 30% of the total sugar content and glucose accounts for almost 60%. During anaerobic fermentation, BA204 still displayed sequential glucose–xylose utilization. The succinic acid concentration reached 5.3 g L1 and the yield of succinic acid was 0.46 g g1 total sugars (Fig. 3A). Meanwhile, the higher succinic acid yield derived from sugarcane bagasse hydrolysate fermentation was obtained from BA305 (Fig. 3B). The yield of succinic acid in BA305 was 0.66 g g1 total sugars which was 43% higher than that in BA204, and the sugar consumption rate was 34% higher than that in BA204 due to simultaneous utilization of the sugars in BA305. As a result, the succinic acid concentration reached 10.1 g L1 which was 91% higher than that in BA204. 3.5. Fed-batch fermentation of sugarcane bagasse hydrolysate in BA305 Genetically engineered strains of E. coli (Andersson et al., 2007; Liu et al., 2012) and native succinic acid producers such as Actino-

R. Liu et al. / Bioresource Technology 149 (2013) 84–91

89

Fig. 3. Anaerobic fermentation of sugarcane bagasse hydrolysate by engineered E. coli (A) BA204 and (B) BA305. Symbols used in the figure: DCW (filled triangle up), xylose (empty circle), glucose (empty square), succinic acid (filled square), pyruvic acid (filled circle), acetic acid (filled triangle down), ATP (empty triangle up), total sugar (empty triangle down).

bacillus succinogenes (Li et al., 2010; Borges and Pereira, 2011; Zheng et al., 2009) and Anaerobiospirillum succiniciproducens (Lee et al., 2003) have been tested for lignocellulose conversion to succinic acid. However, fermentation using these strains

required complex nutrient supplementation (Andersson et al., 2007; Lee et al., 2003; Liu et al., 2012; Li et al., 2010; Borges and Pereira, 2011). Among the above strains, AFP184 grew well in glucose/xylose mixtures with complex nutrient, and production

Fig. 4. Fed-batch fermentation of sugarcane bagasse hydrolysate in BA305. Symbols used in the figure: DCW (filled triangle up), xylose (empty circle), glucose (empty square), succinic acid (filled square), pyruvic acid (filled circle), acetic acid (filled triangle down), ATP (empty triangle up), total sugar (empty triangle down).

90

R. Liu et al. / Bioresource Technology 149 (2013) 84–91

Table 5 Anaerobic fermentations of the strains after 72 h in 3 L bioreactor with different media.a Strains

Medium

DCW (g L1)

Succinic acid (g L1)

Glucose consumed (g L1)

Xylose consumed (g L1)

NADH/ NAD+

NAD(H) (mmol g1 DCW)

PEPCK activity (U mg1)

Experimental data of ATP (nmol g1 DCW)

BA305

CD medium CD-Y medium CD-Y medium

0.39 ± 0.04

5.5 ± 0.2

5.5 ± 0.1

4.7 ± 0.1

0.17 ± 0.01

1.48 ± 0.09

1.07 ± 0.02

550 ± 35

2.57 ± 0.01

10.2 ± 0.1

10.0 ± 0.3

2.7 ± 0.1

0.15 ± 0.01

1.99 ± 0.09

0.32 ± 0.02

540 ± 34

2.98 ± 0.05

20.0 ± 0.3

12.6 ± 0.3

6.2 ± 0.1

0.12 ± 0.01

2.49 ± 0.09

1.71 ± 0.03

810 ± 41

BA102 BA305 a

Each value is the mean of three parallel replicates ± standard deviation.

of succinic acid decreased when organic acid concentrations reached approximately 30.0 g L1 with a high yield (0.60 g g1) (Andersson et al., 2007). To enhance the efficiency of succinic acid production, a fed-batch fermentation of sugarcane bagasse hydrolysate was tested in BA305 with yeast extracts as the sole nutrient. After 120 h of anaerobic fed-batch fermentation in BA305, the DCW and succinic acid concentration were 4.58 g L1 and 39.3 g L1, respectively (Fig. 4). The yield of succinic acid in BA305 fermented in CD-Y medium was 0.97 g g1 total sugars and the sugar consumption rate was almost 1.65-fold higher than that fermented in CD-medium. Furthermore, the PCK activity fermented in CD-Y medium at 72 h was 60% higher than that was fermented in CD medium (Table 5). As a result, the ATP concentration fermented in CD-Y medium at 72 h was 47% higher than that was fermented in CD-medium. In addition, the NAD(H) concentration fermented in CD-Y medium was further improved, which was 68% higher than that was fermented in CD-medium. Because of the higher ATP supply fermented in CD-Y medium, another ptsG deletion strain, BA102, maybe could consume the sugar mixture simultaneously with the complex nutrient. To test this inference, BA102 was fermented in CD-Y medium (Table 5). However, BA102 showed low xylose utilization. Although the sugar consumption rate in BA102 was higher than that in BA305 which was fermented in CD medium, the ATP concentration at 72 h in BA102 was still lower than that in BA305. This means that the ATP supply is still not enough for xylose utilization in BA102. In contrast, the higher concentration of ATP derived from glucose fermentation in BA305 can be used to complement xylose fermentation, which can further enhance xylose utilization during the hydrolysate fermentation in both media. Meanwhile, repetitive succinic acid production from lignocellulose hydrolysates by BA305 can reach a high concentration of succinic acid, but the aerobic cell growth needs consume carbon sources which can reduce the whole yield of succinic acid (Liang et al., 2013). The yield of anaerobic fermentation was 11% higher than that of repetitive fermentation. Besides, cellobiose can be obtained by enzymolysis via cellulase without b-glucosidase from sugarcane bagasse cellulose (Jiang et al., 2013). Compare with the results of succinic acid production by Actinobacillus succinogenes NJ113, the yield and concentration of succinic acid in BA305 was 50% and 97% higher than those in NJ113.

4. Conclusions To improve the capability of glucose fermentation and simultaneously consume sugar mixture for succinic acid production, a pflB, ldhA, ppc, and ptsG deletion strain overexpressing ATP-forming PEPCK, named E. coli BA305, was constructed. As a result, after 120 h fed-batch fermentation of sugarcane bagasse hydrolysate, the dry cell weight and succinic acid concentration in BA305 were 4.58 g L1 and 39.3 g L1, respectively. Meanwhile, the ATP from

the glucose fermentation can be used to complement the xylose fermentation.

Acknowledgements This study was supported by the National Natural Science Foundation of China (Grant Nos. 21076105 and 21106066), the ‘‘973’’ Program of China (Grant No. 2011CB707405), Innovation Scholars Climbing Program (SBK200910195), the ‘‘863’’ Program of China (Grant No. 2011AA02A203), ‘‘Qinglan project’’ of Jiangsu province, ‘‘The six talent summit’’ of Jiangsu province, Program for Changjiang Scholars and Innovative Research Team in University, Natural Science Foundation of the Higher Education Institutions of Jiangsu Province, China (11KJB530003), Program for New Century Excellent Talents in University (NCET), and the PAPD Project of Jiangsu Province, a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

References Andersson, C., Hodge, D., Berglund, K., Rova, U., 2007. Effect of different carbon sources on the production of succinic acid using metabolically engineered Escherichia coli. Biotechnol. Prog. 23, 381–388. Andersson, C., Petrova, E., Berglund, K., Rova, U., 2009. Maintaining high anaerobic succinic acid productivity by product removal. Bioprocess Biosyst. Eng. 33, 711–718. Borges, E.R., Pereira Jr., N., 2011. Succinic acid production from sugarcane bagasse hemicellulose hydrolysate by Actinobacillus succinogenes. J. Ind. Microbiol. Biotechnol. 38, 1001–1011. Breuil, C., Saddler, J.N., 1985. Comparison of the 3,5-dinitrosalicylic acid and NelsonSomogyi methods of assaying for reducing sugars and determining cellulase activity. Enzyme Microb. Technol. 7, 327–332. Chatterjee, R., Millard, C.S., Champion, K., Clark, D.P., Donnelly, M.I., 2001. Mutation of the ptsG gene results in increased production of succinate in fermentation of glucose by Escherichia coli. Appl. Environ. Microbiol. 67, 148–154. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640– 6645. Donnelly, M.I., Millard, C.S., Clark, D.P., Chen, M.J., Rathke, J.W., 1998. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol. Appl. Biochem. Biotechnol. 70–72, 187–198. Fan, Y.T., Zhang, Y.H., Zhang, S.F., Hou, H.W., Ren, B.Z., 2006. Efficient conversion of wheat straw wastes into biohydrogen gas by cow dung compost. Bioresour. Technol. 97, 500–505. Gonzalez, R., Tao, H., Shanmugam, K.T., York, S.W., Ingram, L.O., 2002. Global gene expression differences associated with changes in glycolytic flux and growth rate in Escherichia coli during the fermentation of glucose and xylose. Biotechnol. Prog. 18, 6–20. Guo, T., Tang, Y., Zhang, Q.Y., Du, T.F., Liang, D.F., Jiang, M., Ouyang, P.K., 2012. Clostridium beijerinckii mutant with high inhibitor tolerance obtained by lowenergy ion implantation. J. Ind. Microbiol. Biotechnol. 39, 401–407. Hasona, A., Kim, Y., Healy, F.G., Ingram, L.O., Shanmugam, K.T., 2004. Pyruvate formate lyase and acetate kinase are essential for anaerobic growth of Escherichia coli on xylose. J. Bacteriol. 186, 7593–7600. Jeffries, T.W., 1983. Utilization of xylose by bacteria, yeasts, and fungi. Adv. Biochem. Eng./Biotechnol. 27, 1–32. Jiang, M., Liu, S.W., Ma, J.F., Chen, K.Q., Yu, L., Yue, F.F., Xu, B., Wei, P., 2010. Effect of growth phase feeding strategies on succinate production by metabolically engineered Escherichia coli. Appl. Environ. Microbiol. 76, 1298–1300.

R. Liu et al. / Bioresource Technology 149 (2013) 84–91 Jiang, M., Xu, R., Xi, Y.L., Zhang, J.H., Dai, W.Y., Wan, Y.J., Chen, K.Q., Wei, P., 2013. Succinic acid production from cellobiose by Actinobacillus succinogenes. Bioresour. Technol. 135, 469–474. Kim, P., Laivenieks, M., Vieille, C., Zeikus, J.G., 2004. Effect of overexpression of Actinobacillus succinogenes phosphoenolpyruvate carboxykinase on succinate production in Escherichia coli. Appl. Environ. Microbiol. 70, 1238–1241. Laivenieks, M., Vieille, C., Zeikus, J.G., 1997. Cloning, sequencing and overexpression of the Anaerobiospirillum succiniciproducens phosphoenolpyruvate carboxykinase (pckA) gene. Appl. Environ. Microbiol. 63, 2273–2280. Lam, V.M.S., Daruwalla, K.R., Henderson, P.J.F., Jones-Mortimer, M.C., 1980. Protonlinked d-xylose transport in Escherichia coli. J. Bacteriol. 143, 396–402. Lee, P.C., Lee, S.Y., Hong, S.H., Chang, H.N., Park, S.C., 2003. Biological conversion of wood hydrolysate to succinic acid by Anaerobiospirillum succiniciproducens. Biotechnol. Lett. 25, 111–114. Liang, L.Y., Liu, R.M., Li, F., Wu, M.K., Chen, K.Q., Ma, J.F., Jiang, M., Wei, P., Ouyang, P.K., 2013. Repetitive succinic acid production from lignocellulose hydrolysates by enhancement of ATP supply in metabolically engineered Escherichia coli. Bioresour. Technol. 143, 405–412. Liang, L.Y., Liu, R.M., Wang, G.M., Gou, D.M., Ma, J.F., Chen, K.Q., Jiang, M., Wei, P., Ouyang, P.K., 2012. Regulation of NAD(H) pool and NADH/NAD+ ratio by overexpression of nicotinic acid phosphoribosyltransferase for succinic acid production in Escherichia coli NZN111. Enzyme Microb. Technol. 51, 286–293. Liu, R.M., Liang, L.Y., Chen, K.Q., Ma, J.F., Jiang, M., Wei, P., Ouyang, P.K., 2012. Fermentation of xylose to succinate by enhancement of ATP supply in metabolically engineered Escherichia coli. Appl. Microbiol. Biotechnol. 94, 959–968. Li, Q., Yang, M., Wang, D., Li, W., Wu, Y., Zhang, Y., Xing, J., Su, Z., 2010. Efficient conversion of crop stalk wastes into succinic acid production by Actinobacillus succinogenes. Bioresour. Technol. 101, 3292–3294.

91

Nichols, N.N., Dien, B.S., Bothast, R.J., 2001. Use of catabolite repression mutants for fermentation of sugar mixtures to ethanol. Appl. Microbiol. Biotechnol. 56, 120–125. Orencio-Trejo, M., Utrilla, J., Fernández-Sandoval, M.T., Huerta-Beristain, G., Gosset, G., Martinez, A., 2010. Engineering the Escherichia coli fermentative metabolism. Adv. Biochem. Eng./Biotechnol. 121, 71–107. Singh, A., Lynch, M.D., Gill, R.T., 2009. Genes restoring redox balance in fermentation-deficient E. coli NZN111. Metab. Eng. 11, 347–354. Sun, J.X., Sun, X.F., Zhao, H., Sun, R.C., 2004. Isolation and characterization of cellulose from sugarcane bagasse. Polym. Degrad. Stab. 84, 331–339. Vemuri, G.N., Eiteman, M.A., Altman, E., 2002. Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of Escherichia coli. Appl. Environ. Microbiol. 68, 1715–1727. Werpy, T., Petersen, G., 2004. Top value added chemicals from biomass. U.S. Department of Energy, Washington, DC. Wu, H., Li, Z.M., Zhou, L., Ye, Q., 2007. Improved succinic acid production in the anaerobic culture of an Escherichia coli pflB ldhA double mutant as a result of enhanced anaplerotic activities in the preceding aerobic culture. Appl. Environ. Microbiol. 73, 7837–7843. Zeikus, J.G., Jain, M.K., Elankovan, P., 1999. Biotechnology of succinic acid production and markets for derived industrial products. Appl. Microbiol. Biotechnol. 51, 545–552. Zhang, M.L., Fan, Y.T., Xing, Y., Pan, C.M., Zhang, G.S., Lay, J.J., 2007. Enhanced biohydrogen production from cornstalk wastes with acidification pretreatment by mixed anaerobic cultures. Biomass Bioenergy 31, 250–254. Zheng, P., Dong, J.J., Sun, Z.H., Ni, Y., Fang, L., 2009. Fermentative production of succinic acid from straw hydrolysate by Actinobacillus succinogenes. Bioresour. Technol. 100, 2425–2429.