Combination of multiplex PCR and DHPLC-based strategy for CYP2D6 genotyping scheme in Thais

Clinical Biochemistry 44 (2011) 1144–1152

Contents lists available at ScienceDirect

Clinical Biochemistry j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c l i n b i o c h e m

Combination of multiplex PCR and DHPLC-based strategy for CYP2D6 genotyping scheme in Thais Payiarat Suwannasri a, Wanna Thongnoppakhun b, Pornpen Pramyothin a,⁎, Anunchai Assawamakin c, Chanin Limwongse b,⁎⁎ a b c

Department of Pharmacology and Physiology, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand Division of Molecular Genetics, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkoknoi, Bangkok 10700, Thailand Biostatistics and Informatics Laboratory, Genome Institute, National Center for Genetic Engineering and Biotechnology (BIOTEC), Klong Luang, Pathumthani 12120, Thailand

a r t i c l e

i n f o

Article history: Received 15 February 2011 Received in revised form 1 June 2011 Accepted 26 June 2011 Available online 6 July 2011 Keywords: CYP2D6 Multiplex PCR Single-base extension Denaturing high performance liquid chromatography Mutiplex-long PCR

a b s t r a c t Objective: To develop CYP2D6 genotyping scheme for accurate allele calling and reliable estimation of functional allele dosage in Thais. Design and methods: We analyzed CYP2D6 copy numbers by pentaplex PCR coupled with semi-quantitative denaturing high performance liquid chromatography (DHPLC)-based technique. Ten common SNPs were genotyped from CYP2D6 gene product using single base extension (SBE) followed by DHPLC analysis. This detection scheme was compared with real-time PCR and conventional PCR-RFLP for cost-effectiveness. Results: The distribution of CYP2D6 gene copy numbers in our population ranged from zero (0.69%), one (7.99%), two (60.07%), three (28.13%) and four (3.13%). The most commonly detected SNPs were related to CYP2D6*10 haplotype. CYP2D6*36 in tandem with CYP2D6*10B is the major rearrangement type in Thais (18.75%). Conclusions: Multiplex PCR coupled with DHPLC-based strategy is convenient and reliable method for CYP2D6 genotyping offering sufficient allele coverage for Asians. Both cost and analytical time saving were shown and the method could potentially be modified to accommodate CYP2D6 genotyping in other ethnics. © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Introduction Genetic polymorphism in drug metabolizing enzymes is an important factor contributed to inter-ethnic differences in drug response. It is usually customary to identify and categorize drug responder status, ranging from slow to rapid metabolizers, based upon the catalytic activity of enzymes in metabolic pathway. CYP2D6 enzyme plays an important role in the metabolism of 25% of commonly prescribed drugs, such as antidepressant, antipsychotic, antiarrythmia, opiates and antihypertensive drugs [1]. Genotype– phenotype correlation studies suggested that CYP2D6 genotyping should be practically useful for phenotype prediction. Accurate genotyping is therefore essential for the implementation of individualized medicine [2–5]. CYP2D6 is exclusively recognized as the most highly polymorphic among drug metabolizing enzyme genes, not only possessing a growing numbers of single nucleotide polymorphisms

Abbreviations: DHPLC, denaturing high performance liquid chromatography; SBE, single base extension; RFLP, restriction fragment length polymorphism; TEAA, triethylammonium acetate. ⁎ Corresponding author. Fax: + 66 2 255 8227. ⁎⁎ Corresponding author. Fax: + 66 2 4183565. E-mail addresses: [email protected] (P. Pramyothin), [email protected] (C. Limwongse).

(SNPs), but also having several types of rearrangement within the gene locus [6–9]. There are more than 78 alleles and additional SNPs, where the haplotype has not yet been determined (http://www. cypalleles.ki.se/cyp2d6.htm: accessed 7 March 2010). Copy number variations (CNVs) in CYP2D6 gene is mainly attributed to an unequal crossing-over event, which has created allele harboring whole gene deletion, duplication, multiplication, and gene conversion [10,11]. CYP2D6 allelic distribution was remarkably different among ethnics, for instance, CYP2D6*3, *4 and *5 were contributed mainly to poor metabolizer (PM) status in Caucasians (~ 10%), while less than 2% of PM were found in Asians [1]. Reduced functional alleles such as CYP2D6*10 was commonly found (N50%) in Asians corresponding with intermediate metabolizer (IM) phenotype, while it was rare in Caucasians (b2%) [1]. CYP2D6*36 was previously termed *10C or Ch2 and collectively taken or masked under CYP2D6*10 allele in the past, until it was distinguishable and later found to be associated with PM status [11,12]. It has been described in tandem arrangement with CYP2D6*10B (CYP2D6*36-*10B) with frequency of 0.3 in Japanese [11]. Interestingly, half of total CYP2D6*10 were tandem allele [12]. The investigation of duplicated or multiplicated CYP2D6 gene in Caucasian showed that CYP2D6*1 × 2 or *2 × 2 is the major type, which is considered to be an ultra-rapid metabolizer (UM) [1]. In contrast, reduced functional alleles contributed mainly to duplication type (CYP2D6*10 × 2, CYP2D6*36-*10B and CYP2D6*36 × 2) in Asians and

0009-9120/$ – see front matter © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved. doi:10.1016/j.clinbiochem.2011.06.985

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

associated with IM or PM but not UM phenotype [11,12]. Therefore, the accurate estimation of functional allele dosage is necessary for the precise phenotype prediction from genotype. There is much analytical interference in genotyping of CYP2D6. The first common one is the presence of its highly homologous pseudogenes (CYP2D7 and CYP2D8), which is basically resolved by preamplification of CYP2D6-specific region. SNPs can be subsequently detected by nested PCR-RFLP or allele specific amplification (ASA) from CYP2D6 template of the first PCR step. Second interference is the large structural alterations from CNVs, which often lead to the falsepositive results. For instance, the misinterpretation in CYP2D6*5 typing was found in multiplex long PCR due to the existence of 1.6-kb insert downstream from CYP2D6 stop codon and/or the chimeric repetitive sequence of CYP2D7 and CYP2D6 (CYP-REP7/6) [8]. This problem is usually circumvented by using long-range PCR. Nonetheless, this strategy was reported to give a high rate of detection failure for a particular source of DNA such as hair root analysis and also very time consuming [13,14]. TaqMan real-time PCR [15], SNaPshot [16], pyrosequencing [17] and AmpliChip® [18] were later introduced for CYP2D6 genotyping but they still inadequately addressed the functional allele scoring and some of these methods (AmpliChip®) had occasional difficulties with genotypic assignment in Thais. Recently, the multiplex PCR-based invader assays (mPCR-RETINA) [19] were proven to be able to assess both gene copy numbers and SNPs genotypes; however, this technology is still at high cost and often beyond the affordability of typical academic laboratories. We therefore developed an alternative detection scheme to circumvent those complicated CYP2D6 structures, which incorporated both CNVs and SNPs analysis using denaturing high performance liquid chromatography (DHPLC)-based strategy under non-denaturing and full-denaturing conditions, respectively. The former was previously used coupled with semi-quantitative multiplex PCR for detection of rearrangements in many genes such as RB1 [20], SMN [21] and dystrophin [22], while the latter applied for genotyping of several SNPs by means of multiplex primer extension [22,23]. Besides their simplicity, these DHPLC-based techniques have proven to be accurate and more cost-effective when compared to quantitative real-time PCR (for CNV analysis) and the traditional PCR-RFLP (for SNP genotyping). The application of our genotyping scheme results in the correction of CYP2D6 genotype previously analyzed with PCR-RFLP. The complete data of CYP2D6 gene copy numbers and SNPs therein result in improved genotyping accuracy for facilitating pharmacogenomic application. Materials and methods gDNA samples We recruited 288 anonymous healthy blood donors from the Division of Transfusion Medicine, Siriraj Hospital for CYP2D6 genotyping. Four-milliliter buffy coat of plasma-free EDTA blood from each subject was obtained for DNA preparation. DNA extraction was performed by using a simple salting out procedure [24] unless very low yield of leukocyte was achieved, then standard phenol-chloroform method was applied. This study protocol was approved by the Institute Review Board of Siriraj Hospital and every donor has given informed consent. CYP2D6 genotyping scheme The detection scheme consists of two different procedures for CYP2D6 genotyping, CNV analysis and SNP detection, which can be performed in parallel. We determined copy number by semiquantitative DHPLC analysis of pentaplex PCR products, which was optimized to achieve the same PCR effectiveness. The relative peak height of DHPLC chromatogram (running under non-denaturing

1145

condition, 50 °C) of each 5-plex amplicon is directly compared to the reference gene and copy number of CYP2D6 can be derived. For SNP detection, multiplex long-range PCR was utilized to simultaneously generate CYP2D6-specific amplicons (and deletion amplicon in the case that deletion exists). Afterward, tetraplex PCR was performed from CYP2D6 whole gene amplicon (Fig. 2a) and used as templates for 5-plex single-base extension (SBE) reactions. Each set of 5 SBE products can be directly analyzed by a fully-denaturing mode (70 °C) of DHPLC system. An order of retention time in DHPLC column for the same particular oligonucleotide (i.e., extension primer) having different bases (dideoxynucleotide triphosphate, ddNTP) at the 3′ end is as follows: C b G b T b A [22]. This means that the SBE product with ‘C’ allele would be eluted fastest, while that with ‘A’ being the slowest. In total 3 multiplex PCR steps and 2 DHPLC analyses were required to perform both CNV and SNP analysis as shown in diagram of Fig. 1. Finally, manual assignment of CYP2D6 genotype can be directly inferred from CNVs and SNPs results without difficulty (see Figs. 2a to d). Primer sequences in all assays are shown in Table 1 and those for SBE reactions are presented in Table 2.

Validation of analytical methods CNV analysis Long-range PCR adapted from Gaedigk et al. [25] was utilized to screen duplication or multiplication samples. Multiplex long PCR was also performed to obtain whole gene and gene deletion (Fig. 1). Fourteen DNA samples consisted of complete deletion, hemizygous deletion, normal, and duplication were selected for quantification of relative copy numbers by LightCycler® 2.0 real-time PCR (Roche Applied Science). Five nanograms of gDNA template was quantified and prepared for each sample. LightCycler® FastStart DNA Master PLUS SYBR Green I Mastermix (Roche Applied Science, USA) was used with D3/D4 and Cx26F/Cx26R primer (Conexin 26 gene as reference gene [26]) for PCR reaction following recommended protocol and run in LightCycler® 2.0 system (Roche Applied Science, USA). The relative copy number of CYP2D6 was calculated by ΔΔCt method, where Ct is threshold cycle. This resulting relative copy number was used as a reference copy for semi-quantitative DHPLC condition and the optimization of pentaplex PCR primer. For the determination of CNV, 5-plex PCR was amplified from gDNA. The PCR effectiveness was optimized by primer concentration adjusting based on the DHPLC peak height corresponding with quantitative real-time PCR results. We started with equal concentration for all primers at the beginning. Female sample with normal copy numbers (2 copies) was used as reference, and we adjusted concentration of each primers based on their corresponding DHPLC peak heights, which represent the quantity of products after PCR. The concentration was increased when the peak height was too low and was decreased when the peak height was too high to achieve the same peak height. During trial condition, the reproducibility of 5-plex PCRs was confirmed with 8 repeats in 14 samples (2 sample of 0 copy and 3 sample of each 1, 2, 3 and 4 copies). Moreover, we added 8 known CNV (reference of 0 to 4 copies) to each set of tested samples (9 set to complete 288 samples) and genotyped in parallel to prove method reliability.

SNPs detection Tetra-plex PCR was conducted to cover all detected SNPs amplified from CYP2D6 whole gene amplicon and used as templates for 5-plex single-base extension (SBE) reactions. Then, the products from SBE step were analyzed by DHPLC using peak retention compared to its primer peak. The results from DHPLC peak interpretation were verified with the results of 20 samples previously genotyped by PCRRFLP or direct-sequencing.

1146

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

Fig. 1. The overview of validation and detection scheme for CYP2D6 genotyping. The processes in dot-lined box (gene duplication, quantitative real-time PCR and PCR-RFLP or sequencing) were conducted only during method validation. CNV analysis was obtained from 5-plex PCRs product analyzed by DHPLC relative peak height interpretation. Ten SNPs detection were derived from 4-plex PCR amplified from CYP2D6 whole gene amplicon. Single base extension (SBE) was performed using 4-plex PCR product as templates and finally injected to DHPLC for peak interpretation.

Copy number analysis condition We designed 3 pairs of primer to selectively amplify 3 regions of CYP2D6; exons 3 to 4, exons 5 to 6, and exon 9 (see annealing site in Fig. 2c). Two-copy reference gene could be obtained from LDL and onecopy reference (only in male) from dystrophin gene product, an x-linked gene as they are deprived of CNV in the selected regions. Gene copy numbers are derived in an assumption that amplified products can proportionally reflect their initial template copy(s) when achieve linear phase (~26 cycles in our optimization) of PCR amplification. We optimized pentaplex reaction to normalize amplification efficiency by varying primer concentrations. The mixture contained 10× buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.42 μM of each D3 and D4 primer, 0.18 μM of each G1 and G2 primer, 0.28 μM of each DYS-F, DYS-R, LDL-F, LDL-R, H3 and H2 primer, 20% Q solution, 0.1 U of Immolase® (Bioline Ltd., UK) and 100 ng of gDNA. Thermal cycles (PCR Touchgene™ Gradient, Techne Inc., USA) started with pre-denaturing at 94 °C 10 min, 94 °C 30 s, 60 °C 30 s, 72 °C 30 s and final extension 72 °C 7 min for 26 cycles. DHPLC condition for gene copy number analysis DHPLC-based CNV analysis was carried out on a non-denaturing mode of the WAVE™ Nucleic Acid Fragment Analysis System (Transgenomic Inc., CA), an automated HPLC instrument equipped with DNASep® HT cartridge (cat. no. DNA-99-3710, Transgenomic). Five microliters of pentaplex PCR products was eluted with a linear acetonitrile gradient using 45% to 80% of buffer B (0.1 M TEAA, 25% acetonitrile) by mixing with buffer A (0.1 M triethylammonium acetate, TEAA) within a separation time of 3.5 min. Each injection was cleaned with 100% solution D (75% acetonitrile in water) for 0.7 min and equilibrated with 40% B for 0.7 min. Flow rate was set at 0.9 mL/min and at an oven temperature of 50 °C. Generally, the analysis took about 7.5 min for each sample. SNP detection condition We selected 10 frequently reported SNPs in most Asians, 100C N T, 843T N G, 1039C N T, 1661G N C, 1707delT, 1758G N A, 1846G N A, 2850C N T, 4155C N T, and 4180G N C. Extension primers were designed immediately upstream or downstream of SNP sites for SBE assay (Table 2). These SNPs were determined from CYP2D6 gene amplicon of first step multiplex long-range PCR. Notably, in case of duplication,

these multiplex primers (A1/A2 and I3/I4) could anneal only to 3′-UTR region of CYP2D6 gene but not 3′-UTR region of CYP2D7 located upstream like in case of CYP2D6*36-*10 (Fig. 2b). Multiplex long-range PCR reaction contained 0.5 μL of Elongase® (Invitrogen Ltd., USA), 1.25 μL of buffer A and 3.75 μL of buffer B (two buffers mixing resulted to 1.75 mM MgCl2), 0.2 mM dNTPs, 0.48 μM of each A1 and A2 and 0.2 μM of each I3 and I4 primer, 10% DMSO. Thermal cycles (PCR Touchgene™ Gradient, Techne Inc., USA) were predenaturation at 94 °C for 2 min, followed by 94 °C 30 s, 60 °C 30 s, 68 °C 5 min and final extension at 68 °C 7 min for 30 cycles. Then nested tetraplex PCR was performed using the CYP2D6 whole gene from above step as templates. Tetraplex products encompassed all 10 SNPs were further used as templates for SBE reaction. The optimized tetraplex PCR mixture contained 10× buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.32 μM of each F1 and G2, 0.16 μM of each B1, B2, D3, D4, H1, and H2, 0.1 U of Immolase® (Bioline Ltd, UK), and 2 μL of 1:400 diluted PCR product from multiplex long PCR step. Thermal cycles (PTC-100™, MJ Research, USA) were pre-denaturing at 94 °C 10 min, followed by 94 °C 30 s, 62 °C 30 s, extension 72 °C 45 s and final extension 72 °C 7 min for 30 cycles. The teraplex amplicons were checked by gel electrophoresis using 2% LE agarose (only in validation step). If tetraplex PCR was successfully amplified, exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT®, GE healthcare, USA) was used for PCR product purification by removing the unincorporated primers and dephosphorylating the dNTPs. Multiplex single-base extension (SBE) Ten extension primers used for SNPs detection were manually designed for 2 separate multiplex SBE reactions (Table 2, see set I and set II extension primers). Each 20-μL reaction contained 10 pmol of each primer (5 primers per reaction), 1 mM of ddNTPs, 0.5 U of Thermosequenase® (Amersham Biosciences Ltd., UK), 0.67 μL reaction buffer, and 5 μL ExoSAP-IT treated products. Cycle condition (PCR Touchgene™ Gradient, Techne Inc., USA) was pre-denatured at 96 °C 1 min, then allowed to proceed for 60 cycles at 96 °C 15 s, 50 °C 15 s, 60 °C 1 min, and soaking at 4 °C at the end. Before injecting to DHPLC, the products were heated to 96 °C for 1 min and snapped cool in ice box to prevent the DNA from re-annealing. DHPLC condition for SNP analysis SBE products were analyzed, without pre-treatment or requiring of gel electrophoresis, on a fully denaturing mode of the WAVE™

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

1147

Fig. 2. a) Multiplex-long range PCR primers, A1/A2 and I4/I3, could anneal only to 3′-UTR region of CYP2D6 gene but not 3′-UTR region of CYP2D7 located upstream. The products from multiplex long-range PCR were CYP2D6 whole gene (and deletion amplicon in case of deletion), which was later used as a template for secondary tetra-plex PCR and its tetraplex products were subsequently used for SBE reaction. b) Duplication arrangement structure shows the location of primer annealing to upstream and downstream allele, which give different fragment lengths based on the upstream allele. The longer fragment (6.5 kb) is indicative of upstream gene containing CYP2D7-like sequence at 3′-UTR (e.g., CYP2D6*4xN, CYP2D6*36) while 4.9 kb fragment show CYP2D6-like sequence (e.g., CYP2D6*1, *2, *3, *4, *10, *14, etc.). Rep6 and 7 is repetitive sequences of CYP2D6 and CYP2D7 gene, respectively; a bar with close circle ends is illustrative of primer. c) An illustration of pentaplex primers specifically hybridize to 5 regions of 3 genes; CYP2D6, dystrophin (present only one copy in male) and LDL gene (two-copy reference) in penta-plex PCR assay and the resulting 5-plex products with variable sizes shown in gel electrophoresis. Pane d) shows tetra-plex primer annual to different exons coverage all 10 SNPs. Bar with close circle ends represent the PCR fragment size amplified from each primer.

DHPLC system equipped with OLIGOSep™ cartridge (cat. no. NUC-993550, Transgenomic). Ten microliters of the SBE products was autoinjected, and eluted with gradient of buffer A and B. DHPLC condition used for set I SBE products were running gradient solution of 40% to 50% buffer B within 7 min separation time, active cleaned with 100% B for 0.3 min, and equilibrated with 35% B for 0.2 min. Set II SBE

products were allowed to eluted with running gradient solution of 39% to 52% buffer B within 7.5 min separation time, active cleaned with 100% solution D for 0.5 min, and equilibrated with 35% B for 0.5 min. Both running profiles used 70 °C oven temperature and 0.9 mL/min flow rate. Total run time of each injection for set I product was 10 min and 11 min for set II. The extension primers were

1148

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

Table 1 Sequence of PCR primers used in the assay. Name

#

A1 A2 B1 B2 D3 D4 F1 G2 H1 H2 G1 G2 I3 I4 7S Set E(R) H3 H2 DYS-F DYS-R LDL-F LDL-R

GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA CTCAGCCTCAACGTACCCCTGTCTCAAATGCG CCATTTGGTAGTGAGGCAGGTAT CCCCACTCGCTGGCCTGTTTCA GAGACTCCTCGGTCTCTCG TAATGCCTTCATGGCCACGCG GCTGGGGCCTGAGACTT CCCCTGCACTGTTTCCCAGA GAGACAAACCAGGACCTGCCA GCCTCAACGTACCCCTGTCTC AGG CCTTCCTGGCAGAGATGAAG CCCCTGCACTGTTTCCCAGA CAGGCATGAGCTAAGGCACCCAGAC CACACCGGGCACCTGTACTCCTCA AAGGAGTGTCAGGGCCGGA CCTGTAGTGTCAGTGACTCAGAAGGCTG CCAGCCACCATGGTGTCTTTG GCCTCAACGTACCCCTGTCTC TTGTCGGTCTCCTGCTGGTCAGTG CAAAGCCCTCACTCAAACATGAAGC TACAAGTGCCAGTGTGAGGAAG GTGCAAAGTTCAGAGGATGAAACT

PCR primer sequences (5′ N 3′)

Purposes

Amplicon size (bp)

whole gene amplification

4680

tetraplex PCR

1194

tetraplex and pentaplex PCR

472

tetraplex PCR

610 866

pentaplex PCR

386

gene deletion amplification

3.1 kb

gene duplication

4.9 or 6.5 kb

pentaplex PCR

250

one-copy reference in pentaplex PCR (on X-chromosome)

190

two-copy reference in pentaplex PCR (on autosome)

150

#

Primer was designed using standard sequences retrieved from GenBank Accession numbers M33388, AY545216, and DQ211353 (CYP2D6*36-*10). bp; base pair, kb; kilobase pair.

designed to anneal immediately adjacent to known SNPs position so that eluted peak next to primer peak can be interpreted as base corresponding to the initial template. Allele assignment was determined based on the key SNPs combination established in the standard nomenclature of CYP2D6 allele, publically available in the CYP450 allele nomenclature website (http://www.cypalleles.ki.se/cyp2d6.htm). Strong haplotype structure arise from multiple sites having share ancestry, for example, 100C N T is in linkage with 1661G N C and 4180G N C as compound SNPs for CYP2D6*10A allele. We used both copy numbers and SNPs therein (in case of duplication, SNPs data were obtained from the downstream CYP2D6 product) to infer CYP2D6 haplotype, estimated from the highest probability of compound SNPs to corresponding CYP2D6 allele. Results Our CNV assessment between males and females was 100% accuracy (N = 288) when verified with the gender data of tested samples. Visual inspection is mainly used to identify relative gene dosage, which was obtained by comparing peak heights rather than peak areas, since the curves did not always reach the baseline between eluted peaks.

Calculated peak height was rechecked when visual comparison could not draw the decision of gene dose assignment. In a few cases, repeating genotyping process is needed to confirm the results due to the low quality of DNA. We can simply interpret relative copy numbers of CYP2D6 from the DHPLC peak heights of the pentaplex products (Fig. 2c) by comparing to its reference gene copy (LDL and dystrophin). CYP2D6 heterozygous deletion is presented by the half of LDL peak height whereas 3 and 4 copies of CYP2D6 can be also interpreted accordingly as 1.5- and 2-fold higher than LDL peak height, respectively (Fig. 3a). The reproducibility of peak height relative to its copy number is also achieved when repeating those with equal peak height and 1.5- and 2- fold higher than its internal controls (Fig. 3b). CYP2D6*36 can be inferred from the presence/absence of gene conversion in exon 9 by comparing its peak height to other 2 peaks of CYP2D6 (exons 3–4 and exons 5–6; Fig. 3a). CNVs of CYP2D6 in Thais were detected at 39.94%, and the highest proportion of all CNVs was the 3-copy type (28.13%). Individuals who loss one copy was presented at 7.99% and only 2 samples (0.69%) show complete loss of active CYP2D6 (*5/*5). Slightly over half of population has normal two copies (60.06%). Ten CYP2D6 SNPs were simultaneously and simply identified from SBE products represented as extension DHPLC peak profiles I and II

Table 2 Sequences of extension primers used in set I and II of SBE reactions. Name

Multiplex SBE Set I:

Primer length (bp)

DNA strand

5′-TGGGCTGCACGCTAC-3′ 5′-TTTCTTGTCAAGCCAGGATC-3′ 5′-TTTTTATTTTTTTGGGAACGCGGCCC-3′ 5′-TTTTTTATTTTTTTGCAGAGGCGCTTCTCCGT-3′ 5′-TTTTTTTTATTTTTTTTTAAAGAAGTCGCTGGAGCAG-3′

15 20 26 32 37

Sense Anti-sense Anti-sense Sense Sense

Multiplex SBE Set II:

Primer length (bp)

DNA strand

15 22 28 34 42

Anti-sense Sense Anti-sense Sense Sense

Sequences of extension primers (5′ N 3′)* 100C N T 843T N G 1039C N T 1661G N C 1707delT Name

Sequences of extension primers (5′ N 3′) 2850C N T 4155C N T 4180G N C 1846G N A 1758G N A

5′-CAGCCACCACTATGC-3′ 5′-TTTTTATTTCCGGCCCAGCCAC-3′ 5′-TTTTTTTTAAAGCTCATAGGGGGATGGG-3′ 5′-TTTTTTTTAATTTTTTTTGCATCTCCCACCCCCA-3′ 5′-TTTTTTTTTTATAATATTTTTTTTGCCTTC GCCAACCACTCC-3′

*Bold letters are additional bases extend to 5' ends of the original sequences (GenBank Accession number M33388) to create increasing and non-overlapping retention times of all primers and their corresponding SBE products in each set.

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

1149

Fig. 3. a) DHPLC profiles from semi-quantitative analysis of 5-plex products, which relatively reflect its initial template copy(s) when amplification is in linear phase (26 cycles). Profile a demonstrates homozygous deletion of the CYP2D6 gene as all peaks of CYP2D6 are absent, while being present only half height of LDL peak in profile b , indicating the hemizygous deletion. Profiles c and d represent normal two copies in female and male, respectively, and e shows 2 copies of gene conversion as no peak in exon 9 (primers anneal only to wild-type sequence). Profiles f and g shows 1.5-fold duplication and g have one copy of gene conversion. Four copies are shown in h and i profiles with 2 copies and 1 copy of gene conversion, respectively. b) The reproducibility of peak height with1.5 (3 copies) and 2.0 (4 copies) fold higher than its reference gene is shown as well as its equal peak height to reference (2 copies).

(Figs. 4a and b). Among 10 SNPs, 9 were detected at different frequencies, except 1707delT was not observed. SNPs at loci 100C N T, 843T N G, 1039C N T, 1661G N C and 4180G N C have a frequency ranging from 0.6 to almost 0.75, while 4155C N T, 2850C N T, 1758G N A and 1846G N A had much lower frequencies ranging from 0.37, 0.13, 0.0120 and 0.009, respectively. From genotype analysis, we found CYP2D6*36-*10B/*10B as the most common rearrangement type in Thais. Functional allele such as CYP2D6*1/*1 and *1/*2 was detected only 13.19%, while reduced functional allele mainly involved with CYP2D6*10 was shown over 44%. Only a few of non-functional alleles such as CYP2D6*5, *4D and * 14 were found in our population (Table 4). When we compared final genotype from our detection scheme with those 20 samples previously genotyped by PCR-RFLP or direct sequencing (without CNV data), only 65% was concordant (Table 3). All discordant cases were resolved and revealed the presence of CNV, most of them are in tandem duplication (CYP2D6*36-*10B) and a few with four copies (CYP2D6*10Bx2/*36× 2). We also compared the allele frequencies derived from our method with other Asian population (Korean, Chinese, and Japanese) genotyped by other methods in Table 5 [27]. Allele coverage is over 97%, only a few SNPs has not been characterized here but found at very low frequency in other Asians. Moreover, total cost of CYP2D6 genotyping from our detection scheme was compared with the conventional PCR-RFLP plus real-time PCR analysis (Table 6). The costs were calculated for reagents and disposable materials only. Labor costs were excluded since there was no difference in each technique as being counted per analysis not run time and no more depreciation costs for equipments. Our detection scheme showed significant saving in both expense and analytical time over the other detection platform mentioned above.

Discussion We present here a CYP2D6 genotyping scheme using simple multiplex PCR with or without multiplex SBE reaction coupled with DHPLC-based strategy to measure CNVs and identify 10 SNPs. Our well optimized 5-plex PCR reaction is simple and convenient since it requires only one step 60 min-PCR running time before injecting products to DHPLC without pre-/post-treatment (non-radioactive, non-fluorescent probe and gel free). Additionally, an extremely accurate amount of gDNA between samples is not required as such for real-time PCR analysis since copy numbers of each sample can be independently derived from the relative comparison with its own internal control co-amplified in the same reaction. This quantitative approach requires almost no preparation step with DNA, so that it consumes less time comparing to real-time PCR. It is considered medium throughput requiring less than 7 min DHPLC running per sample. Each multiplex SBE products were simultaneously resolved with DHPLC giving 5 SNPs/injection. This method is superior to conventional PCR-RFLP or ASA for its simultaneous detection of multiple SNPs, non gel-based approach and less time consuming; approximately 10 min/5 SNPs (DHPLC step). In addition to the advantage of copy number measurement, the capability of gene phase elucidation is another feature of this detection scheme. We can infer CYP2D6*36 from copy numbers of exon 9 as the presence or absence of gene conversion. The duplication with gene conversion can be inferred as CYP2D6*7-like sequence at 3'UTR lining upstream of CYP2D6 as corresponding to the results of 6.5 kb fragment from long-range PCR in validation step (Fig. 2b). Although, this inference may potentially lead to the wrong assignment, the probability of an alternative type is very low (observed from the results found in Asians).

1150

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

Fig. 4. DHPLC profiles of multiplex SBE set I and II. a). DHPLC profiles of multiplex SBE set I consisted of 5 SNPs; 100C N T, 843T N G, 1039C N T, 1661G N C and 1707delT, eluted out of column in order based on the size and sequence context of SBE product Each SNP can be interpreted from the extension peak compared with its primer peak (top peak). The base reading in the right most demonstrates the interpretation of SNPs; WT is wild type. Four extension primers for detection of 843T N G, 1039C N T, 2850C N T and 4180G N C were on antisense strand (see Table 2), thus we had to converted the experimental base calling to their corresponding complementary bases in final genotypes. b) DHPLC profile of multiplex SBE set II consisted of 5 SNPs; 1758G N A, 1846G N A, 2850C N T, 4155C N T and 4180G N C. Base calling of a heterozygous 1846G N A can be unambiguously differentiated from the homozygous ones, although the peak of A allele was superimposed by peak of the next primer (G1758T/A).

Therefore, genotype can be sufficiently inferred from total copy numbers in combination with SNPs data of CYP2D6 gene product. Common genotypes detected from our scheme show N97% coverage. Unaccounted allele (b3%) probably come from CYP2D6*21 and *41 which would be categorized as intermediate metabolizer similar to CYP2D6*10. Therefore the metabolic status would have not change. Our genotyping scheme can cover sufficiently important allele mostly found in Asians. We have compared 20 samples that previously genotyped by

PCR-RFLP and ASA (lack of CNV data) with final genotype from this detection scheme. Discordance was found in 35% of cases and revised genotypes mostly present CYP2D6*36-*10B related allele, which were previously identified as CYP2D6*10A/10B. This is obviously demonstrated that analysis platform that has no capability of elucidating functional gene dosage cannot be reasonably interpreted for accurate CYP2D6 genotypes. Among 288 DNA samples tested, we found CYP2D6*1/*10B, *10B/*10B, *10B/*36-*10B, and *1/*36-*10B at 17.36%,

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152 Table 3 Comparison of genotyping results identified by this detection scheme and conventional method (without CNV detection) in 20 cases. Prior genotype

a

Discordant cases CYP2D6*10A/*10B CYP2D6*10A/*10B CYP2D6*10A/*10B CYP2D6*5/*10B Concordant cases CYP2D6*10A (or B) /*10B CYP2D6*1/*10B CYP2D6*5/*10B CYP2D6*4/*10B CYP2D6*1/*2 Total

Revised genotype

CYP2D6 copy number

Number of samples

CYP2D6*2K/*36-*10B CYP2D6*10B/*36-*10B CYP2D6*10Bx2/*36 × 2 CYP2D6*10B/*36-*10B

3 3 4 3

2 3 1 1

CYP2D6*10A (orB)/*10B CYP2D6*1/*10B CYP2D6*5/*10B CYP2D6*4/*10B CYP2D6*1/*2

2 2 1 2 2

7 3 1 1 1 20

Revised CYP2D6 genotypes using our methods in 20 subjects compared with the same sample previously genotyped with PCR-RFLP and ASA technique. a Some samples were not included in this study population.

13.89%, 11.80%, and 6.94%, respectively, which is slightly different from the report in Japanese that *1/*36-*10B is the highest (19.8%). The percentage (7.99%) of individuals (23/288) carrying only one copy is not significantly different from those reported in other Asians [25,28,29]. Functional allele duplication (e.g., CYP2D6*1 × 2, *2 × 2 and *10 × 2) was found remarkably low at 0.69% in Eastern and central Han Chinese; 1.87% in Japanese; 0.84% in Malaysian [29,30], which are in agreement with this study (b1%), whereas those in Caucasian and African represented significantly higher numbers (7.2%) [1,31,32]. This multiplex PCR- and DHPLC-based detection scheme of CYP2D6 incorporated both CNVs and SNPs analysis is simple and cost-effective providing sufficient allele coverage with reliable genotyping results, leading to more detailed and precise prediction of CYP2D6 metabolizer status. The limitation of this method lies only with the required pre-requisite knowledge regarding SNP variations in study popula-

1151

Table 5 The comparison between CYP2D6 allele coverage detected by our method and other genotyping methods from other Asian population. CYP2D6 allele

Thai (n = 288)

Japanese Chinese Korean (n = 286) (n = 223) (n = 758)

CYP2D6*1 CYP2D6*2 CYP2D6*4 CYP2D6*5 CYP2D6*10 CYP2D6*14 CYP2D6*21 CYP2D6*36 CYP2D6*41 Functional gene duplication Allele coverage Method

21.0% 9.7% 0.7% 4.3% 44.6% 1.04% n/d 16.4% n/d 0.35% 98.09% Multiplex+ DHPLC

42.7% 11.4% n/d 7.2% 36.2% n/d 0.7% n/d n/d n/d 98.2% PGRC [27]

23.6% 15.5% n/d 7.2% 51.6% 2.0% n/d n/d n/d n/d 99.9% PGRC [27]

32.3% 10.1% n/d 5.6% 45.6% 0.3% 0.3% n/d 2.2% 1.5% 100% PGRC [27]

n/d: not determined.

tion. This issue is currently no longer problematic since information in published literature is ample and will undoubtedly aid in the design of specific multiplex and SBE primers to facilitate the simultaneous detection of more than one amplicons using DHPLC system.

Acknowledgments We thank the grant from the 90th Anniversary of Chulalongkorn University Fund, Chulalongkorn University Graduate Scholarship to Commemorate the 72nd Anniversary of His Majesty King Phumibol Adulyadej (to P.S. and P.P.) and Mahidol University Research Grant (to C.L.). A.A. was supported by the National Science and Technology Development Agency (NSTDA) Postdoctoral Fellowship offered through the National Center for Genetic Engineering and Biotechnology (BIOTEC).

Table 4 Copy number variations, SNPs, and genotype frequency found in 288 Thais. CYP2D6 copy (%Freq)

a

Ex 9 Conv copy No

Key SNPs detected from CYP2D6 amplicon

CYP2D6 Genotype

0 1 (7.99%)

0 0

2 (60.06%)

0

not detected wild type 1661C/C; 2850T/T; 4180C/C 100T/T; 1039T/T; 1661C/C; 4180C/C 100T/T; 1039T/T; 1661C/C; 1846A/A; 4155T/T; 4180C/C 100C/T; 1039C/T; 1661G/C; 4180G/C 100T/T; 1039T/T; 1661C/C; 4180C/C 1661G/C; 2850C/T; 4180G/C 100C/T; 1039C/T; 1661C/C; 2850C/T; 4180C/C wild type 100C/T; 1758G/A; 1661C/C; 2850T/T; 4180G/C 100T/T; 1039T/T; 1758G/A; 2850C/T; 1661C/C; 4180C/C 100T/T; 843T/G; 1039T/T; 1661C/C; 4155C/T; 4180C/C 100T/T; 843T/G; 1039C/T; 1661C/C; 1758G/A; 2850C/T; 4155C/T; 4180C/C 100T/T; 1039T/T; 1661C/C; 843G/G; 4155T/T; 4180C/C 100T/T; 1039C/T; 1758G/A; 1661C/C; 2850T/T; 4180C/C 100T/T; 843T/G ;1039T/T; 1661C/C; 4180C/C 100C/T; 843T/G; 1039C/T; 1661G/C; 4180G/C 100C/T; 843T/G; 1039T/T; 1661C/C; 2850C/T; 4180C/C 100T/T; 843T/G ; 1039T/T; 1661C/C; 1846G/A; 4180C/C 100T/T; 843T/G ; 1039T/T; 1661C/C; 4155C/T; 4180C/C 100C/T; 843G/G; 1039C/T; 1661G/C; 4155C/T; 4180G/C 100T/T; 843G/G; 1039T/T; 1661C/C; 4155T/T; 4180C/C 100T/T; 843T/G; 1039T/T; 1661C/C; 4180C/C 100C/T; 843T/G 1039C/T; 1661G/C; 415C/T; 4180G/C

*5/*5 *1/*5 *2/*5 *5/*10B *5/*4D *1/*10B *10B/*10B *1/*2 *2/*10B *1/*1 *2/*14A *10B/*14A *10B/*36 *14A/*36 *36/*36 *14A/*2Bx2 *10B/*36-10B *1/*36-10B *2/*36-10B *4D/*36-10B *36/*36-10B *1/*36 × 2 *36/*36 × 2 *36-10B/*36-10B *36-10B/*36 × 2 Others related to *2b

1

3 (28.13%)

2 0 1

2

4 (3.13%)

3 2 3

total Freq; frequency, Ex 9; exon 9, Conv; gene conversion, No; numbers. a Frequency was calculated from total 288 subjects. b Other genotype related to CYP2D6*2.

No

% Freq

2 7 3 12 1 50 40 21 20 17 3 1 12 1 1 1 35 21 9 3 3 2 1 6 1 15 288

0.69 2.43 1.04 4.17 0.35 17.36 13.89 7.29 6.94 5.91 1.04 0.35 4.17 0.35 0.35 0.35 12.15 7.29 3.13 1.04 1.04 0.69 0.35 2.08 0.35 5.21 100

1152

P. Suwannasri et al. / Clinical Biochemistry 44 (2011) 1144–1152

Table 6 The comparison of cost between detection scheme in this study and conventional PCRRFLP combined with quantitative real-time PCR. Detection panel

CNV

10 SNPs

This study

Cost/ sample (n = 100)

Conventional detection

Cost/ sample (n= 100) b

DNA preparation 5-plex PCRs

5$

DHPLC Multiplex long PCR 4-plex PCR + ExoSAP 2 SBE Reactions 2 DHPLC injection

4.0$ 4$

2 SYBR Green I reactions 13 $ (2D6 and Cx26) – Multiplex long PCRs 4$

3.2$

10 nested PCRs

16$

15$

10 RFLPs

30$

8.5$

Total gel electrophoresis

2.85$

Total cost CNV Total time for 100 samples a detection SNPs detection

[11]

[12]

5$ [13]

2.15$

[14]

[15]

[16]

[17]

41.85$ 15 hrs

CNV detection

70.85$ 16 hrs

36 hrs

SNPs detection

7 days

[18]

[19]

a

Total run time was calculated for 100 samples genotyping but excluded DNA preparation step. However, 2 tested panels can be performed simultaneously for PCRbased steps, so that run time for SNPs detection in this study was calculated based on DHPLC run time only. For, SNP detection by PCR-RFLP was calculated based on 48-well gel electrophoresis running for each round. b Costs were calculated for reagents and disposable materials used only.

[20]

[21]

[22]

References [1] Bradford DL. CYP2D6 allele frequency in European, Caucasians, Asians, African and their descendants. Pharmacogenomics 2002;3:229–43. [2] Dahl ML, Yue QY, Roh HK, Johansson I, Sawe J, Sjoqvist F, et al. Genetic analysis of the CYP2D locus in relation to debrisoquine hydroxylation capacity in Korean, Japanese and Chinese subjects. Pharmacogenetics 1995;5:159–64. [3] Griese E, Zanger UM, Brudermanns U, Gaedigk A, Mikus G, Morike K, et al. Assessment of the predictive power of genotypes for the in-vivo catalytic function of CYP2D6 in a German population. Pharmacogenetics 1998;8:15–26. [4] Johansson IOM, Yue QY, Bertilsson L, Sjoqvist F, Ingelman-Sundberg M. Genetic analysis of the Chinese cytochrome P450 locus: characterization of variant CYP2D6 genes present in subjects with diminished capacity for debrisoquine hydroxylation. Mol Pharmacol 1994;45:452–9. [5] Bertilsson L, Dahl ML, Dalén P, Al-Shurbaji A. Molecular genetics of CYP2D6: clinical relevance with focus on psychotropic drugs. Br J Clin Pharmacol 2002;53: 111–22. [6] Steen V, Andreassen OA, Daly AK, Tefre T, Borresen AL, Idle JR, et al. Detection of the poor metabolizer-associated CYP2D6(D) gene deletion allele by long-PCR technology. Pharmacogenetics 1995;5:215–23. [7] Daly AK, Brockmoller J, Broly F, Eichelbaum M, Evans WE, Gonzalez FJ, et al. Nomenclature for human CYP2D6 alleles. Pharmacogenetics 1996;6:193–201. [8] Fukuda T, Maune H, Ikenaga Y, Naohara M, Fukuda K, Azuma J. Novel structure of CYP2D6 gene that confuses genotyping for CYP2D6*5 allele. Drug Metab Pharmacokinet 2005;20:345–50. [9] Qin S, Shen L, Zhang A, Xie J, Shen W, Chen L, et al. Systematic polymorphism analysis of the CYP2D6 gene in four different geographical Han populations in mainland China. Genomics 2008;92:152–8. [10] Johansson I, Lundqvist E, Bertilsson L, Dahl ML, Sjoqvist F, Ingelman-Sundberg M. Inherited amplification of an active gene in the cytochrome P450 CYP2D locus as a

[23]

[24] [25]

[26]

[27]

[28]

[29]

[30] [31]

[32]

cause of ultrarapid metabolism of debrisoquine. Proc Natl Acad Sci U S A 1993;90: 11825–9. Soyama A, Saito Y, Kubo T, Miyajima A, Ohno Y, Komamura K, et al. Sequencebased analysis of CYP2D6*36-CYP2D6*10 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population. Drug Metab Pharmacokinet 2006;21:208–16. Gaedigk A, Bradford LD, Alander SW, Leeder JS. CYP2D6*36 gene arrangement within the CYP2D6 locus: association of CYP2D6*36 with poor metabolizer status. Drug Metab Dispos 2006;34:563–9. Gan SH, Ismali R, Wan Adnan WA, Wan Z. Standard CYP2D6 genotyping procedures fail for the CYP2D6*5 and duplication alleles when hair roots are used as a source of DNA. Clin Chim Acta 2003;329:61–8. Nevilie M, Selzer R, Aizenstein B, Maquire M, Hogan K, Walton R, et al. Characterization of cytochrome P450 2D6 alleles using the Invader system. Biotechniques 2002:40–3 (suppl). Schaeffeler E, Schwab M, Eichelbaum M, Zanger UM. CYP2D6 genotyping strategy based on gene copy number determination by TaqMan real-time PCR. Hum Mutat 2003;22:476–85. Fuselli S, Dupanloup I, Frigato E, Cruciani F, Scozzari R, Moral P, et al. Molecular diversity at the CYP2D6 locus in the Mediterranean region. Eur J Hum Genet 2004;12:916–24. Söderbäck E, Zackrisson AL, Lindblom B, Alderborn A. Determination of CYP2D6 gene copy number by pyrosequencing. Clin Chem 2005;51:522–31. Heller T, Kirchheiner J, Armstrong VW, Luthe H, Tzvetkov M, Brockmöller J, et al. AmpliChip CYP450 GeneChip: a new gene chip that allows rapid and accurate CYP2D6 genotyping. Ther Drug Monit 2006;28:673–7. Hosono N, Kato M, Kiyotani K, Mushiroda T, Takata S, Sato H, et al. CYP2D6 genotyping for functional-gene dosage analysis by allele copy number detection. Clin Chem 2009;55:1546–54. Dehainault C, Laugé A, Caux-Moncoutier V, Pagés-Berhouet S, Doz F, Desjardins L, et al. Multiplex PCR/liquid chromatography assay for detection of gene rearrangements: application to RB1 gene. Nucleic Acids Res 2004;11(32(18)): e139. Hung CC, Su YN, Lin CY, Yang CC, Lee WT, Chien SC, et al. Denaturing HPLC coupled with multiplex PCR for rapid detection of large deletions in Duchenne muscular dystrophy carriers. Clin Chem 2005;51(7):1252–6. Yip SP, Pun SF, Leung KH, Lee SY. Rapid simultaneous genotyping of five common Southeast Asian beta-thalassemia mutations by multiplex minisequencing and denaturing HPLC. Clin Chem 2003;49(10):1656–9. Wu G, Hua L, Zhu J, Mo QH, Xu XM. Rapid accurate genotyping of beta-thalassemia mutations using a novel multiplex primer extension/denaturing high-performance liquid chromatography assay. Br J Haematol 2003;122(20):311–6. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure of extracting DNA from human nucleated cell. Nucleic Acid Res 1988;16(3):1215–9. Gaedigk A, Ndjountché L, Divakaran K, Dianne Bradford L, Zineh I, Oberlander TF, et al. Cytochrome P4502D6 (CYP2D6) gene locus heterogeneity: characterization of gene duplication events. Clin Pharmacol Ther 2007;81:242–51. Wattanasirichaigoon D, Limwongse C, Jariengprasert C, Yenchitsomanus PT, Tocharoenthanaphol C, Thongnoppakhun W, et al. High prevalence of V37I genetic variant in the connexin-26 (GJB2) gene among non-syndromic hearing-impaired and control Thai individuals. Clin Genet 2004;66:452–60. Kim E-Y, Lee S-S, Jung H-J, Ung H-E, Yeo C-W, Shon J-H, et al. Robust CYP2D6 genotype assay including copy number variation using multiplex single base extension for Asian populations. Clin Chim Acta 2010;411:2043–8. Sheng HH, Zeng AP, Zhu WX, Zhu RF, Li HM, Zhu ZD, et al. Allelic distributions of CYP2D6 gene copy number variation in the Eastern Han Chinese population. Acta Pharmacol Sin 2007;28:279–86. Chida M, Ariyoshi N, Yokoi T, Nemoto N, Inaba M, Kinoshita M, et al. New allelic arrangement CYP2D6*36 × 2 found in a Japanese poor metabolizer of debrisoquine. Pharmacogenetics 2002;12:659–62. Teh LK, Ismail R, Yusoff R, Hussein A, Isa MN, Rahman AR. Heterogeneity of the CYP2D6 gene among Malays in Malaysian. J Clin Pharmacol Ther 2001;26:205–11. Gaedigk A, Coetsee C. The CYP2D6 gene locus in South African coloureds: unique allele distributions, novel alleles and gene arrangements. Eur J Clin Pharmacol 2008;64:465–75. Ledesma MC, Agúndez JA. Identification of subtypes of CYP2D gene rearrangements among carriers of CYP2D6 gene deletion and duplication. Clin Chem 2005;51:939–43.