- Email: [email protected]
Multiple genotyping based on multiplex PCR and microarray
G Model
CCLET-3668; No. of Pages 5 Chinese Chemical Letters xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Chinese Chemical Letters journal homepage: www.elsevier.com/locate/cclet
Original article
Multiple genotyping based on multiplex PCR and microarray Xian-Bo Mou a, Zeeshan Ali a, Bo Li a, Tao-Tao Li a, Huan Yi a, Hong-Ming Dong b, Nong-Yue He a,b,*, Yan Deng b,**, Xin Zeng c,** a
State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China Economical Forest Cultivation and Utilization of 2011 Collaborative Innovation Center in Hunan Province, Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology, Hunan University of Technology, Zhuzhou 412007, China c Nanjing Maternity and Child Health Care Hospital, Nanjing 210029, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 15 February 2016 Received in revised form 4 April 2016 Accepted 6 April 2016 Available online xxx
The genetic variability has obtained more and more attention in the process of diagnosis and treatment of tumors. Herein, we have described a multiple genotyping method based on magnetic enrichmentmultiplex PCR (MEM-PCR) and microarray technology. Monodisperse magnetic beads were fabricated and modified with streptavidin. Four loci on two genes (M235T and A-6G loci on AGT gene, A1298C and C677T loci on MTHFR gene) were selected to study single nucleotide polymorphisms (SNP). Target sequences of these SNP loci were amplified using Cy3-labeled primers through multiplex PCR in one tube after the templates were enriched and purified by functional magnetic beads (MB). Four pairs of NH2labeled probes, corresponding to each locus, were fixed on CHO-modified glass slide by covalent binding. Hybridization between target sequences and probes was performed under suitable conditions. The spotting locations on microarray and the ratio of fluorescence intensity, produced by different loci, were used to distinguish the SNP genotypes. Finally, three of gastric cancer samples were collected and genotyping analysis for these four SNP loci was carried out successfully simultaneously by this method. ß 2016 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences. Published by Elsevier B.V. All rights reserved.
Keywords: Magnetic beads Multiplex PCR Microarray Multiple genotyping Gastric cancer
1. Introduction Recently, some studies have reported strong association between genetic mutations and diseases like cancer. Single nucleotide polymorphism (SNP) is the main form of genetic mutation, and they have been linked with the occurrence and development of diseases [1–6]. A lot of researchers have devoted to study SNPs in order to find new markers for the early detection of cancer [7–10]. However, the tumor occurrence is multifactorial and usually changes allele frequency at more than one locus. Therefore, the SNPs at multiple loci should be simultaneously detected and their association with the tumor initiation or development is analyzed [11–15]. It is particularly important to build a method which can genotype multiple SNPs loci simultaneously. Because of the distinct properties, such as small size, easy separation and simple functionalization, magnetic beads have
* Corresponding author at: State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China. ** Corresponding authors. E-mail addresses: [email protected] (N.-Y. He), [email protected] (Y. Deng), [email protected] (X. Zeng).
been combined with many biochemical technologies and widely used in biomedical and biochemical fields [16–22]. Multiplex PCR is an efficient technology to amplify more than one sequence [23–28]. Many primer pairs are mixed in one tube, and amplification process is performed under the same thermal cycling conditions. It can be used to amplify different SNP loci in one tube. Glass slide can be utilized as a platform to fabricate a microarray by fixing various detection probes. It has been spread in many fields, such as drug screening, disease diagnosis, environmental protection, and modern agriculture [29–34]. Because it can rapidly and accurately analyze thousands of genes at the same time, it is used in gene expression [35,36] and mutation detection [37–39], genome polymorphism analysis [40], gene library construction [41] and hybridization sequencing [42,43]. In this report, a multiple genotyping method based on magnetic enrichment-multiplex PCR amplification and microarray technology was built up. Four SNP loci on two genes (M235T and A-6G loci on AGT gene, A1298C and C677T loci on MTHFR gene) which have association with gastric cancer risk were selected. Four pairs of primers were designed. Target sequences containing SNP loci were obtained by magnetic enrichment-multiplex PCR amplification. Meanwhile, the detection probes were fixed on CHO-modified glass slide. Then, the PCR products were transferred onto the glass
http://dx.doi.org/10.1016/j.cclet.2016.04.005 1001-8417/ß 2016 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences. Published by Elsevier B.V. All rights reserved.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
2
slide and captured by the probes. After several washing steps, the microarray was scanned by CapitalBio (China) and fluorescence intensity was measured. Genotypes of SNP loci were identified by the locations and the ratio of fluorescence intensity on microarray.
for 5 min. Multiplex PCR was performed in one tube. Four pairs of primers were designed to get target sequences of different length. It was purposed to distinguish these amplified sequences clearly on the agarose gel electrophoresis.
2. Experiment
2.4. Probes fixation onto glass slide
2.1. Materials and samples preparation
Printing solution contained 10–30 mmol/L probe was prepared by 50% dimethyl sulfoxide (DMSO) and printed onto CHO-modified glass slide at specified location. Four mutant probes were printed in one strip on left side of slide, and another four wild probes were printed on right side. The sketch of probes distribution was shown in Fig. 1. Then, the glass slide was placed in wet box at 37 8C for 12 h to ensure that the probes were fixed onto the slide. 0.2% sodium dodecyl sulfonate (SDS) was used as washing solution to wash glass slide several times after fixation. Then, the slide was soaked for 5 min into a solution which comprised of 0.1 mol/L of phosphate buffer saline (PBS), 25% of ethanol and 0.1%–0.3% of NaBH4. Finally, the glass slide was washed by ddH2O and blowdried by high-pure N2.
Gastric cancer samples were obtained from Shanghai Jiaotong University (Shanghai). All the oligonucleotides including PCR primers and allele-specific probes used in this experiment were synthesized and HPLC purified by Sangon Biotech (Shanghai) Co., Ltd. (China) (Table 1). TaqDNA polymerase and other polymerase chain reaction (PCR) reagents were obtained from TaKaRa (China). Streptavidin was ordered from Sangon Biotech (Shanghai) Co., Ltd. (China). Other unnamed reagents were domestic analytical grade reagents. CHO-modified glass slide was purchased from CapitalBio (China). DNA was extracted by Automatic Extractor System designed by our group. Magnetic beads were fabricated in our group and characterized with scanning electron microscope (SEM) (Hitachi, Japan). Magnetic enrichment and PCR amplification were performed on Veriti 96 Well Thermal Cycler (Applied Biosystems, USA). Hybridization process was carried out in an incubator (designed by our group). The fluorescence intensity on glass slide was measured by LuxScan-10K/A (CapitalBio, China). 2.2. Fabrication and modification of monodisperse magnetic beads
2.5. Microarray fabrication based on hybridization Multiplex PCR products were denatured at 95 8C for 5 min and immediately cooled down in ice-bath. Hybridization mixture was made up of equal volume of denatured multiplex PCR products and 2 Hybridization Buffer. A balanced amount of mixture, according to the reaction area, was added dropwise onto the glass slide which was placed in a wet box. Coverslip was used to blanket probes
Magnetic beads were fabricated as previously reported with slight change [44–47]. Tetraethoxysilane (TEOS) was used to coat a SiO2 layer on the surface of magnetic beads to protect being oxidated fast. MB@SiO2 was further functionalized with –NH2 and –CHO groups by 3-Aminopropyltriethoxysilane (APTES) and glutaraldehyde solution before streptavidin modification. Then, specific probe was fixed onto the surface of MB@SiO2 to fabricate MB@SiO2@probe beads. 2.3. Templates enrichment and multiplex PCR amplification
Fig. 1. The sketch of probes distribution on glass slide. Mutant probes were fixed onto the left side and wild probes were fixed onto the right side twice. From up to down, C: C677T, M: M235T, A: A1298C and G: A-6G.
Templates and MB@SiO2@probe beads were mixed and incubated for 30 min under suitable temperature to ensure that most of templates were enriched onto the surface of MB@SiO2@p robe beads. PCR buffer solution was utilized to obtain ssDNA of templates from the surface of MB@SiO2@probe beads under 95 8C Table 1 Primers and probes used in the experiment.
C677T
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
Sequence (5′′–3′′) GGAAGGTGCAAGATCAGAGC Cy3-AGGACGGTGCGGTGAGAGT NH2-(t)10-atgaaatcggctcccgcag NH2-(t)10-atgaaatcgactcccgcag
A1298C
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
TTTGGGGAGCTGAAGGACTA Cy3-ACAGGATGGGGAAGTCACAG NH2-(t)10-aaagacactttcttcactggt NH2-(t)10-aaagacacttgcttcactggt
M235T
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
CCACGCTCTCTGGACTTCA Cy3-CACTTCCCCACTTCTCAAGGG NH2-(t)10-tggctcccatcagggag NH2-(t)10-tggctcccgtcagggag
A-6G
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
AAGAGGTCCCAGCGTGAGT Cy3-CAAGACCAGAAGGAGCTGAGG NH2-(t)10-tcttcccccggccgggt NH2-(t)10-tcttcccctggccgggt
Name
Fig. 2. SEM of magnetic beads. (A) Naked magnetic beads; (B) magnetic beads with silica coating.
Fig. 3. Multiplex PCR amplification for three of gastric cancer samples after adjusting the ratio of primers.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
3
fixation region and the box was incubated in temperature controlled environment for 40 min. The coverslip was discarded and the slide was transferred into washing solution I (0.3 SSC, 0.1% SDS) and washing solution II (0.06 SSC) to wash for 2 min respectively after incubation. Finally, the glass slide was dried by high-pure N2 and scanned by LuxScan-10K/A to obtain the result of fluorescence intensity. 3. Results and discussion 3.1. Monodisperse magnetic beads fabrication and modification Magnetic beads were approximately spherical and the diameter of most particles distributed in 300–400 nm. The surface of naked magnetic beads was rough (Fig. 2A). After coating with SiO2, magnetic beads (MB@SiO2) become much smoother and the dispersion was better than before (Fig. 2B). Previous studies [48–55] showed that magnetic beads with silica coating were more suitable than naked magnetic beads for fixing probe. Thus, MB@SiO2 particles were further functionalized by –NH2 and –CHO groups for the following experiment.
Fig. 5. Fluorescence intensity of different hybridization temperature. Maximum fluorescence intensity was recorded at 56 8C for both the wild and mutant probes.
primer pair’s ratio for the four C677T:M235T:A1298C: A-6G was 1:0.7:1:1.5. The result was shown in Fig. 3 and each of them was two repeats. 3.3. Microarray fabrication and genotyping
3.2. Multiplex PCR amplification for target sequences preparation Three of gastric cancer samples were collected and the target sequences were amplified successfully. The four loci C677T, M235T, A1298C and A-6G were amplified in multiplex PCR producing four bands of 375 bp, 293 bp, 265 bp and 235 bp lengths, respectively. All the four loci were amplified with equal efficiency after adjusting the primer’s amount. The optimized
According to our experience in previous studies, when the ratio of fluorescence intensity of wild-probe/mutant-probe was 3, the genotype of this locus/sample was identified as wild type. And when the ratio of wild-probe/mutant-probe was 0.35, the genotype of this locus/sample was identified as mutant type. While the genotype of this locus/sample was identified as heterozygote if the value of wild-probe/mutant-probe was
Fig. 4. Optimization of hybridization temperature. The hybridization temperature in (a)–(f) was 50 8C, 53 8C, 56 8C, 58 8C, 60 8C and 62 8C, respectively.
Fig. 6. The genotyping results of three gastric cancer samples. The left figures were obtained from scanning by LuxScan-10K/A (CapitalBio, China), and the right figures were the histograms, showing the fluorescence intensity and wild-probe/mutant-probe ratios of corresponding SNP loci.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 4
X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
between 0.8 and 1.2. Arise of situations other than specified above were considered as genotyping failure. Complementary pairing between probe, fixed on glass slide, and multiplex PCR products was occurred in hybridization buffer. The hybridization temperature was optimized in order to ensure high specificity, and the results were shown in Figs. 4 and 5. The hybridization temperature in Fig. 4a–f was 50 8C, 53 8C, 56 8C, 58 8C, 60 8C and 62 8C, respectively. The four loci produced fluorescence signal of the same because the sample under study was heterozygous for all these loci. M235T locus was chosen, as representative, to analyze the effect of hybridization temperature on genotyping. The result was exhibited as histogram in Fig. 5. Maximum fluorescence intensity was recorded at 56 8C for both the wild and mutant probes. It was chosen as the optimal temperature of hybridization in following experiment. After the optimization of multiplex PCR amplification and hybridization conditions, three gastric cancer samples were selected and genotyped using this method. The genotyping results of these samples were exhibited in Fig. 6. The figures of first line were obtained from scanning by LuxScan-10K/A (CapitalBio, China), and the figures of second line were the histograms, showing the fluorescence intensity and wild-probe/mutant-probe ratios of corresponding SNP loci. Genotypes were recognized by spotting the locations on microarray/glass slide and fluorescence ratios. These three gastric cancer samples were genotyped differently on the basis of these four loci. Sample 1 was genotyped as mutant type for SNP locus on C677T gene while the samples 2 and 3 were heterozygous for the same locus. Samples 1 and 3 were identified as wild type for both the loci on M235T gene and A-6G gene while sample 2 was heterozygous for the locus on M235T gene and mutant type for the locus on A-6G gene. All the three samples showed different genotypes for the locus on A1298C gene: sample 1 was genotypes as heterozygous, sample 2 was genotyped as wild type and sample 3 was mutant type for this locus. 4. Conclusion In this report, we have described a multiple genotyping method which is based on multiplex PCR amplification and microarray technology and optimized the experimental conditions. Genotypes can be recognized by the specified locations on the glass slide and fluorescence ratios. The three gastric cancer samples were genotyped for four SNP loci successfully using this method. However this method has the potential to be used for highthroughput SNPs genotyping. Acknowledgments This research was financially supported by the National Key Program for Developing Basic Research (No. 2010CB933903), the Chinese National Key Project of Science and Technology (No. 2013ZX10004103-002), the National Youth Science Foundation of China (No. 61301043), the NSFC (Nos. 61271056, 61471168, 61201100 and 61527806), and the Economical Forest Cultivation and Utilization of 2011 Collaborative Innovation Center in Hunan Province [No. (2013) 448]. References [1] K.L. Gunderson, F.J. Steemers, G. Lee, L.G. Mendoza, M.S. Chee, A genome-wide scalable SNP genotyping assay using microarray technology, Nat. Genet. 37 (2005) 549–554. [2] H. Sakamoto, K. Yoshimura, N. Saeki, et al., Genetic variation in PSCA is associated with susceptibility to diffuse-type gastric cancer, Nat. Genet. 40 (2008) 730–740. [3] Z.B. Hu, J. Liang, Z.W. Wang, et al., Common genetic variants in pre-microRNAs were associated with increased risk of breast cancer in Chinese women, Hum. Mutat. 30 (2009) 79–84.
[4] K.P. Madeira, R.D. Daltoe´, G.M. Sirtoli, et al., Estrogen receptor alpha (ERS1) SNPs c454-397T>C (PvuII) and c454-351A>G (XbaI) are risk biomarkers for breast cancer development, Mol. Biol. Rep. 41 (2014) 5459–5466. [5] X.G. Sun, K.M. Kaltenbronn, T.H. Steinberg, K.J. Blumer, RGS2 is a mediator of nitric oxide action on blood pressure and vasoconstrictor signaling, Mol. Pharmacol. 67 (2005) 631–639. [6] F. Kamangar, C.C. Abnet, A.A. Hutchinson, et al., Polymorphisms in inflammationrelated genes and risk of gastric cancer (Finland), Cancer Cause Control 17 (2006) 117–125. [7] Y.Y. Shi, Z.B. Hu, C. Wu, et al., A genome-wide association study identifies new susceptibility loci for non-cardia gastric cancer at 3q13.31 and 5p13.1, Nat. Genet. 43 (2011) 1215–1219. [8] R. Kogo, K. Mimori, F. Tanaka, S. Komune, M. Mori, Clinical significance of miR146a in gastric cancer cases, Clin. Cancer Res. 17 (2011) 4277–4284. [9] S. Li, H.N. Liu, Y.Y. Jia, et al., A novel SNPs detection method based on gold magnetic nanoparticles array and single base extension, Theranostics 2 (2012) 967–975. [10] S. Elingarami, Y. Deng, J. Fan, Y.Y. Zhang, N.Y. He, NEIL-2 single nucleotide polymorphism genotyping using single base extension on core–shell Fe3O4@SiO2@Au magnetic nanoparticles and association of the genotypes with gastric cancer risk in northern Jiangsu (China), Sci. Adv. Mater. 6 (2014) 899–907. [11] J.B. Long, Y.X. Liu, Q.F. Cao, et al., Sensitive and enzyme-free detection for single nucleotide polymorphism using microbead-assisted toehold-mediated strand displacement reaction, Chin. Chem. Lett. 26 (2015) 1031–1035. [12] E. De Feo, R. Persiani, A. La Greca, et al., A case–control study on the effect of p53 and p73 gene polymorphisms on gastric cancer risk and progression, Mutat. Res. 675 (2009) 60–65. [13] X.Q. Wu, Z.R. Zeng, B. Chen, et al., Association between polymorphisms in interleukin-17A and interleukin-17F genes and risks of gastric cancer, Int. J. Cancer 127 (2010) 86–92. [14] Y.Y. Zhang, Y.Y. Jia, S. Li, et al., Genotyping of 765G>C in COX-2 gene based on MNPs and dual-color fluorescence hybridization and its association with risk of gastric cancer in Northern Jiangsu of China, Sci. Adv. Mater. 6 (2014) 1146–1153. [15] X.B. Mou, T.T. Li, J.H. Wang, et al., Genetic variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) genes and their correlation to gastric cancer risk based on universal tagged arrays and Fe3O4 magnetic nanoparticles, J. Biomed. Nanotechnol. 11 (2015) 2057–2066. [16] X.L. Wang, L. Wei, G.H. Tao, M.Q. Huang, Synthesis and characterization of magnetic and luminescent Fe3O4/CdTe nanocomposites using aspartic acid as linker, Chin. Chem. Lett. 22 (2011) 233–236. [17] J.N. Zheng, Z. Lin, L. Zhang, H.H. Yang, Polydopamine-mediated immobilization of phenylboronic acid on magnetic microspheres for selective enrichment of glycoproteins and glycopeptides, Sci. China Chem. 58 (2015) 1056–1064. [18] H. Zhang, F. Huang, D.L. Liu, P. Shi, Highly efficient removal of Cr(VI) from wastewater via adsorption with novel magnetic Fe3O4@C@MgAl-layered double-hydroxide, Chin. Chem. Lett. 26 (2015) 1137–1143. [19] J.H. Wang, Z. Ali, N.Y. Wang, et al., Simultaneous extraction of DNA and RNA from Escherichia coli BL 21 based on silica-coated magnetic nanoparticles, Sci. China Chem. 58 (2015) 1774–1778. [20] Y.G. Sun, T.T. Truong, Y.Z. Liu, Y.X. Hu, Encapsulation of superparamagnetic Fe3O4@SiO2 core/shell nanoparticles in MnO2 microflowers with high surface areas, Chin. Chem. Lett. 26 (2015) 233–237. [21] L.W. Lu, X.Y. Wang, C.X. Xiong, L. Yao, Recent advances in biological detection with magnetic nanoparticles as a useful tool, Sci. China Chem. 58 (2015) 793–809. [22] M. Mirabedini, E. Motamedi, M.Z. Kassaee, Magnetic CuO nanoparticles supported on graphene oxide as an efficient catalyst for A3-coupling synthesis of propargylamines, Chin. Chem. Lett. 26 (2015) 1085–1090. [23] D.C. Oliveira, H. de Lencastre, Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus, Antimicrob. Agents Chemother. 4 (2002) 2155–2161. [24] F.J. Pe´rez-Pe´rez, N.D. Hanson, Detection of plasmid-mediated AmpC-lactamase genes in clinical isolates by using multiplex PCR, J. Clin. Microbiol. 40 (2002) 2153–2162. [25] L. Poirela, T.R. Walshb, V. Cuvilliera, P. Nordmann, Multiplex PCR for detection of acquired carbapenemase genes, Diagn. Microbiol. Infect. Dis. 70 (2011) 119–123. [26] C. Fitting, M. Parlato, M. Adib-Conquy, et al., DNAemia detection by multiplex PCR and biomarkers for infection in systemic inflammatory response syndrome patients, PLoS ONE 7 (2012) e38916. [27] M.A. Poritz, A.J. Blaschke, C.L. Byington, et al., Film Array, an automated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection, PLoS ONE 6 (2011) e26047. [28] C.S. Carlson, R.O. Emerson, A.M. Sherwood, et al., Using synthetic templates to design an unbiased multiplex PCR assay, Nat. Commun. 4 (2013) 2680. [29] L.P. Lim, N.C. Lau, P. Garrett-Engele, et al., Microarray analysis shows that some microRNAs down regulate large numbers of target mRNAs, Nature 433 (2005) 769–773. [30] S. Wei, C.L. Brooks III, Stability and orientation of cecropin P1 on maleimide selfassembled monolayer (SAM) surfaces and suggested functional mutations, Chin. Chem. Lett. 26 (2015) 485–490. [31] M.P.S. Brown, W.N. Grundy, D. Lin, et al., Knowledge-based analysis of microarray gene expression data by using support vector machines, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 262–267. [32] C. Wang, H. Zhang, L. Tian, et al., Ultrasensitive detection of aliphatic nitroorganics based on ‘‘turn-on’’ fluorescent sensor array, Sci. China Chem. 59 (2016) 89–94.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx [33] J.G. Sun, S.V. Graeter, J. Tang, et al., Preparation of stable micropatterns of gold on cell-adhesion-resistant hydrogels assisted by a hetero-bifunctional macromonomer linker, Sci. China Chem. 57 (2014) 645–653. [34] S. Dudoit, Y.H. Yang, M.J. Callow, T.P. Speed, Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments, Stat. Sinica 12 (2002) 111–139. [35] M. Schena, D. Shalon, R.W. Davis, P.O. Brown, Quantitative monitoring of gene expression patterns with a complementary DNA microarray, Science 270 (1995) 467–470. [36] J.S. Reis-Filho, L. Pusztai, Gene expression profiling in breast cancer: classification, prognostication, and prediction, Lancet 378 (2011) 1812–1823. [37] R. Moure, M. Espan˜o, G. Tudo´, et al., Characterization of the embB gene in Mycobacterium tuberculosis isolates from Barcelona and rapid detection of main mutations related to ethambutol resistance using a low-density DNA array, J. Antimicrob. Chemother. 69 (2014) 947–954. [38] K.L. Sund, S.L. Zimmerman, C. Thomas, et al., Regions of homozygosity identified by SNP microarray analysis aid in the diagnosis of autosomal recessive disease and incidentally detect parental blood relationships, Genet. Med. 15 (2013) 70–78. [39] W.Q. Liu, R. Zhang, J. Wei, et al., Rapid diagnosis of imprinting disorders involving copy number variation and uniparental disomy using genome-wide SNP microarrays, Cytogenet. Genome Res. 146 (2015) 9–18. [40] C.L. Ronchi, E. Leich, S. Sbiera, et al., Single nucleotide polymorphism microarray analysis in cortisol-secreting adrenocortical adenomas identifies new candidate genes and pathways, Neoplasia 14 (2012) 206–218. [41] C. Trapnell, D.G. Hendrickson, M. Sauvageau, et al., Differential analysis of gene regulation at transcript resolution with RNA-seq, Nat. Biotechnol. 31 (2013) 46–53. [42] J.H. Malone, B. Oliver, Microarrays, deep sequencing and the true measure of the transcriptome, BMC Biol. 9 (2011) 34. [43] M.E. Ritchie, B. Phipson, D. Wu, et al., Limma powers differential expression analyses for RNA-sequencing and microarray studies, Nucleic Acids Res. 43 (2015) e47. [44] Y.J. Tang, Z.Y. Li, N.Y. He, et al., Preparation of functional magnetic nanoparticles mediated with PEG-4000 and application in Pseudomonas aeruginosa rapid detection, J. Biomed. Nanotechnol. 9 (2013) 312–317.
5
[45] H.R. Jiang, X. Zeng, N.Y. He, et al., Preparation and biomedical applications of goldcoated magnetic nanocomposites, J. Nanosci. Nanotechnol. 13 (2013) 1617–1625. [46] H.R. Jiang, X. Zeng, Z.J. Xi, et al., Improvement on controllable fabrication of streptavidin-modified three-layer core-shell Fe3O4@SiO2@Au magnetic nanocomposites with low fluorescence background, J. Biomed. Nanotechnol. 9 (2013) 674–684. [47] M. Liu, P. Hu, G. Zhang, et al., Copy number variation analysis by ligationdependent PCR based on magnetic nanoparticles and chemiluminescence, Theranostics 5 (2015) 71–85. [48] Z.F. Wang, P.F. Xiao, B. Shen, N.Y. He, Synthesis of palladium-coated magnetic nanoparticle and its application in Heck reaction, Colloids Surf. A: Physicochem. Eng. Aspects 276 (2006) 116–121. [49] S. Li, H.N. Liu, L.S. Liu, L. Tian, N.Y. He, A novel automated assay with dual-color hybridization for single-nucleotide polymorphisms genotyping on gold magnetic nanoparticle array, Anal. Biochem. 405 (2010) 141–143. [50] C.Y. Li, C. Ma, F. Wang, et al., Preparation and biomedical applications of core–shell silica/magnetic nanoparticle composites, J. Nanosci. Nanotechnol. 12 (2012) 2964–2972. [51] H.W. Yang, Z.Y. Li, Q.Y. Jia, et al., Ultrasensitive detection and subtyping of porcine endogenous retrovirus provirus based on magnetic nanoparticles and chemiluminescence, J. Nanosci. Nanotechnol. 15 (2015) 5597–5604. [52] S. Li, H.N. Liu, Y.Y. Jia, et al., An automatic high-throughput Single Nucleotide Polymorphism genotyping approach based on universal tagged arrays and magnetic nanoparticles, J. Biomed. Nanotechnol. 9 (2013) 689–698. [53] Y.Y. Zhang, H.N. Liu, Y.Y. Jia, et al., A magnetic nanoparticles-based combination detection of COX-2 and BCL-2 polymorphisms associated with gastric cancer susceptibility, Sci. Adv. Mater. 7 (2015) 532–539. [54] H.N. Liu, S. Li, L.S. Liu, L. Tian, N.Y. He, An integrated and sensitive detection platform for biosensing application based on Fe@Au magnetic nanoparticles as bead array carries, Biosens. Bioelectron. 26 (2010) 1442–1448. [55] S. Elingarami, H.N. Liu, A.V. Kalinjuma, et al., Polymorphisms in NEIL-2, APE-1, CYP2E1 and MDM2 genes are independent predictors of gastric cancer risk in a northern Jiangsu population (China), J. Nanosci. Nanotechnol. 15 (2015) 4815– 4828.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
CCLET-3668; No. of Pages 5 Chinese Chemical Letters xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Chinese Chemical Letters journal homepage: www.elsevier.com/locate/cclet
Original article
Multiple genotyping based on multiplex PCR and microarray Xian-Bo Mou a, Zeeshan Ali a, Bo Li a, Tao-Tao Li a, Huan Yi a, Hong-Ming Dong b, Nong-Yue He a,b,*, Yan Deng b,**, Xin Zeng c,** a
State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China Economical Forest Cultivation and Utilization of 2011 Collaborative Innovation Center in Hunan Province, Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology, Hunan University of Technology, Zhuzhou 412007, China c Nanjing Maternity and Child Health Care Hospital, Nanjing 210029, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 15 February 2016 Received in revised form 4 April 2016 Accepted 6 April 2016 Available online xxx
The genetic variability has obtained more and more attention in the process of diagnosis and treatment of tumors. Herein, we have described a multiple genotyping method based on magnetic enrichmentmultiplex PCR (MEM-PCR) and microarray technology. Monodisperse magnetic beads were fabricated and modified with streptavidin. Four loci on two genes (M235T and A-6G loci on AGT gene, A1298C and C677T loci on MTHFR gene) were selected to study single nucleotide polymorphisms (SNP). Target sequences of these SNP loci were amplified using Cy3-labeled primers through multiplex PCR in one tube after the templates were enriched and purified by functional magnetic beads (MB). Four pairs of NH2labeled probes, corresponding to each locus, were fixed on CHO-modified glass slide by covalent binding. Hybridization between target sequences and probes was performed under suitable conditions. The spotting locations on microarray and the ratio of fluorescence intensity, produced by different loci, were used to distinguish the SNP genotypes. Finally, three of gastric cancer samples were collected and genotyping analysis for these four SNP loci was carried out successfully simultaneously by this method. ß 2016 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences. Published by Elsevier B.V. All rights reserved.
Keywords: Magnetic beads Multiplex PCR Microarray Multiple genotyping Gastric cancer
1. Introduction Recently, some studies have reported strong association between genetic mutations and diseases like cancer. Single nucleotide polymorphism (SNP) is the main form of genetic mutation, and they have been linked with the occurrence and development of diseases [1–6]. A lot of researchers have devoted to study SNPs in order to find new markers for the early detection of cancer [7–10]. However, the tumor occurrence is multifactorial and usually changes allele frequency at more than one locus. Therefore, the SNPs at multiple loci should be simultaneously detected and their association with the tumor initiation or development is analyzed [11–15]. It is particularly important to build a method which can genotype multiple SNPs loci simultaneously. Because of the distinct properties, such as small size, easy separation and simple functionalization, magnetic beads have
* Corresponding author at: State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China. ** Corresponding authors. E-mail addresses: [email protected] (N.-Y. He), [email protected] (Y. Deng), [email protected] (X. Zeng).
been combined with many biochemical technologies and widely used in biomedical and biochemical fields [16–22]. Multiplex PCR is an efficient technology to amplify more than one sequence [23–28]. Many primer pairs are mixed in one tube, and amplification process is performed under the same thermal cycling conditions. It can be used to amplify different SNP loci in one tube. Glass slide can be utilized as a platform to fabricate a microarray by fixing various detection probes. It has been spread in many fields, such as drug screening, disease diagnosis, environmental protection, and modern agriculture [29–34]. Because it can rapidly and accurately analyze thousands of genes at the same time, it is used in gene expression [35,36] and mutation detection [37–39], genome polymorphism analysis [40], gene library construction [41] and hybridization sequencing [42,43]. In this report, a multiple genotyping method based on magnetic enrichment-multiplex PCR amplification and microarray technology was built up. Four SNP loci on two genes (M235T and A-6G loci on AGT gene, A1298C and C677T loci on MTHFR gene) which have association with gastric cancer risk were selected. Four pairs of primers were designed. Target sequences containing SNP loci were obtained by magnetic enrichment-multiplex PCR amplification. Meanwhile, the detection probes were fixed on CHO-modified glass slide. Then, the PCR products were transferred onto the glass
http://dx.doi.org/10.1016/j.cclet.2016.04.005 1001-8417/ß 2016 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences. Published by Elsevier B.V. All rights reserved.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
2
slide and captured by the probes. After several washing steps, the microarray was scanned by CapitalBio (China) and fluorescence intensity was measured. Genotypes of SNP loci were identified by the locations and the ratio of fluorescence intensity on microarray.
for 5 min. Multiplex PCR was performed in one tube. Four pairs of primers were designed to get target sequences of different length. It was purposed to distinguish these amplified sequences clearly on the agarose gel electrophoresis.
2. Experiment
2.4. Probes fixation onto glass slide
2.1. Materials and samples preparation
Printing solution contained 10–30 mmol/L probe was prepared by 50% dimethyl sulfoxide (DMSO) and printed onto CHO-modified glass slide at specified location. Four mutant probes were printed in one strip on left side of slide, and another four wild probes were printed on right side. The sketch of probes distribution was shown in Fig. 1. Then, the glass slide was placed in wet box at 37 8C for 12 h to ensure that the probes were fixed onto the slide. 0.2% sodium dodecyl sulfonate (SDS) was used as washing solution to wash glass slide several times after fixation. Then, the slide was soaked for 5 min into a solution which comprised of 0.1 mol/L of phosphate buffer saline (PBS), 25% of ethanol and 0.1%–0.3% of NaBH4. Finally, the glass slide was washed by ddH2O and blowdried by high-pure N2.
Gastric cancer samples were obtained from Shanghai Jiaotong University (Shanghai). All the oligonucleotides including PCR primers and allele-specific probes used in this experiment were synthesized and HPLC purified by Sangon Biotech (Shanghai) Co., Ltd. (China) (Table 1). TaqDNA polymerase and other polymerase chain reaction (PCR) reagents were obtained from TaKaRa (China). Streptavidin was ordered from Sangon Biotech (Shanghai) Co., Ltd. (China). Other unnamed reagents were domestic analytical grade reagents. CHO-modified glass slide was purchased from CapitalBio (China). DNA was extracted by Automatic Extractor System designed by our group. Magnetic beads were fabricated in our group and characterized with scanning electron microscope (SEM) (Hitachi, Japan). Magnetic enrichment and PCR amplification were performed on Veriti 96 Well Thermal Cycler (Applied Biosystems, USA). Hybridization process was carried out in an incubator (designed by our group). The fluorescence intensity on glass slide was measured by LuxScan-10K/A (CapitalBio, China). 2.2. Fabrication and modification of monodisperse magnetic beads
2.5. Microarray fabrication based on hybridization Multiplex PCR products were denatured at 95 8C for 5 min and immediately cooled down in ice-bath. Hybridization mixture was made up of equal volume of denatured multiplex PCR products and 2 Hybridization Buffer. A balanced amount of mixture, according to the reaction area, was added dropwise onto the glass slide which was placed in a wet box. Coverslip was used to blanket probes
Magnetic beads were fabricated as previously reported with slight change [44–47]. Tetraethoxysilane (TEOS) was used to coat a SiO2 layer on the surface of magnetic beads to protect being oxidated fast. MB@SiO2 was further functionalized with –NH2 and –CHO groups by 3-Aminopropyltriethoxysilane (APTES) and glutaraldehyde solution before streptavidin modification. Then, specific probe was fixed onto the surface of MB@SiO2 to fabricate MB@SiO2@probe beads. 2.3. Templates enrichment and multiplex PCR amplification
Fig. 1. The sketch of probes distribution on glass slide. Mutant probes were fixed onto the left side and wild probes were fixed onto the right side twice. From up to down, C: C677T, M: M235T, A: A1298C and G: A-6G.
Templates and MB@SiO2@probe beads were mixed and incubated for 30 min under suitable temperature to ensure that most of templates were enriched onto the surface of MB@SiO2@p robe beads. PCR buffer solution was utilized to obtain ssDNA of templates from the surface of MB@SiO2@probe beads under 95 8C Table 1 Primers and probes used in the experiment.
C677T
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
Sequence (5′′–3′′) GGAAGGTGCAAGATCAGAGC Cy3-AGGACGGTGCGGTGAGAGT NH2-(t)10-atgaaatcggctcccgcag NH2-(t)10-atgaaatcgactcccgcag
A1298C
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
TTTGGGGAGCTGAAGGACTA Cy3-ACAGGATGGGGAAGTCACAG NH2-(t)10-aaagacactttcttcactggt NH2-(t)10-aaagacacttgcttcactggt
M235T
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
CCACGCTCTCTGGACTTCA Cy3-CACTTCCCCACTTCTCAAGGG NH2-(t)10-tggctcccatcagggag NH2-(t)10-tggctcccgtcagggag
A-6G
Forward Primer Reverse Primer Wild detection probe Mutant detection probe
AAGAGGTCCCAGCGTGAGT Cy3-CAAGACCAGAAGGAGCTGAGG NH2-(t)10-tcttcccccggccgggt NH2-(t)10-tcttcccctggccgggt
Name
Fig. 2. SEM of magnetic beads. (A) Naked magnetic beads; (B) magnetic beads with silica coating.
Fig. 3. Multiplex PCR amplification for three of gastric cancer samples after adjusting the ratio of primers.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
3
fixation region and the box was incubated in temperature controlled environment for 40 min. The coverslip was discarded and the slide was transferred into washing solution I (0.3 SSC, 0.1% SDS) and washing solution II (0.06 SSC) to wash for 2 min respectively after incubation. Finally, the glass slide was dried by high-pure N2 and scanned by LuxScan-10K/A to obtain the result of fluorescence intensity. 3. Results and discussion 3.1. Monodisperse magnetic beads fabrication and modification Magnetic beads were approximately spherical and the diameter of most particles distributed in 300–400 nm. The surface of naked magnetic beads was rough (Fig. 2A). After coating with SiO2, magnetic beads (MB@SiO2) become much smoother and the dispersion was better than before (Fig. 2B). Previous studies [48–55] showed that magnetic beads with silica coating were more suitable than naked magnetic beads for fixing probe. Thus, MB@SiO2 particles were further functionalized by –NH2 and –CHO groups for the following experiment.
Fig. 5. Fluorescence intensity of different hybridization temperature. Maximum fluorescence intensity was recorded at 56 8C for both the wild and mutant probes.
primer pair’s ratio for the four C677T:M235T:A1298C: A-6G was 1:0.7:1:1.5. The result was shown in Fig. 3 and each of them was two repeats. 3.3. Microarray fabrication and genotyping
3.2. Multiplex PCR amplification for target sequences preparation Three of gastric cancer samples were collected and the target sequences were amplified successfully. The four loci C677T, M235T, A1298C and A-6G were amplified in multiplex PCR producing four bands of 375 bp, 293 bp, 265 bp and 235 bp lengths, respectively. All the four loci were amplified with equal efficiency after adjusting the primer’s amount. The optimized
According to our experience in previous studies, when the ratio of fluorescence intensity of wild-probe/mutant-probe was 3, the genotype of this locus/sample was identified as wild type. And when the ratio of wild-probe/mutant-probe was 0.35, the genotype of this locus/sample was identified as mutant type. While the genotype of this locus/sample was identified as heterozygote if the value of wild-probe/mutant-probe was
Fig. 4. Optimization of hybridization temperature. The hybridization temperature in (a)–(f) was 50 8C, 53 8C, 56 8C, 58 8C, 60 8C and 62 8C, respectively.
Fig. 6. The genotyping results of three gastric cancer samples. The left figures were obtained from scanning by LuxScan-10K/A (CapitalBio, China), and the right figures were the histograms, showing the fluorescence intensity and wild-probe/mutant-probe ratios of corresponding SNP loci.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 4
X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx
between 0.8 and 1.2. Arise of situations other than specified above were considered as genotyping failure. Complementary pairing between probe, fixed on glass slide, and multiplex PCR products was occurred in hybridization buffer. The hybridization temperature was optimized in order to ensure high specificity, and the results were shown in Figs. 4 and 5. The hybridization temperature in Fig. 4a–f was 50 8C, 53 8C, 56 8C, 58 8C, 60 8C and 62 8C, respectively. The four loci produced fluorescence signal of the same because the sample under study was heterozygous for all these loci. M235T locus was chosen, as representative, to analyze the effect of hybridization temperature on genotyping. The result was exhibited as histogram in Fig. 5. Maximum fluorescence intensity was recorded at 56 8C for both the wild and mutant probes. It was chosen as the optimal temperature of hybridization in following experiment. After the optimization of multiplex PCR amplification and hybridization conditions, three gastric cancer samples were selected and genotyped using this method. The genotyping results of these samples were exhibited in Fig. 6. The figures of first line were obtained from scanning by LuxScan-10K/A (CapitalBio, China), and the figures of second line were the histograms, showing the fluorescence intensity and wild-probe/mutant-probe ratios of corresponding SNP loci. Genotypes were recognized by spotting the locations on microarray/glass slide and fluorescence ratios. These three gastric cancer samples were genotyped differently on the basis of these four loci. Sample 1 was genotyped as mutant type for SNP locus on C677T gene while the samples 2 and 3 were heterozygous for the same locus. Samples 1 and 3 were identified as wild type for both the loci on M235T gene and A-6G gene while sample 2 was heterozygous for the locus on M235T gene and mutant type for the locus on A-6G gene. All the three samples showed different genotypes for the locus on A1298C gene: sample 1 was genotypes as heterozygous, sample 2 was genotyped as wild type and sample 3 was mutant type for this locus. 4. Conclusion In this report, we have described a multiple genotyping method which is based on multiplex PCR amplification and microarray technology and optimized the experimental conditions. Genotypes can be recognized by the specified locations on the glass slide and fluorescence ratios. The three gastric cancer samples were genotyped for four SNP loci successfully using this method. However this method has the potential to be used for highthroughput SNPs genotyping. Acknowledgments This research was financially supported by the National Key Program for Developing Basic Research (No. 2010CB933903), the Chinese National Key Project of Science and Technology (No. 2013ZX10004103-002), the National Youth Science Foundation of China (No. 61301043), the NSFC (Nos. 61271056, 61471168, 61201100 and 61527806), and the Economical Forest Cultivation and Utilization of 2011 Collaborative Innovation Center in Hunan Province [No. (2013) 448]. References [1] K.L. Gunderson, F.J. Steemers, G. Lee, L.G. Mendoza, M.S. Chee, A genome-wide scalable SNP genotyping assay using microarray technology, Nat. Genet. 37 (2005) 549–554. [2] H. Sakamoto, K. Yoshimura, N. Saeki, et al., Genetic variation in PSCA is associated with susceptibility to diffuse-type gastric cancer, Nat. Genet. 40 (2008) 730–740. [3] Z.B. Hu, J. Liang, Z.W. Wang, et al., Common genetic variants in pre-microRNAs were associated with increased risk of breast cancer in Chinese women, Hum. Mutat. 30 (2009) 79–84.
[4] K.P. Madeira, R.D. Daltoe´, G.M. Sirtoli, et al., Estrogen receptor alpha (ERS1) SNPs c454-397T>C (PvuII) and c454-351A>G (XbaI) are risk biomarkers for breast cancer development, Mol. Biol. Rep. 41 (2014) 5459–5466. [5] X.G. Sun, K.M. Kaltenbronn, T.H. Steinberg, K.J. Blumer, RGS2 is a mediator of nitric oxide action on blood pressure and vasoconstrictor signaling, Mol. Pharmacol. 67 (2005) 631–639. [6] F. Kamangar, C.C. Abnet, A.A. Hutchinson, et al., Polymorphisms in inflammationrelated genes and risk of gastric cancer (Finland), Cancer Cause Control 17 (2006) 117–125. [7] Y.Y. Shi, Z.B. Hu, C. Wu, et al., A genome-wide association study identifies new susceptibility loci for non-cardia gastric cancer at 3q13.31 and 5p13.1, Nat. Genet. 43 (2011) 1215–1219. [8] R. Kogo, K. Mimori, F. Tanaka, S. Komune, M. Mori, Clinical significance of miR146a in gastric cancer cases, Clin. Cancer Res. 17 (2011) 4277–4284. [9] S. Li, H.N. Liu, Y.Y. Jia, et al., A novel SNPs detection method based on gold magnetic nanoparticles array and single base extension, Theranostics 2 (2012) 967–975. [10] S. Elingarami, Y. Deng, J. Fan, Y.Y. Zhang, N.Y. He, NEIL-2 single nucleotide polymorphism genotyping using single base extension on core–shell Fe3O4@SiO2@Au magnetic nanoparticles and association of the genotypes with gastric cancer risk in northern Jiangsu (China), Sci. Adv. Mater. 6 (2014) 899–907. [11] J.B. Long, Y.X. Liu, Q.F. Cao, et al., Sensitive and enzyme-free detection for single nucleotide polymorphism using microbead-assisted toehold-mediated strand displacement reaction, Chin. Chem. Lett. 26 (2015) 1031–1035. [12] E. De Feo, R. Persiani, A. La Greca, et al., A case–control study on the effect of p53 and p73 gene polymorphisms on gastric cancer risk and progression, Mutat. Res. 675 (2009) 60–65. [13] X.Q. Wu, Z.R. Zeng, B. Chen, et al., Association between polymorphisms in interleukin-17A and interleukin-17F genes and risks of gastric cancer, Int. J. Cancer 127 (2010) 86–92. [14] Y.Y. Zhang, Y.Y. Jia, S. Li, et al., Genotyping of 765G>C in COX-2 gene based on MNPs and dual-color fluorescence hybridization and its association with risk of gastric cancer in Northern Jiangsu of China, Sci. Adv. Mater. 6 (2014) 1146–1153. [15] X.B. Mou, T.T. Li, J.H. Wang, et al., Genetic variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) genes and their correlation to gastric cancer risk based on universal tagged arrays and Fe3O4 magnetic nanoparticles, J. Biomed. Nanotechnol. 11 (2015) 2057–2066. [16] X.L. Wang, L. Wei, G.H. Tao, M.Q. Huang, Synthesis and characterization of magnetic and luminescent Fe3O4/CdTe nanocomposites using aspartic acid as linker, Chin. Chem. Lett. 22 (2011) 233–236. [17] J.N. Zheng, Z. Lin, L. Zhang, H.H. Yang, Polydopamine-mediated immobilization of phenylboronic acid on magnetic microspheres for selective enrichment of glycoproteins and glycopeptides, Sci. China Chem. 58 (2015) 1056–1064. [18] H. Zhang, F. Huang, D.L. Liu, P. Shi, Highly efficient removal of Cr(VI) from wastewater via adsorption with novel magnetic Fe3O4@C@MgAl-layered double-hydroxide, Chin. Chem. Lett. 26 (2015) 1137–1143. [19] J.H. Wang, Z. Ali, N.Y. Wang, et al., Simultaneous extraction of DNA and RNA from Escherichia coli BL 21 based on silica-coated magnetic nanoparticles, Sci. China Chem. 58 (2015) 1774–1778. [20] Y.G. Sun, T.T. Truong, Y.Z. Liu, Y.X. Hu, Encapsulation of superparamagnetic Fe3O4@SiO2 core/shell nanoparticles in MnO2 microflowers with high surface areas, Chin. Chem. Lett. 26 (2015) 233–237. [21] L.W. Lu, X.Y. Wang, C.X. Xiong, L. Yao, Recent advances in biological detection with magnetic nanoparticles as a useful tool, Sci. China Chem. 58 (2015) 793–809. [22] M. Mirabedini, E. Motamedi, M.Z. Kassaee, Magnetic CuO nanoparticles supported on graphene oxide as an efficient catalyst for A3-coupling synthesis of propargylamines, Chin. Chem. Lett. 26 (2015) 1085–1090. [23] D.C. Oliveira, H. de Lencastre, Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus, Antimicrob. Agents Chemother. 4 (2002) 2155–2161. [24] F.J. Pe´rez-Pe´rez, N.D. Hanson, Detection of plasmid-mediated AmpC-lactamase genes in clinical isolates by using multiplex PCR, J. Clin. Microbiol. 40 (2002) 2153–2162. [25] L. Poirela, T.R. Walshb, V. Cuvilliera, P. Nordmann, Multiplex PCR for detection of acquired carbapenemase genes, Diagn. Microbiol. Infect. Dis. 70 (2011) 119–123. [26] C. Fitting, M. Parlato, M. Adib-Conquy, et al., DNAemia detection by multiplex PCR and biomarkers for infection in systemic inflammatory response syndrome patients, PLoS ONE 7 (2012) e38916. [27] M.A. Poritz, A.J. Blaschke, C.L. Byington, et al., Film Array, an automated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection, PLoS ONE 6 (2011) e26047. [28] C.S. Carlson, R.O. Emerson, A.M. Sherwood, et al., Using synthetic templates to design an unbiased multiplex PCR assay, Nat. Commun. 4 (2013) 2680. [29] L.P. Lim, N.C. Lau, P. Garrett-Engele, et al., Microarray analysis shows that some microRNAs down regulate large numbers of target mRNAs, Nature 433 (2005) 769–773. [30] S. Wei, C.L. Brooks III, Stability and orientation of cecropin P1 on maleimide selfassembled monolayer (SAM) surfaces and suggested functional mutations, Chin. Chem. Lett. 26 (2015) 485–490. [31] M.P.S. Brown, W.N. Grundy, D. Lin, et al., Knowledge-based analysis of microarray gene expression data by using support vector machines, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 262–267. [32] C. Wang, H. Zhang, L. Tian, et al., Ultrasensitive detection of aliphatic nitroorganics based on ‘‘turn-on’’ fluorescent sensor array, Sci. China Chem. 59 (2016) 89–94.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005
G Model
CCLET-3668; No. of Pages 5 X.-B. Mou et al. / Chinese Chemical Letters xxx (2016) xxx–xxx [33] J.G. Sun, S.V. Graeter, J. Tang, et al., Preparation of stable micropatterns of gold on cell-adhesion-resistant hydrogels assisted by a hetero-bifunctional macromonomer linker, Sci. China Chem. 57 (2014) 645–653. [34] S. Dudoit, Y.H. Yang, M.J. Callow, T.P. Speed, Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments, Stat. Sinica 12 (2002) 111–139. [35] M. Schena, D. Shalon, R.W. Davis, P.O. Brown, Quantitative monitoring of gene expression patterns with a complementary DNA microarray, Science 270 (1995) 467–470. [36] J.S. Reis-Filho, L. Pusztai, Gene expression profiling in breast cancer: classification, prognostication, and prediction, Lancet 378 (2011) 1812–1823. [37] R. Moure, M. Espan˜o, G. Tudo´, et al., Characterization of the embB gene in Mycobacterium tuberculosis isolates from Barcelona and rapid detection of main mutations related to ethambutol resistance using a low-density DNA array, J. Antimicrob. Chemother. 69 (2014) 947–954. [38] K.L. Sund, S.L. Zimmerman, C. Thomas, et al., Regions of homozygosity identified by SNP microarray analysis aid in the diagnosis of autosomal recessive disease and incidentally detect parental blood relationships, Genet. Med. 15 (2013) 70–78. [39] W.Q. Liu, R. Zhang, J. Wei, et al., Rapid diagnosis of imprinting disorders involving copy number variation and uniparental disomy using genome-wide SNP microarrays, Cytogenet. Genome Res. 146 (2015) 9–18. [40] C.L. Ronchi, E. Leich, S. Sbiera, et al., Single nucleotide polymorphism microarray analysis in cortisol-secreting adrenocortical adenomas identifies new candidate genes and pathways, Neoplasia 14 (2012) 206–218. [41] C. Trapnell, D.G. Hendrickson, M. Sauvageau, et al., Differential analysis of gene regulation at transcript resolution with RNA-seq, Nat. Biotechnol. 31 (2013) 46–53. [42] J.H. Malone, B. Oliver, Microarrays, deep sequencing and the true measure of the transcriptome, BMC Biol. 9 (2011) 34. [43] M.E. Ritchie, B. Phipson, D. Wu, et al., Limma powers differential expression analyses for RNA-sequencing and microarray studies, Nucleic Acids Res. 43 (2015) e47. [44] Y.J. Tang, Z.Y. Li, N.Y. He, et al., Preparation of functional magnetic nanoparticles mediated with PEG-4000 and application in Pseudomonas aeruginosa rapid detection, J. Biomed. Nanotechnol. 9 (2013) 312–317.
5
[45] H.R. Jiang, X. Zeng, N.Y. He, et al., Preparation and biomedical applications of goldcoated magnetic nanocomposites, J. Nanosci. Nanotechnol. 13 (2013) 1617–1625. [46] H.R. Jiang, X. Zeng, Z.J. Xi, et al., Improvement on controllable fabrication of streptavidin-modified three-layer core-shell Fe3O4@SiO2@Au magnetic nanocomposites with low fluorescence background, J. Biomed. Nanotechnol. 9 (2013) 674–684. [47] M. Liu, P. Hu, G. Zhang, et al., Copy number variation analysis by ligationdependent PCR based on magnetic nanoparticles and chemiluminescence, Theranostics 5 (2015) 71–85. [48] Z.F. Wang, P.F. Xiao, B. Shen, N.Y. He, Synthesis of palladium-coated magnetic nanoparticle and its application in Heck reaction, Colloids Surf. A: Physicochem. Eng. Aspects 276 (2006) 116–121. [49] S. Li, H.N. Liu, L.S. Liu, L. Tian, N.Y. He, A novel automated assay with dual-color hybridization for single-nucleotide polymorphisms genotyping on gold magnetic nanoparticle array, Anal. Biochem. 405 (2010) 141–143. [50] C.Y. Li, C. Ma, F. Wang, et al., Preparation and biomedical applications of core–shell silica/magnetic nanoparticle composites, J. Nanosci. Nanotechnol. 12 (2012) 2964–2972. [51] H.W. Yang, Z.Y. Li, Q.Y. Jia, et al., Ultrasensitive detection and subtyping of porcine endogenous retrovirus provirus based on magnetic nanoparticles and chemiluminescence, J. Nanosci. Nanotechnol. 15 (2015) 5597–5604. [52] S. Li, H.N. Liu, Y.Y. Jia, et al., An automatic high-throughput Single Nucleotide Polymorphism genotyping approach based on universal tagged arrays and magnetic nanoparticles, J. Biomed. Nanotechnol. 9 (2013) 689–698. [53] Y.Y. Zhang, H.N. Liu, Y.Y. Jia, et al., A magnetic nanoparticles-based combination detection of COX-2 and BCL-2 polymorphisms associated with gastric cancer susceptibility, Sci. Adv. Mater. 7 (2015) 532–539. [54] H.N. Liu, S. Li, L.S. Liu, L. Tian, N.Y. He, An integrated and sensitive detection platform for biosensing application based on Fe@Au magnetic nanoparticles as bead array carries, Biosens. Bioelectron. 26 (2010) 1442–1448. [55] S. Elingarami, H.N. Liu, A.V. Kalinjuma, et al., Polymorphisms in NEIL-2, APE-1, CYP2E1 and MDM2 genes are independent predictors of gastric cancer risk in a northern Jiangsu population (China), J. Nanosci. Nanotechnol. 15 (2015) 4815– 4828.
Please cite this article in press as: X.-B. Mou, et al., Multiple genotyping based on multiplex PCR and microarray, Chin. Chem. Lett. (2016), http://dx.doi.org/10.1016/j.cclet.2016.04.005