Detection and identification of Vibrio parahaemolyticus by multiplex PCR and DNA–DNA hybridization on a microarray

Available online at www.sciencedirect.com

Journal of Genetics and Genomics 38 (2011) 129e135 www.jgenetgenomics.org

Detection and identification of Vibrio parahaemolyticus by multiplex PCR and DNAeDNA hybridization on a microarray Rongzhi Wang a, Jiadong Huang b, Wei Zhang a, Guangmei Lin a, Junwei Lian a, Libin Jiang a, Hongcong Lin a, Songfa Wang a, Shihua Wang a,* a

The Ministry of Education Key Laboratory of Biopesticide and Chemical Biology, College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China b College of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022, China Received 26 September 2010; revised 21 December 2010; accepted 30 December 2010

Abstract In this paper, we developed a rapid and accurate method for the detection of Vibrio parahaemolyticus strains, using multiplex PCR and DNAeDNA hybridization. Multiplex PCR was used to simultaneously amplify three diagnostic genes (tlh, tdh and fla) that serve as molecular markers of V. parahaemolyticus. Biotinylated PCR products were hybridized to primers immobilized on a microarray, and detected by chemiluminesce with avidineconjugated alkaline phosphatase. With this method, forty-five samples were tested. Eight known virulent strains (tlhþ/tdhþ/flaþ) and four known avirulent strains (tlhþ/tdh/flaþ) of the V. parahaemolyticus were successfully detected, and no non-specific hybridization and cross-hybridization reaction were found from fifteen closely-related strains (tlh/tdh/flaþ) of the Vibrio spp. In addition, all the other eighteen strains of non-Vibrio bacteria (tlh/tdh/fla) gave negative results. The DNA microarray successfully distinguished V. parahaemolyticus from other Vibrio spp. The results demonstrated that this was an efficient and robust method for identifying virulent strains of V. parahaemolyticus. Keywords: Vibrio parahaemolyticus; Multiplex PCR; Hybridization; Gene microarray

1. Introduction Vibrio parahaemolyticus, a kind of Gram-negative motile bacteria inhabiting marine and estuarine environments throughout the world (Vora et al., 2005), is a major food-borne pathogen that causes diarrhea primarily through the consumption of raw or undercooked seafood (Bresee et al., 2002; Kawatsu et al., 2006). In the coastal provinces of eastern China, a total of 802 outbreaks of food-borne disease were reported in 13 provinces and caused a reported 17 462 persons to become ill. V. parahaemolyticus (40.1%) accounted for the largest number of outbreaks and cases (Liu et al., 2003; Chao et al., 2010), and no effective therapy was found other than antibiotics (Mao et al., 2007). In Korea, V. parahaemolyticus is one of the leading

* Corresponding author. Tel/fax: þ86 591 8789 84471. E-mail address: [email protected] (S. Wang).

causes of food-borne diseases, caused 17 outbreaks in 2005, and 26 outbreaks in 2006 according to data collected from the Korea Food and Drug Administration (KFDA, 2006). In addition to food-borne pathogenesis, V. parahaemolyticus infection can occur through open wounds. In 2005, the Center for Disease Control and Prevention’s (CDC, USA) emerging infections program reported that two out of three cases of wound infections caused by V. parahaemolyticus resulted in death (CDC, 2005). In Europe, the epidemiology of V. parahaemolyticus-related diseases changed significantly when a large number of cases associated with V. parahaemolyticus were reported in Galicia Spain in 1999 and 2000 (Martinez-Urtaza et al., 2008). Given the harmful effects and prevalence of V. parahaemolyticus pathogenesis, development of fast and efficient diagnostic methods is quite important for rapidly detecting and discriminating the pathogenic species from other Vibrio spp. It is known that V. parahaemolyticus has two major species markers: tlh, which encodes thermolabile hemolysin (TLH) (Li

1673-8527/$ - see front matter Copyright Ó 2011, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Limited and Science Press. All rights reserved. doi:10.1016/j.jgg.2011.02.002

130

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135

and Nie, 2003; Myers et al., 2003; Izutsu et al., 2008); and tdh, which encodes thermolabile direct hemolysin (TDH) that can lyse red blood cells. The Kanagawa phenomenon (KP) has been reported to be associated with TDH (Honda and Iida, 1993). The KP is considered a good marker to differentiate human pathogenic V. parahaemolyticus strains from the nonpathogenic ones (Miyamoto et al., 1969; Ono et al., 2006). The fla gene, which encodes polar flagellin, is an important common molecular marker to Vibrio spp., such as V. parahaemolyticus, Vibrio anguillarium, Vibrio cholerae and Vibrio vulnificus (McGee et al., 1996; Kim and McCarter, 2000). These genes are therefore chosen as the targets for detection of V. parahaemolyticus. Conventional serotypes detection methods are likely laborious and time-consuming. Molecular methods based on polymerase chain reaction (PCR) (Bej et al., 1999), real-time PCR (Rizvi et al., 2006; Nordstrom et al., 2007), arbitrarily primed PCR (AP-PCR) (Okura et al., 2003), and gene specific oligonucleotide probes (Eom et al., 2006) have also been established. However, the methods mentioned above based on PCR are considered incompetent in their ability to identify pathogenic strains for the shortage of specificity target tdh gene. Fluorescence based DNA microarray methods have also been reported in the identification of pathogenic bacteria (Hong et al., 2004; Vora et al., 2005; Myers et al., 2006; Jin et al., 2007). These methods also have some flaws: generating fluorescent signals requires a set of expensive experimental equipments, and the final results cannot be identified by naked eyes without scanner and software. Besides, the process of detection often needs special professionals to complete this work. Recently, multiplex PCR and DNAeDNA hybridization methods have been developed for the detection of pathogenic bacteria (Courtney et al., 2006; Fujimuro et al., 2006; Myers et al., 2006; Choi et al., 2007; Nhung et al., 2007). A microarray-based multiplex PCR method for the identification and characterization of Bacillus anthracis was also reported (Wang et al., 2004). Comparison with other methods for low-throughput screening assay, detection of pathogenic bacteria by multiplex PCR and DNAeDNA hybridization on microarray is of high specificity and sensitivity, and the procedure of detection is simple. Besides, the result of detection can be easily analyzed by visual inspection due to the use of chemiluminescence and the design of proper primer probe. In this study, we have developed a multiplex PCR and DNAeDNA hybridization assay to detect V. parahaemolyticus. We designed three sets of primers to simultaneously amplify three target genes (tlh, tdh and fla) that serve as molecular makers of V. parahaemolyticus. Biotinylated PCR products were captured by DNAeDNA hybridization on a microarray with immobilized DNA oligonucleotide probes for the target genes, and detected by chemiluminescence with an avidinealkaline phosphatase conjugate. The results demonstrated that this was an efficient and robust method for identifying virulent strains of V. parahaemolyticus.

V. anguillarium XM01 were provided by Professor Xuanxian Peng (Xiamen University, China). V. parahaemolyticus Strains CGMCC 1.1614, 1.1415 and 1.1616 were purchased from Institute of Microbiology, Chinese Academy of Sciences (Beijing, China). V. parahaemolyticus DL01 and Vibrio harveyi DL1901 were donated by Dr. Bing Wang (Dalian Fisheries University, China). Other strains were from Fujian Agriculture and Forestry University (Fujian, China). To extract the bacterial genomic DNA, all strains were grown in 5 mL LB-broth with shaking at 37  C for overnight. The cultures were boiled for 15 min and centrifuged at 8000 g for 15 min. Genomic DNA in the supernatants were used as templates for PCR (Fasanella et al., 2001). 2.2. Primer design and synthesis Multiplex PCR primers sets for amplifying the conserved DNA fragments of tlh, tdh, and fla target genes were designed using Primer 5.0 software (Primier, Canada). The primers were designed to yield PCR products of 367 bp, 269 bp, and 176 bp for the tlh, tdh, and fla genes, respectively. All the multiplex PCR primers were then synthesized by Dingan Biological Engineering Technology and Service Co. Ltd. (Shanghai, China). The immobilized probes (tlh11, tdh11 and fla11) were modified with (CH2)6eSeSe(CH2)6ePO4 at their 50 -ends. The sequences of the primers and probes sets are listed in Table 2. 2.3. Preparation of DNA microarray DNA microarrays were prepared with minor modifications as previously described (Wang et al., 2004; Wen et al., 2004). To form the three arrays, the glass slides (25 mm  72 mm) (Boster, Wuhan, China) were etched with 20% hydrofluoric acid for 45 min at room temperature. The average dimension of the well was 0.8 mm. Slides were then immersed in a 25% ammonia solution (Sigma, USA), followed by a mixture of 1% 3-mercaptopropyl trimethoxysilane (Sigma), 95% ethanol, and 16 mmol/L acetic acid (pH 4.5) for 80 min. The silanized slides were immediately rinsed with the solution containing 95% ethanol and 16 mmol/L acetic acid (pH 4.5). Then, they were cured under dry nitrogen overnight at room temperature. Each array consists of two or three rows of triplicate repeats; top: tlh11, middle: tdh11, bottom: fla11, respectively. The probes (0.5 mL, 20 mmol/L) with 50 -disulfide modification were arrayed in the mercaptosilane-coated well by pipetting. The microarrays were incubated in a humid chamber for 12 h, and then washed with TNT buffer (10 mmol/L TriseHCl, pH 7.5, 150 mmol/L NaCl, and 0.05% Tween 20) for 6 min. The DNA microarrays modified with DNA probes were ready for use. 2.4. Single and multiplex PCR system

2. Materials and methods 2.1. Bacterial strains and DNA extraction The bacterial strains used in this study are listed in Table 1. Positive control V. parahaemolyticus strain (tlhþ/tdhþ) and

Optimized PCR conditions were developed to produce three target genes for V. parahaemolyticus strains. Single PCR amplifications were carried out with 1 PCR buffer, 0.25 mmol/ L of each deoxyribonucleotide triphosphate, 1 U Taq polymerase (TaKaRa TaqÔ; TaKaRa Biotechnology Co. Ltd,

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135

131

Table 1 Bacterial strains tested for tlh, tdh and fla. Strains

Target gene

No. of tested

Vibrio parahaemolyticus XM01(O3:K6) Vibrio parahaemolyticus F2002(O1:K25) Vibrio parahaemolyticus F1998(O1:K48) Vibrio parahaemolyticus DL01(O3:K6) Vibrio parahaemolyticus 1997(O3:K29) Vibrio parahaemolyticus 1999(O1:K41) Vibrio parahaemolyticus F1516(O4:K8) Vibrio parahaemolyticus F1728(O4:K8) Vibrio parahaemolyticus1.1614 (O1:K1) Vibrio parahaemolyticus ATCC17802(O1:K1) Vibrio parahaemolyticus1.1615 (O1:K1) Vibrio parahaemolyticus1.1616 (O1:K1) Vibrio cholerae F01 Vibrio cholerae F02 Vibrio cholerae F03 Vibrio cholerae F04 Vibrio cholerae F05 Vibrio cholerae F06 Vibrio vulnificus F1999 Vibrio vulnificus F2001 Vibrio vulnificus F2002 Vibrio anguillarium F2006 Vibrio anguillarium XM01 Vibrio alginolyticus DM07 Vibrio harveyi DL1901 Bacillus subtilis Bacillus amyloliquefaciens Bacillus thuringiensis Streptococcus pyogenes Escherichia coli

tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdhþ tlhþ/tdh tlhþ/tdh tlhþ/tdh tlhþ/tdh Non Non Non Non Non Non Non Non Non Non Non Non Non Non Non Non Non Non

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 2 3 6 4 2 3

Dalian, China), 0.5 mmol/L primers, and 5 mL template DNA in a final reaction volume of 50 mL. Amplification was performed with a thermal cycler, Eppendorf AG 22331 (Eppendorf, Germany) under the following thermal cycle: 1 cycle of 94  C for 5 min, 25 cycles of 94  C for 30 s, 56  C for 30 s, and 72  C for 30 s, and a final extension step of 72  C for 3 min. Multiplex PCR amplifications were performed in a similar manner except with all primer mixture (0.25 mmol/L tlh1 and tlh2, 0.25 mmol/L tdh1 and tdh2, and 0.5 mmol/L fla1 and fla2).

Detection result tlh

tdh

Fla

þ þ þ þ þ þ þ þ þ þ þ þ                  

þ þ þ þ þ þ þ þ                      

þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ      

2.5. Biotinylation of multiplex PCR The multiplex PCR mixture (50 mL) contained 1 PCR buffer, 0.25 mmol/L of each deoxyribonucleotide triphosphate, 1 U Taq polymerase (TaKaRa TaqÔ), 0.25 mmol/L tlh1 and tlh2, 0.25 mmol/L tdh1 and tdh2, 0.5 mmol/L fla1 and fla2, 5 mL template DNA and 0.05 mmol/L5 [N-(N-biotinylaminocaproyl)-3-3-aminoallyl]-2-deoxy-uridine-5-triphosphate (Biotin-11-dUTP) (SinoAmerican Biotechnology Company), in a final reaction volume

Table 2 Primer and probes sequences for tlh, tdh and fla detection.a Locus

Primer

Function of primer

Size (bp)

Sequence (50 / 30 )

tlh

tlh1 tlh2 tlh11

Upstream primer Downstream primer Immobilized probe

17 18 27

GACGGCTACTGGTGGAG AGTTGTAGAGCGGAAGGT TTTTTTTTTTGACGGCTACTGG TGGAG

tdh

tdh1 tdh2 tdh11

Upstream primer Downstream prime Immobilized probe

17 18 27

GCCTTTGAGCTTCCATC CGCTTATAGCCAGACAAC TTTTTTTTTTGCCTTTGAGCTTCCATC

fla

fla1 fla2 fla11

Upstream primer Downstream prime Immobilized probe

17 16 27

GCGTTTGTCTTCAGGTT GGAGTTGGTGGTCTCG TTTTTTTTTTGCGTTTGTCTTCAGGTT

a

Primers tlh1 and tlh2 were used to amplify tlh chromosomal fragment, primers tdh1 and tdh2 were used to amplify tdh gene, fla1 and fla2 were to amplify fla gene. Probes tlh11, tdh11 and fla11 were modified with (CH2)6eSeSe(CH2)6ePO4 at their 50 end (polyT), and were immobilized in mercaptosilanized wells by disulfide bond formation.

132

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135

of 50 mL. PCR amplification was carried out as the former amplification. 2.6. DNAeDNA hybridization on microarray DNAeDNA hybridization was progressed on microarray following PCR amplification. At the beginning, 1 mL of the multiplex PCR product was added to the reaction wells, and the microarray was mantled with a cover-slip to prevent the evaporation of solution. And then, double stranded reaction products were first denatured at 94  C for 5 min followed by annealing of biotinylated single stranded DNA with immobilized primers at 55  C for 1 h, so as to increase the efficiency of hybridization. 2.7. Signal generation After DNA hybridization, the microarrays were washed with TNT buffer (10 mmol/L TriseHCl, pH 7.5, 150 mmol/L NaCl, and 0.05% Tween 20), and the reaction wells were blocked with blocking buffer (100 mmol/L TriseHCl, pH 7.8, 50 mg/mL BSA, and 0.2 mg/mL NaN3) for 20 min to avoid non-specific attachments. To each well, 0.5 mL of avidinealkaline phosphatase conjugate (AVeAP, 1 mg/mL, Sigma) was added, and incubated for 20 min. The microarrays were immersed into TNT buffer twice, followed by the addition of 0.5 mL enzyme substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) solution. The reaction was performed at 37  C for 15 min or up to 30 min. Development of a purple color during the incubation indicated the presence of the target DNA (Rogers et al., 1999; Wang et al., 2004). 3. Results 3.1. Multiplex PCR To clearly differentiate the three target genes by agarose gel electrophoresis, we designed the PCR primers to generate products that differ by an approximately 100 bp in length. The length of DNA fragments obtained by multiplex PCR of tlh, tdh and fla were 367 bp, 269 bp and 176 bp, respectively. We used multiplex PCR to amplify three target genes of positive V. parahaemolyticus strain (tlhþ/tdhþ). When the primers were used in equal concentrations in the initial multiplex PCR experiments, in comparison with other brighter bands, a weaker DNA band of fla occurred. However, after adjusting the individual primer concentration [0.25 mmol/L (tlh1/tlh2), 0.25 mmol/L (tdh1/tdh2) and 0.5 mmol/L (fla1/fla2)], a better result was obtained by gel electrophoresis. The amplification results of single locus PCR and three loci PCR were shown in Fig. 1A. Positive control V. parahaemolyticus XM01 strain was tested, and no nonspecific DNA fragment was observed on gel. Lane 1 is the result of three loci PCR, Lanes 2e4 are the results of single locus PCR of tlh, tdh and fla fragments, respectively.

3.2. DNAeDNA hybridization and enzymatic detection Rogers presented a useful method to immobilize DNA probes or primers on a microarray surface (Rogers et al., 1999). We anchored the disulfide-modified probes to a mercaptosilane-modified glass surface by covalent attachment. The target gene was amplified with an unmodified primer in the presence of biotin-11-dUTPs to yield biotinylated DNA fragments. Then, the amplified multiplex PCR products were added into the reaction wells. The biotinylated products were annealed to the immobilized DNA probes, and detected by chemiluminescence with an avidinealkaline phosphatase conjugate. Development of a purple color and, thus, the presence of target gene fragments can be analyzed easily by visual inspection. The identification of tlh, tdh and fla positive strains was shown in Fig. 2A. After hybridization and enzymatic detection, the color of NBT/BCIP solution changed from the original light yellow to purple which indicated the positive response. In contrast, the negative control wells which have no immobilized disulfide-modified probes did not undergo a color change because no hybridization occurred. 3.3. Identification of bacterial strains We used multiplex PCR and DNAeDNA hybridization to detect bacterial strains. Twelve V. parahaemolyticus isolates and fifteen Vibrio strains were successfully tested. Fig. 1B shows that no non-specific DNA bands were observed by gel electrophoresis. In addition, eighteen strains of other bacteria were also tested using this method and gave negative results (Table 2). To assess the feasibility of DNA microarray for simultaneous detection and discrimination, three different genes were amplified and hybridized to the primers immobilized on the microarray. The result of DNAeDNA hybridization on the microarray and detection by chemiluminescence with avidinealkaline phosphatase conjugate was shown in Fig. 2B. Forty-five associated strains were successfully tested, and the result revealed that no non-specific hybridization and crosshybridization reaction were discovered on DNA microarray. V. parahaemolyticus must contain two specific genetic genes (tlhþ/tdhþ). Thus, detection of V. parahaemolyticus based on multiplex PCR may have the ability to differentiate virulent strains from avirulent strains and other species. If the multiplex PCR is positive for tlh, tdh, and fla, it is indication of a virulent V. parahaemolyticus strain (tlhþ/tdhþ/flaþ). However, the absence of the tdh gene would be indicative of avirulent V. parahaemolyticus strain (tlhþ/tdh/flaþ), and the type of tlh/tdhþ/flaþ had not been reported until now. If only fla gene is positive, it belongs to avirulent V. parahaemolyticus strain (tlh/tdh/flaþ) or other Vibrio species. If the multiplex PCR are negative for the three target genes, it belongs to nonVibrio species (tlh/tdh/fla). 4. Discussion At present, gene microarray based on multiplex PCR and DNAeDNA hybridization has become one of the most

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135

133

Fig. 1. PCR analysis on agarose gel electrophoresis (1.0%). A: single PCR and multiplex detecftion. Lane M is the molecular weight maker (MW) DL-2000 (TaKaRa Biotechnology Co. Ltd) which showed bands as indicated. Lane 1 is the result of three loci PCR, Lanes 2e4 are the results of single locus PCR of tlh, tdh and fla fragments, respectively; B: detection of isolated strains by multiplex PCR. Lane M is the Marker DL-2000; Lane 1 is from virulent strains (tlhþ/tdhþ/flaþ); Lane 2 from partially virulent strains of (tlhþ/tdh/flaþ); Lane 3 is from avirulent strains of (tlh/tdhflaþ) or other Vibrio species.

remarkable achievements in detection of pathogenic bacteria (Wang et al., 2004; Wen et al., 2004). The most attractive features of gene microarrays are the miniaturization, speed and accuracy. Accordingly, gene microarray technology offers an enormous potential for rapid multiplex analysis of nucleic acid

samples, including the diagnosis of genetic diseases, detection of infectious agents, measurements of differential gene expression, and drug screening (Service, 1998; Wang, 2002). In this study, three target genes were chosen as the targets for detection of V. parahaemolyticus. The tlh gene is present in

Fig. 2. Visual detection of DNAeDNA hybridization on a microarray by biotin-avidin alkaline phosphatase indicator system. Biotinylated multiplex PCR products of isolated strains were captured on a microarray by immobilized DNA probes for target genes and detected by chemiluminescence with an avidinealkaline phosphatase conjugate. A: detection of DNAeDNA hybridization on a microarray. Each array consists of three rows of two repeats, top: tlh, middle: tdh, bottom: fla. Array (a) indicates the positive results of three loci PCR; arrays (b)e(d) represent detection results of the single loci positive PCR of fla, tdh and tlh fragments, respectively. Other dots correspond to negative controls. The negative control wells are the same as other wells except that no disulfide-modified primers were immobilized. B: detection of isolated strains by gene microarray. Each array consists of three rows of triplicate repeats; top: tlh, middle: tdh, bottom: fla. Array (a) indicates the results of virulent strains (tlhþ/tdhþ/flaþ); array (b) indicates the results of partially virulent strains(tlhþ/tdh/flaþ); array (c) indicates the results of avirulent strains (tlh/tdhflaþ) or other Vibrio species, and other dots correspond to negative controls.

134

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135

every V. parahaemolyticus strains and has been regarded as a marker of this species, and the tdh gene is a commonly regarded virulence gene of V. parahaemolyticus and has been frequently used as the target of detecting virulent strains of this species. Besides, the fla gene is a common gene in Vibrio spp. (Honda and Iida, 1993; Yun and Ccarter, 2000; Myers et al., 2003). Three target genes were simultaneously amplified from the genomic DNA of microbial pathogens using multiplex PCR, and the result of amplification was of high specificity and sensitivity. With this approach, a variety of different types of V. parahaemolyticus can be easily detected and identified. Therefore, multiplex PCR assay would be an effective method in pathogenic bacterial studies (Gheit et al., 2006). Multiplex PCR was the critical step in our experiment. In evaluating multiplex PCR methods, key performance parameters to consider include specificity and uniformity (Porreca et al., 2007). One of the crucial problems to multiplex PCR is when large numbers of specific primer pairs are added to the same reaction, both correct and incorrect amplicons are formed (Fredriksson et al., 2007). To achieve the highest yield of DNA products, the primers were designed to be completely complementary to the target gene to minimize the formation of primer dimers and amplification of non-specific DNA fragments. Pairs of primers had similar annealing temperatures and base composition. In addition, the primers were designed with an appropriate length and G þ C contents to ensure the veracity of amplification. The optimized primers decreased the occurrence of non-specific PCR products. Gene specific oligonucleotide probes, fluorescent-, or radioactive-labeled probes (Taqman) are the most common means for detection with a scanner on DNA microarray in laboratory (Hong et al., 2004; Myers et al., 2006; Rizvi et al., 2006; Sergeev et al., 2006). However, the need for expensive equipments and the harmful radioactivity are two disadvantages for their use as detection methods. The “visual” microarray format provides a more convenient and economical method through chemiluminescence with an avidinealkaline phosphatase conjugate for detection of target DNA products on lowdensity DNA microarrays. In addition, it is very sensitive, because all samples were amplified by multiplex PCR. Previous studies showed that the DNA microarray hybridization approach was effective for the detection of amplicons generated by PCR from multiple food-borne microorganisms, including pathogenic strains (Chizhikov et al., 2001; Volokhov et al., 2002; Wilson et al., 2002). In this study, our main objective was to design a highly sensitive and specific DNA microarray which is able to effectively differentiate V. parahaemolyticus from the other strains. However, it was difficult to obtain a better detection signal at the beginning of the hybridization process. Cross-hybridization reactions, false positives and low detection signal all appeared in DNA microarrays. This might arise from many factors affecting the efficiency of DNAeDNA hybridization, such as single strand DNA secondary structures (Lane et al., 2004), hybridization temperature, hybridization time, etc. To obtain a satisfactory signal following hybridization on the microarray, we

optimized many pivotal factors. Firstly, the DNAeDNA hybridization temperature and DNA melting temperature are important parameters for optimizing hybridization reactions. Secondly, the efficiency of the hybridization reaction was improved by adjusting the hybridization time, PCR product purification and reactant concentrations. In many cases, these factors can provide a limited amount of DNAeDNA hybridization with best conditions. In conclusion, we had successfully amplified three target genes by multiplex PCR and detected the bacterial strains through chemiluminescence with an avidinealkaline phosphatase conjugate. With the optimal condition, this DNA microarray’s limit of detection was 2 pg specific DNA per hybridization reaction, and the whole progress for detection needs 2e3 h. The result of the detection with this method can be easily analyzed by naked eyes without any expensive instruments. Although this approach was developed for the detection of V. parahaemolyticus, it may serve as a useful tool for the detection and identification for Vibrio spp. and other microbial pathogens. Acknowledgements We are grateful to the financial supports from National High Technology Research and Development Program of China (No. 2007AA10Z430), National Natural Science Foundation of China (No. 30700535), Program for New Century Excellent Talents in Fujian Province University, and Fok Ying Tong Education Foundation (No. 111032). Professor Xianxuan Peng (Xiamen University, China) is greatly appreciated for the donation of V. parahaemolyticus strains. Dr. Bing Wang (Dalian Fisheries University, China) is also appreciated for the technical discussion and donation of Vibrio. spp. References Bej, A.K., Patterson, D.P., Brashera, C.W., Vickerya, M.C.L., Jones, D.D., Kaysner, C.A., 1999. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. J. Microbiol. Methods 36, 215e225. Bresee, J.S., Widdowson, M.A., Monroe, S.S., Glass, R.I., 2002. Foodborne viral gastroenteritis, challenges and opportunities. Clin. Infect. Dis. 35, 748e753. Centers for Disease Control and Prevention (CDC), 2005. Vibrio illnesses after Hurricane Katrinadmultiple states. Morb. Mortal Week Rep. 54, 928e931. Chao, G.X., Jiao, X.N., Zhou, X.H., Wang, F., Yang, Z.Q., Huang, J.L., Pan, Z. M., Zhou, L.P., Qian, X.Q., 2010. Distribution of genes encoding four pathogenicity Islands VPaIs., T6SS, Biofilm, and type I Pilus in food and clinical strains of Vibrio parahaemolyticus in China. Foodborne Pathog. Dis. 76, 649e658. Chizhikov, V., Rasooly, A., Chumakov, K., Levy, D.D., 2001. Microarray analysis of microbial virulence factors. Appl. Environ. Microbiol. 67, 3258e3263. Choi, Y.S., Lim, J.Y., Lee, K.S., 2007. Development of a DNA microarray using hydrophobic interaction between template and particle by using the random fluidic self-assembly method. Curr. Appl. Phys. 7, 370e374. Courtney, S., Mossoba, M.E., Hammack, T.S., Al-Khaldi, C., 2006. Using PCR amplification to increase the confidence level of Salmonella typhimurium DNA microarray hybridization. Mol. Cell Probes 20, 163e171.

R. Wang et al. / Journal of Genetics and Genomics 38 (2011) 129e135 Eom, H.S., Hwang, B.H., Kim, D.H., Lee, I.B., Kimc, Y.H., Cha, H.J., 2006. Multiplex detection of food-borne pathogenic bacteria using a novel 16S rDNA-based oligonucleotide signature microarray. Biosens. Bioelectron. 22, 845e853. Fasanella, A., Losito, S., Trotta, T., Adone, R., Massa, S., Ciuchini, F., Chiocco, D., 2001. Detection of anthrax vaccine virulence factors by polymerase chain reaction. Vaccine 19, 4214e4218. Fredriksson, S., Baner, J., Dahl, F., Chu, A., Ji, H., Welch, K., Davis, R.W., 2007. Multiplex amplification of all coding sequences within 10 cancer genes by gene-collector. Nucleic Acids Res. 35, 47e52. Fujimuro, M., Nakaso, K., Nakashima, K., Sadanari, H., Hisanori, I., Teishikata, Y., Hayward, S.D., Yokosawa, H., 2006. Multiplex PCR-based DNA array for simultaneous detection of three human herpesviruses, EVB, CMV and KSHV. Exp. Mol. Pathol. 80, 124e131. Gheit, T., Landi, S., Gemignani, F., Snijders, P.J.F., Vaccarella, S., Franceschi, S., Canzian, F., Tommasino, M., 2006. Development of a sensitive and specific assay combining multiplex PCR and DNA micro array primer extension to detect high-risk mucosal human papillomavirus types. J. Clin. Microbiol. 446, 2025e2031. Honda, T., Iida, T., 1993. The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct hemolysin and related hemolysins. Rev. Med. Microbiol. 10, 106e113. Hong, B.X., Jiang, L.F., Hu, Y.S., Fang, D.Y., Guo, H.Y., 2004. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections. J. Microbiol. Methods 583, 403e411. Izutsu, K., Kurokawa, K., Tashiro, K., Kuhara, S., Hayashi, T., Honda, T., Iida, T., 2008. Comparative genomic analysis using microarray demonstrates a strong correlation between the presence of the 80-kilobase pathogenicity island and pathogenicity in Kanagawa phenomenon-positive Vibrio parahaemolyticus strains. Infect. Immun. 76, 1016e1023. Jin, D.Z., Xu, X.J., Chen, S.H., Wen, S.Y., Ma, X.E., Zhang, Z., Lin, F., Wang, S.Q., 2007. Detection and identification of enterohemorrhagic Escherichia coli O157, H7 and Vibrio cholerae O139 using oligonucleotide microarray. Infect. Agent Cancer 2, 23. Kawatsu, K., Ishibashi, M., Tsukamoto, T., 2006. Development and evaluation of a rapid, simple, and sensitive immunochromatographic assay to detect thermostable direct hemolysin produced by Vibrio parahaemolyticus in enrichment cultures of stool specimens. J. Clin. Microbiol. 5, 1821e1827. Kim, Y.K., McCarter, L.L., 2000. Analysis of the polar flagellar gene system of Vibirio parahaemolyticus. J. Bacteriol. 182, 3693e3704. Korea Food and Drug Administration, KFDA, 2006. Annual Report of Foodborne Outbreaks. . Lane, S., Evermann, J., Loge, F., Call, D.R., 2004. Secondary structure prevents target hybridization to oligo nucleotide microarrays. Biosens. Bioelectron. 20, 728e735. Li, Z.F., Nie, J., 2003. Construction of clone and expression vector of gene of Vibrio parahaem olyticus. Chin. J. Public Health 19, 418e419. Liu, X.M., Chen, Y., Fan, Y.X., Wang, M.Q., 2006. Foodborne diseases occurred in 2003dreport of the National Foodborne Diseases Surveillance system, China. J. Hyg. Res. 35, 201e204 (in Chinese with an English abstract). Mao, Z.J., Yu, L., You, Z.Q., Wei, Y.W., Liu, Y., 2007. Cloning, expression and immunogenicty analysis of five outer membrane proteins of Vibrio parahaemolyticus zj2003. Fish Shellfish Immunol. 23, 567e575. Martinez-Urtaza, J., Lozano-Leon, A., Varela-Pet, J., Trinanes, J., Pazos, Y., Garcia-Martin, O., 2008. Environmental determinants of the occurrence and distribution of Vibrio parahaemolyticus in the Rias of Galicia, Spain. Appl. Environ. Microbiol. 741, 265e274. McGee, K., Horstedt, P., Milton, D.L., 1996. Identification and characterization of additional flagellin genes from Vibrio anguillarum. J. Bacteriol. 178, 5188e5198.

135

Miyamoto, Y., Kato, T., Obara, Y., Akiyama, S., Takizawa, K., Yamai, S., 1969. In vitro hemolytic characteristic of Vibrio parahaemolyticus, its close correlation with human pathogenicity. J. Bacteriol. 100, 1147e1149. Myers, M.L., Panicker, G., Bej, A.K., 2003. PCR detection of a newly emerged pandemic Vibrio parahaemolyticus O3, K6 pathogen in pure cultures and seeded waters from the mar of Mexico. Appl. Environ. Microbiol. 69, 2194e2200. Myers, K.M., Gaba, J., Al-Khaldi, S.F., 2006. Molecular identification of Yersinia enterocolitica isolated from pasteurized whole milk using DNA microarray microarray hybridization. Mol. Cell Probes 20, 71e80. Nhung, P.H., Ohkusu, K., Miyasak, J., Sun, X.S., Ezaki, T., 2007. Rapid and specific identification of 5 human pathogenic Vibrio species by multiplex polymerase chain reaction targeted to dnaJ gene. Microbiol. Infect. Dis. 59, 271e275. Nordstrom, J.L., Vickery, M.C., Blackstone, G.M., 2007. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 7318, 5840e5847. Okura, M., Osawa, R., Iguchi, A., Arakawa, E., Terajima, J., Watanabe, H., 2003. Genotypic analyses of Vibrio parahaemolyticus and development of a pandemic group-specific multiplex PCR assay. J. Clin. Microbiol. 10, 4676e4682. Ono, T., Kwon-Sam, P., Ueta, M., Iida, T., Honda, T., 2006. Identification of proteins secreted via Vibrio parahaemolyticus type III secretion system 1. Infect. Immun. 74, 1032e1042. Porreca, G.J., Zhang, K., Li, J.B., Xie, B., Austin, D., Vassallo, S.L., LeProust, E.M., Peck, B.J., Emig, C.J., Dahl, F., Gao, Y., Church, G.M., Shendure, J., 2007. Multiplex amplification of large sets of human exons. Nat. Methods 4, 931e936. Rizvi, A.V., Panicker, G., Myers, M.L., Bej, A.K., 2006. Detection of pandemic Vibrio parahaemolyticus O3, K6 serovar in Gulf of Mexico water and shellfish using real-time PCR with Taqman fluorescent probes. FEMS Microbiol. Lett. 2622, 185e192. Rogers, Y.H., Jiang-Baucom, P., Huang, Z.J., Bogdanov, V., Anderson, S., Boyce-Jacino, M.T., 1999. Immobilization of oligonucleotides onto a glass support via disulfide bonds, a method for preparation of DNA microarrays. Anal. Biochem. 266, 23e30. Sergeev, N., Distler, M., Vargas, M., Chizhikov, V., Herold, K.E., Rasooly, A., 2006. Microarray analysis of Bacillus cereus group virulence factors. J. Microbiol. Methods 65, 488e502. Service, R.F., 1998. Micromicroarray arrays put DNA on the spot. Science 282, 396e399. Volokhov, D., Rasooly, A., Chumakov, K., Chizhikov, V., 2002. Identification of Listeria species by microarray-based assay. J. Clin. Microbiol. 40, 4720e4728. Vora, G.J., Meador, C.E., Bird, M.M., Bopp, C.A., Andreadis, J.D., Stenger, D. A., 2005. Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc. Natl. Acad. Sci. USA 52, 19109e19114. Wang, J., 2002. Survey and summary. From DNA biosensors to gene microarrays. Nucleic Acids Res. 28, 3011e3016. Wang, S.H., Wen, J.K., Zhou, Y.F., Zhang, Z.P., Yang, R.F., Zhang, J.B., Chen, J., Zhang, X.E., 2004. Identification and characterization of Bacillus anthracis by multiplex PCR on DNA microarray. Biosens. Bioelectron. 20, 807e813. Wen, J.K., Zhang, X.E., Cheng, Z., Liu, H., Zhang, Z.P., Yang, J.H., Deng, J.Y. , 2004. A visual DNA microarray for simultaneous detection of HBV, HCV and HIV-1 human viruses. Biosens. Bioelectron. 19, 685e692. Wilson, W.J., Strout, C.L., DeSantis, T.Z., Stilwell, J.L., Carrano, A.V., Andersen, G.L., 2002. Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Mol. Cell Probes 16, 119e127. Yun-Keyeong, K., Ccarter, L.L., 2000. Analysis of the polar falgellar gene system of Vbirio parahaemolyticus. J. Bacteriol 187, 3693e3704.