Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates

f u n g a l b i o l o g y x x x ( 2 0 1 5 ) 1 e2 4

journal homepage: www.elsevier.com/locate/funbio

Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates b
Lina ESCOBAR-TOVARa, Mauricio GUZMAN-QUESADA , b

Jorge A. SANDOVAL-FERNANDEZ , Miguel A. GOMEZ-LIMa,*

Departamento de Ingenier
ıa Gen
etica, Centro de Investigaci
on y de Estudios Avanzados del IPN, Unidad Irapuato, 36821, Irapuato, Guanajuato, Mexico b
piles, Direcci
on de Investigaciones, Secci
on de Fitopatolog
ıa, Corporaci
on Bananera Nacional, 390-7210, La Rita, Gua Costa Rica a

article info

abstract

Article history:

Black Sigatoka, a devastating disease of bananas and plantains worldwide, is caused by the

Received 6 August 2014

fungus Mycosphaerella fijiensis. Several banana cultivars such as ‘Yangambi Km 5’ and Cal-

Received in revised form

cutta IV, have been known to be resistant to the fungus, but the resistance has been bro-

13 January 2015

ken in ‘Yangambi Km 5’ in Costa Rica. Since the resistance of this variety still persists in

Accepted 14 January 2015

Mexico, the aim of this study was to compare the in vitro and in planta secretomes from two avirulent and virulent M. fijiensis isolates using proteomics and bioinformatics approaches. We aimed to identify differentially expressed proteins in fungal isolates that dif-

Keywords:

fer in pathogenicity and that might be responsible for breaking the resistance in

Ascomycete fungus

‘Yangambi Km 5’. We were able to identify 90 protein spots in the secretomes of fungal iso-

Black Sigatoka

lates encoding 42 unique proteins and 35 differential spots between them. Proteins in-

Pathogen resistance breakdown

volved in carbohydrate transport and metabolism were more prevalent. Several

Proteomic analysis

proteases, pathogenicity-related, ROS detoxification and unknown proteins were also

Virulence

highly or specifically expressed by the virulent isolate in vitro or during in planta infection. An unknown protein representing a virulence factor candidate was also identified. These results demonstrated that the secretome reflects major differences between both M. fijiensis isolates. ª 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction Mycosphaerella fijiensis [anamorph: Paracercospora fijiensis (Morelet) Deighton] is a haploid, hemibiotrophic ascomycete fungus that causes the Black Leaf Streak Disease (BLSD), also known as black Sigatoka, and is considered to be the most costly and damaging disease of bananas and plantains (Musa spp.) worldwide (Carlier et al. 2000). This pathogen is

responsible for more than 50 % of crop losses in production areas. After penetration of the leaves via the stomata, M. fijiensis initially grows as a biotroph, exclusively colonizing the intercellular spaces between mesophyll cells and obtaining nutrients from the host apoplast without haustoria formation. However, it later becomes a necrotroph, leading to collapse of the host’s tissue (Lepoivre et al. 2003). Thus, this fungus affects plant productivity via reduction of the photosynthetic area

* Corresponding author. Tel.: þ52 462 6239600x401.
mez-Lim). E-mail address: [email protected] (M. A. Go http://dx.doi.org/10.1016/j.funbio.2015.01.002 1878-6146/ª 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

2

and abnormal fruit ripening. The complete genome of M. fijiensis strain CIRAD86 was released in 2010 (http://genome.jgipsf.org/Mycfi2/Mycfi2.home.html); it revealed that the fungus has an estimated genome size of 74.1 Mb, contained in 56 main genome scaffolds and contains 13,107 predicted genes. This milestone event has opened many possibilities for the molecular study of this pathogen. One of the reasons for the disease susceptibility of Musa species is the widespread cultivation of seedless, sterile and genetically uniform clones (Mar
ın et al. 2003). The fact that most of these cultivars are unsuitable for breeding of resistant lines necessitates the extensive use of fungicides as the primary means for disease control (Churchill 2011). However, the increasing use of these compounds has resulted in many economic, health and environmental problems (Ceballos et al. 2012). Furthermore, the constant application of fungicides has induced chemical resistance in M. fijiensis (OrozcoSantos 2013), turning this fungus into a serious agronomic problem. There are some Musa varieties resistant to black Sigatoka such as ‘Yangambi Km 5’ (having an AAA genome), a Musa dessert-type variety that produces small fruits and that has shown resistance to other diseases and plagues, including yellow Sigatoka disease (caused by Mycosphaerella musicola) and the banana and plantain borer nematode (Radopholus similis) (Vargas & Sandoval 2005). Nonetheless, M. fijiensis has been able to break the resistance in ‘Yangambi Km 5’. This was first detected in Cameroon, in 1992 (Mouliom-Pefoura 1999) and
n, unpublater in Costa Rica, in 2008 (Sandoval and Guzma lished observations). Unfortunately, not much is known about the interaction between this pathogen and its host at the molecular level. During the infection, an extensive extracellular communication between the pathogen and the host cells occurs, suggesting an important role for secreted fungal proteins (Brown et al. 2012; do Amaral et al. 2012). Many of these proteins, such as cellulases, hemicellulases, pectinases, esterases, cutinases, oxidoreductases, among others (Cuomo et al. 2007) play important roles in fungal nutrition (Dobinson et al. 1997) or in host cell wall degradation (Dow et al. 1998; Carlile et al. 2000). However, the genome of M. fijiensis contains only a reduced number of genes for cell wall degrading enzymes. On the other hand, it revealed an abundance of genes coding for enzymes previously postulated, or even shown, to be factors required for virulence in various fungal species including pectate lyases and lipases (Deising et al. 1992; Voigt et al. 2005; Ohm et al. 2012), small cysteine-rich proteins with no known enzymatic activity (Rep 2005; Stergiopoulos et al. 2010), and extracellular proteases which may contribute to obtain nutrients during the infective process (Murphy & Walton 1996), and/or to increase the permeability of the plant plasma membrane to facilitate adhesion and tissue invasion or degradation of intercellular pathogenesis-related (PR) proteins (Rodrigo et al. 1991), among others. Mycosphaerella graminicola uses various secreted effectors during the infection process of wheat plants. This mode of plant infection appears to be widespread amongst the Mycosphaerellaceae pathogens (do Amaral et al. 2012). Coincidentally, careful analysis of the M. fijiensis genome identified putative homologs of Avr4 and Ecp2 effectors from the tomato

L. Escobar-Tovar et al.

pathogen Cladosporium fulvum (Stergiopoulos et al. 2010). In addition, a previous study indicated that the Avr4, Ecp2 and SnodProt1 precursor genes of M. fijiensis share significant sequence similarities to identified pathogenicity genes in other fungi (Cho et al. 2008). In recent years, progress in proteomics has allowed researchers to perform systematic studies of proteins secreted from pathogens or during their interactions with hosts in a high-throughput manner (Wang et al. 2013), giving rise to a new term, the secretome (Agrawal et al. 2010). Chuc-Uc et al. (2011) performed a characterization of the in vitro M. fijiensis strain C-1233 secretome. Their results suggested that it mainly consisted of non-host specific enzymes and phytotoxic compounds, capable of causing leaf necrosis not only to the susceptible Musa acuminata cv. Grand Naine and the non-host plant Carica papaya, but also to the resistant M. balbisiana wild species. In the present study, we provide the first report of the in vitro and in planta proteins secreted by two M. fijiensis isolates differing in pathogenicity. These were collected in Mexico and Costa Rica, where the resistance of the ‘Yangambi Km 5’ variety has been broken. We employed a Two-Dimensional gel Electrophoresis (2-DE)-based proteomics approach in combination with an advanced mass spectrometric method. The information generated will contribute to gain a better understanding of the M. fijiensishost interaction.

Material and methods Biological material A mono-ascosporic isolate of Mycosphaerella fijiensis was obtained from in-field, naturally infected and diseased Musa acuminata cv. Grand Naine leaves collected in a plantation at a research station of the ‘Instituto Nacional de Investigaciones Forestales Agr
ıcolas y Pecuarias’ (Colima, Mexico) and will subsequently be referred to in this work as an avirulent M. fijiensis isolate. Likewise, a mono-ascosporic isolate of M. fijiensis was obtained from in-field, naturally infected and diseased M. acuminata var. ‘Yangambi Km 5’ leaves col
n Bananera Naciolected in a plantation at the ‘Corporacio nal’ (Guapiles, Costa Rica) and will subsequently be referred to in this work as a virulent M. fijiensis isolate. Fifteen-day old mycelia, obtained in a Potato Dextrose Agar (PDA) medium (Sigma Aldrich, Saint Louis, MO, USA) and incubated at 27  1  C was ground in a mortar and used to inoculate 10% V8 liquid cultures with 0.4 g l1 CaCO3, incubated at 27  1  C on a shaker at 120 rpm for 15 days. Leaves from M. acuminata var. ‘Yangambi Km 5’ and cv. Grand Naine were inoculated with both M. fijiensis isolates under controlled conditions.

Isolation of fungal genomic DNA and characterization of Mycosphaerella fijiensis isolates Mycelia of two-weeks-old V8 liquid cultures were harvested, washed twice with sterile deionized water, frozen in liquid

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Comparative analysis of the in vitro and in planta secretomes

3

nitrogen and ground to a fine powder using a mortar and pestle. Subsequently, 2 g of ground mycelia from the avirulent and virulent Mycosphaerella fijiensis isolates were used for DNA extraction as described by Punekar et al. (2003). Identification of the M. fijiensis isolates were carried out using the oligonucleotide primers MF137 (50 0 GGCGCCCCCGGAGGCCGTCTA 3 ), specific for M. fijiensis, and R635 (50 GGTCCGTGTTTCAAGACGG 30 ), as described by Johanson & Jeger (1993). Protocols of Polymerase Chain Reaction (PCR) amplification were done in accordance to the same authors. PCR products from both M. fijiensis isolates were excised from a 1 % agarose gel and the DNA fragments were purified with Zymoclean Gel DNA Recovery Kit (Zymo Research, Orange, CA, USA). These fragments were then ligated into the pJET 1.2/blunt vector, according to the manufacturer’s instructions (Thermo Fisher Scientific, Pittsburgh, PA, USA). The ligation mix was used to transform competent Escherichia coli cells strain DH5a. Colonies were selected with ampicillin (Sigma Aldrich), cultured in 3 ml of LuriaeBertani broth with 100 mg ml1 of antibiotic and incubated at 37  1  C for 1 d. The inserts were re-amplified from clones using the primers of the original PCR product cloned by picking the bacterial colonies with a toothpick directly into the PCR reaction. Plasmid DNA was isolated with a Quick Plasmid Miniprep Kit (Invitrogen, Carlsbad, CA, USA) for sequencing at the
noma Instituto de Biotecnolog
ıa, Universidad Nacional Auto
xico, (IBT-UNAM, Cuernavaca, Mexico). de Me

1 min every 2 h and maintained in this way until 40 d postinoculation (dpi). To obtain the in planta secretome of M. fijiensis, an in vitro inoculation of leaves of ‘Yangambi Km 5’ plants grown in vitro was performed, using a modified procedure originally described by Abadie et al. (2008), with conidia of the avirulent and virulent fungal isolates. The conidia inocula from both M. fijiensis isolates were prepared as mentioned above. The abaxial surface of the youngest fully unfolded leaves was inoculated with 200 ml of a conidial suspension which was expanded on the leaf surface using a camel hair brush. Leaves were placed in Petri dishes with the upper leaf surface face down the medium [0.4 % water:agar and 50 mg l1 benzimidazole (Sigma Aldrich)] at 25  1  C, and under a 12 h light and 12 h dark photoperiod during infection. Several leaves inoculated with conidia of the fungal isolates were randomly selected, stained with a few drops of a lactophenol blue solution (SigmaeAldrich) and observed in a bright field light microscopy (DMRE fluorescence microscope, Leica Microsystems, Wetzlar, Germany).

Conidia production and inoculation of ‘Yangambi Km 5’ leaves with Mycosphaerella fijiensis conidia The production of conidia by the avirulent and virulent Mycosphaerella fijiensis isolates was performed as described by Peraza-Echeverr
ıa et al. (2008) with some modifications. The M. fijiensis isolates were fragmented in a mortar and pestle and were grown in culture medium containing 10% V8 juice, 0.2 g l1 CaCO3, and 20 g l1 microbiological agar (Sigma Aldrich) at 20  1  C for 13 d under 25.7 mmol me2 se1 of continuous, cool white fluorescent and black light (General Electric 15 W/18) emitting radiant energy in the near-ultraviolet or black light spectral range. The conidia were dislodged with a sterile camel hair brush and collected in 1 ml V8 liquid medium. The conidial suspensions were then filtered through a 0.8 mm membrane (Millipore, Carrigtwohill, Cork, Ireland) and the conidia concentration was estimated using a Bright-Line haemocytometer (Cambridge Instruments Inc., Buffalo, NY, USA). A 0.05 % Tween 20 (Sigma Aldrich) solution was added to the suspension to facilitate conidia adherence to the surface of leaves. This was performed once the concentration was adjusted to 2  104 conidia mle1 using sterile distilled water. The inoculation of M. fijiensis conidia on the abaxial surface of the youngest fully unfolded leaves of ‘Yangambi Km 5’ was performed under controlled conditions, in order to assess the reaction to black Sigatoka in this variety. A mini spray gun model 250-4 (Badger, Franklin Park, IL, USA) was used to apply a uniform covering of fine droplets of conidial suspension. Thereafter, ‘Yangambi Km 5’ plants were placed in a growth chamber with misting for 2 min every hour during 3 d. Subsequently, misting was gradually reduced to

Preparation of the in vitro secreted proteins from Mycosphaerella fijiensis-cultured liquid medium The biomass was separated from fifteen-day-old V8 liquid medium by filtration through several layers of Miracloth (Calbiochem, San Diego, CA, USA). Fungus-cultured liquid medium was centrifuged at 6,000g for 15 min at 4  C and filtered twice through 0.45 and 0.22 mm membranes (Millipore). Aliquots of 15 ml of filtered medium were freezedried using a Freezemobile 25 SL lyophilizer (The VirTis Co., Gardiner, NY, USA) and re-suspended in 6 ml of 10 % (w/v) Trichloroacetic acid (TCA) in cold acetone. Precipitated secreted proteins were pelleted by centrifugation (18,000g for 30 min at 4  C) and the supernatant discarded. The pellet was re-suspended in 3 ml of cold extraction buffer containing 0.7 M sucrose, 0.1 M KCl, 0.5 M TriseHCl pH 7.5 and 500 mM Ethylenediaminetetraacetic acid (EDTA). Furthermore, 1 % polyvinylpolypyrrolidone and 2 % b-mercaptoethanol were added to the extraction buffer just before use. The protein sample was vortexed for 15 min at 4  C prior to the addition of an equal volume of phenol equilibrated with 10 mM TriseHCl, pH 8.0. The mixture was vortexed for 5 min at 4  C and centrifuged at 10,000g for 20 min at 4  C. The upper phenolic phase was removed and re-extracted twice with cold extraction buffer, as above. Proteins were precipitated overnight at 20  C with five volumes of cold 0.1 M ammonium acetate in methanol and the pellet was rinsed three times with cold acetone and dried. The pellet was resuspended in 500 ml rehydration buffer (7.0 M urea, 2.0 M thiourea, 4 % 3-[(3-cholamidopropyl)dimethylammonio]-1propanesulfonate (CHAPS), 20 mM dithiothreitol (DTT), 10 mM Tris pH 8.0, and 0.25 % immobilized pH gradient (IPG buffer, pH 3e10). The protein samples were concentrated and desalted with a Two Dimensional (2-D) Clean-Up Kit (Amersham Biosciences, Piscataway, NJ, USA) and dissolved in 100 ml rehydration buffer. Protein concentration was quantified using the 2-D Quant Kit (Amersham Biosciences) following the manufacturer’s instructions with Bovine Serum Albumin (BSA) as a standard.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

4

Inoculation of ‘Yangambi Km 5’ leaves with the in vitro secretome of Mycosphaerella fijiensis The in vitro inoculation under controlled conditions was performed across random inoculation sites (consisting in small cuts made with a sterile scalpel) on the abaxial surface of the youngest fully unfolded ‘Yangambi Km 5’ leaves with 50 ml (20 mg) secreted protein extracts from the avirulent and virulent Mycosphaerella fijiensis isolates. Grand Naine leaves inoculated with 50 ml (20 mg) secreted protein extracts were included as a positive control. ‘Yangambi Km 5’ leaves inoculated with 50 ml protein rehydration buffer were included as a negative control. Three independent replicates were prepared. The lesion size [average diameter  standard deviation (SD) in millimeters] was determined at 96 h post-inoculation (hpi). Leaves were placed in Petri dishes with the upper leaf surface face down the medium [0.4 % water:agar and 50 mg l1 benzimidazole (Sigma Aldrich)] at 25  1  C, and under a 12 h light and 12 h dark photoperiod.

L. Escobar-Tovar et al.

from 0 to 100 V over 2 h, 100e250 V over 1 h, 250e500 V over 50 min, 500e1000 V over 30 min, and finally held at 8000 V for a total of 37 kVh. Prior to the second dimension, IPG strips were reduced by incubation in 5 ml of equilibration buffer (6 M urea, 30 % w/v glycerol, 2 % Sodium Dodecyl Sulfate (SDS) and 50 mM TriseHCl pH 8.8) with 1 % w/v DTT for 15 min and then alkylated with 2.5 % w/v iodoacetamide in 5 ml of the same buffer for 15 min. After equilibration, the IPG strips were rinsed for 1 min using SDS electrophoresis buffer and transferred to 12 % SDS-PAGE gels for the second dimension on three vertical slab gel units (Hoefer Scientific Instruments, Holliston, MA, USA), using SDS electrophoresis buffer (250 mM Tris pH 8.3, 1.92 M glycine and 1 % SDS) and run at 190 V for 8 h. After the separations, the gels were fixed in 40 % (v/v) ethanol and 10 % (v/v) acetic acid for 1 h, stained with Coomassie PhastGel Blue R-350 (GE Healthcare) and distained with 10 % acetic acid for image acquisition.

Analysis of gel images Preparation of the in planta secreted proteins from the Mycosphaerella fijiensis isolates Based on our preliminary study, the first signs of the disease were detected by 20-d post-inoculated leaves. Therefore, these were used for the in planta secreted protein extraction according to Agrawal et al. (2010) with some modifications. Briefly, in vitro infected banana leaves were cut with a scalpel to an average length of 3 cm and then packed vertically in the barrel of a 25 ml plastic syringe. The packed tubes were placed in sterile distilled water to cover the leaf pieces, followed by washing with 20 mM potassium phosphate buffer (pH 6.0) and with ice water, again, to remove the buffer. Subsequently, leaf pieces were infiltrated for 6 min with sterile distilled water, placed for 3 min under vacuum and left for 3 additional min without vacuum. Then, the infected plant material was vacuum-infiltrated with the extraction buffer mentioned above, three times for 5 min with 30 s intervals. The syringe barrels were then placed in 30 ml centrifuge tubes and centrifuged twice at 1,500g for 15 min at 4  C. The apoplastic fluid was extracted with phenol and extracellular proteins were precipitated overnight at 20  C with five volumes of cold 0.1 M ammonium acetate in methanol and the pellet was rinsed three times with cold acetone and dried. The pellet was re-suspended in 200 ml rehydration buffer. Protein samples were concentrated and desalted with a 2-D Clean-Up Kit (Amersham Biosciences) and then dissolved in 50 ml rehydration buffer. Protein concentration was quantified using the 2-D Quant Kit (Amersham Biosciences) with the supplied BSA as a standard.

Isoelectric focusing (IEF) and SDS-PAGE IEF was conducted using IPG strips of 13 cm and a pH range of 3e10 (Amersham Biosciences), rehydrated overnight (12 h at 22  C) with 250 mL DeStreak rehydration solution (GE Healthcare, Uppsala, Sweden), containing an estimated 300 mg in vitro secreted protein and 150 mg in planta secreted protein, and focused using an Ettan IPGphor 3 (GE Healthcare) at 22  C. The focusing program consisted of a linear increase

Gels were scanned for image acquisition with the Image Scanner III (GE Healthcare). The protein spots detected and the matching patterns were analyzed with 2-DE analysis software MELANIE 7.0 from Geneva Bioinformatics (GeneBio) S.A. (Geneva, Switzerland). The protein molecular mass was determined using the BenchMark protein ladder (Invitrogen) and the isoelectric point (pI) of proteins was obtained by the migration of the protein spot on the 13-cm IPG strip (pH 3e10) using pH gradient profiles (Amersham Biosciences). Likewise, the same software was used to estimate the abundance of each spot by using the relative volume percentage from three biological replicate gels. To account for variability associated to loading and staining, spot volumes were normalized as a percentage of the total volume in all the spots present in the gel. The differences in protein expression levels among spot groups were tested using one-way Analysis of Variance (ANOVA). When declared statistically significant by ANOVA, the differences among the means were evaluated using a Tukey’s test. A p-value equal to or less than 0.05 was considered statistically significant. Percentage volumes were used to indicate the differentially expressed spots. The statistical analysis was performed using Minitab 14 statistical software package (Minitab, State College, PA, USA). All data are presented as the average  SD of the mean (n ¼ 3).

In-gel digestion of protein spots and mass spectrometry (MS) analysis Excised gel spots were washed twice with sterile distilled water, then with 50 % (v/v) acetonitrile in water, followed by acetonitrile mixed with 100 mM ammonium bicarbonate (1:1 v/v), and finally with 100 % acetonitrile. Washed spots were then reduced, carbamidomethylated, digested with trypsin and the resulting peptides extracted from the gel as described by Shevchenko et al. (1996). MS analyses were performed in a nanoAcquity ultra performance liquid chromatography (Waters, Eschborn, Germany) coupled to a linear ion-trap LTQ-Velos mass spectrometer (Thermo Fisher

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Comparative analysis of the in vitro and in planta secretomes

5

Scientific) equipped with a nano-electrospray ion source. The most abundant peptides were fragmented by collisioninduced dissociation (CID) and Pulsed Q Collision Induced Dissociation (PQD). Acquired MS/MS spectra were compared to those of proteins from the gene catalog of Mycosphaerella fijiensis strain CIRAD86 genome, version 2 (http:// genome.jgi-psf.org/Mycfi2/Mycfi2.home.html) using the Sequest program. Cysteine (þ57 Da) and methionine (þ16 Da) were fixed as static and variable modifications, respectively. Identification was considered positive when at least two different peptides matched to a protein model. In case a MS/MS spectrum matched a protein in the M. fijiensis genome, the sequence was used for protein annotation by performing a Basic Local Alignment Search Tool of protein (BLASTP) search of the predicted protein at the nonredundant National Center for Biotechnology Information (NCBInr) protein database. Theoretical peptide mass and pI were obtained at Expasy (http://web.expasy.org/compute_pi/ ) to confirm that the molecular weight and the pI matched that of the respective protein excised from the gel. A decoy database search was used for determining the false discovery rate (FDR, strict: 0.01, relaxed: 0.05). To confirm protein identifications, the spectra were compared against the M. fijiensis genome using X! Tandem program. Proteins with a probability-based scoring of 1.0 that matched the same protein identified by Sequest, were chosen for further analysis. The euKaryotic Orthologous Groups (KOG) provided for a JGIsequenced organism and the Carbohydrate-Active enZYmes (CAZY) databases were used to perform the functional classification of secreted M. fijiensis protein data. Some in planta secreted proteins from Musa acuminata var. ‘Yangambi Km 5’ were identified by matching acquired MS/ MS spectra with the banana genome (http://bananagenome.cirad.fr/). At least two different peptides were needed for an identification to be considered valid. If some identified proteins did not have functional annotation in the banana genome, BLASTP searches were performed using the banana predicted proteins at the NCBInr protein database. The Gene Ontology bioinformatics program was used to perform the functional classification of secreted banana proteins.

were manually searched for in the unknown secreted proteins identified by MS.

Secreted protein prediction analyses and conserved motif search To confirm secreted protein identification, four different webbased prediction tools were employed. First, SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP-3.0/) was used to predict the presence and location of signal peptide cleavage site in the amino acid (aa) sequences. Second, TMHMM server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) was used to predict transmembrane helices in proteins, and third, TargetP 1.1 server (http://www.cbs.dtu.dk/services/TargetP/) and WoLF PSORT (http://wolfpsort.org/) were used to predict the subcellular location of proteins. All proteins predicted to have an extracellular WoLF PSORT score >17 were kept in the secretome dataset. The conserved aa double motif (RxLR-dEER), which is located in close proximity to the predicted signal peptide sequence, and the Y/F/WxC-motif found in the N-terminal,

Results Characterization of the Mycosphaerella fijiensis isolates The mono-ascosporic, avirulent and virulent Mycosphaerella fijiensis isolates were obtained from naturally infected Musa acuminata cv. Grand Naine and var. ‘Yangambi Km 5’, respectively. Leaves of field-grown banana plants showed typical symptoms of BLSD characterized by the presence of mature lesions relating to symptom stage 6 of Foure’s scale (Fig 1A). The mechanism of infection of these isolates and the symptomatology of the disease were documented in leaves of ‘Yangambi Km 5’. For this purpose, 2  104 conidia of virulent and avirulent isolates were separately inoculated on Musa leaves. In a period between 4 and 40 d, the fungal cell wall was stained with lactophenol blue. The progress of the infection was monitored by bright field light microscopy. Germination of conidia, mycelium development, and fungal penetration were detected in stomata of ‘Yangambi Km 5’ leaves at 8 dpi. Leaves of ‘Yangambi Km 5’ plants infected with the avirulent fungal isolate presented a greater epiphytic mycelial development in contrast to those infected with an virulent isolate (Fig 1B). A faster lesion evolution (1e3 mm2) was observed on the abaxial side of leaves infected with the avirulent isolate at 21 dpi. At 35 to 40 dpi, extended necrotic zones above the leaves were observed, associated with a hypersensitive response. Small necrotic lesions were visible on leaves infected with the virulent M. fijiensis isolate at 30 dpi as well; however, disease development in these leaves did not reach stage 6 of Foure’s scale (Fig 1C). On the other hand, no symptoms of infection were observed in un-inoculated leaves. These results are in accordance with the stages of infection reported previously (Churchill 2011). In order to confirm the identity of the M. fijiensis isolates, PCR of the Internal Transcribed Spacer (ITS) region was performed according to Johanson & Jeger (1993). DNA of a previously characterized strain of M. fijiensis was used as a positive control, whereas DNA of Mycosphaerella musicola was used as a negative control. The expected 1018 bp fragment was observed in samples of the avirulent and virulent isolates of M. fijiensis and in the positive control, as well (Fig 1D). These fragments were purified and sequenced and the sequences were identical to the ITS from M. fijiensis reported in the GenBank (EF666075.1) (data not shown). In contrast, no amplicon was detected when DNA of M. musicola was used.

Mycosphaerella fijiensis in vitro secretome induces necrosis on ‘Yangambi Km 5’ leaves To determine if the secreted proteins actually cause tissue damage, an inoculation was performed on the abaxial surface of the youngest fully unfolded leaf of in vitro grown ‘Yangambi Km 5’ plants with 20 mg of secreted protein extract. The in vitro proteins secreted by the avirulent fungal isolate produced few small tissue lesions of approximately 3.9  0.43 mm2 at 48 hpi;

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

6

L. Escobar-Tovar et al.

96 hpi, which were larger than those caused by the secreted proteins of the avirulent isolate (Fig 2B). In the susceptible Grand Naine cultivar, necrotic lesions induced by the extracellular proteins of the virulent isolate extended to 14.1  0.64 mm2 at 96 hpi and caused tissue necrosis (Fig 2C). As expected, no visible lesions were produced at 96 hpi on ‘Yangambi Km 5’ leaves inoculated with the protein rehydration buffer (Fig 2D).

The nature of the in vitro secretomes of the Mycosphaerella fijiensis isolates

Fig 1 e Characterization of M. fijiensis isolates. (A) Naturally infected and diseased M. acuminata var. ‘Yangambi Km 5’ and cv. Grand Naine leaves, from which the isolates were obtained. Arrows indicates large necrotic lesions corresponding to stage 6 symptom according to Foure’s scale. (B) Early events in colonization of ‘Yangambi Km 5’ leaves by the virulent and avirulent fungal isolates. Germinated conidia were stained with lactophenol blue (TB) at 8 dpi. Penetration of stomata is indicated by arrows. After this stage, the mycelium tissue colonized the intercellular space of mesophyll cells. Scale bar, 20 mm. (C) Abaxial side of ‘Yangambi Km 5’ leaves inoculated with a conidial suspension of virulent and avirulent fungal isolates, under controlled conditions, at 40 dpi. Necrotic lesions are indicated by arrows. (D) PCR of ITS region of M. fijiensis. Specific primers were used to detect a fragment of 1018 bp belonging to the ITS locus of M. fijiensis in the avirulent and virulent fungal isolates and in the positive control. DNA of M. musicola (negative control) did not produce amplicons.

lesion size remained constant at least until 96 hpi (Fig 2A). When leaves were inoculated with extracellular proteins collected from liquid cultures of the virulent isolate, necrotic lesions of approximately 8.8  0.36 mm2 were observed at

The representative secretome 2D gels of the avirulent and virulent Mycosphaerella fijiensis isolates, obtained from three biological replicates, are shown in Fig 3. Use of the MELANIE 7.0 software permitted the detection of 413 protein spots in the in vitro secretome of the avirulent M. fijiensis isolate, whereas 436 proteins spots were detected in the in vitro secretome of the virulent isolate. Proteins spots with molecular weights ranging from 8 to 123 kDa and pI values between 3 and 10 were detected, as shown. The information in Table 1 displays 90 proteins/isoforms that were identified by MS in the secretomes of the M. fijiensis isolates corresponding to 42 unique proteins; 15 protein spots (spots 1, 2, 3, 4, 5, 8, 9, 11, 46, 47, 58, 59, 95, 109 and 115) could not be confidently identified by MS. Additional information shown in Table S1 displays all peptides used to identify proteins/isoforms secreted by the fungal isolates. From 42 identified proteins, only 36 were predicted to have signal peptide sequences (Table 1). Information gathered from the TMHMM program indicated that none of the identified proteins were membrane proteins since they lacked transmembrane domains. Conversely, almost all identified proteins were predicted to have an extracellular localization according to the TargetP and WoLF PSORT programs (Table S1), further suggesting that the protein extraction protocol is suitable for investigation of the M. fijiensis secretome. Some of the identified fungal proteins were present in multiple spots with distinct pI values, possibly indicating post-translational modifications of the same gene product. The functional classification of the M. fijiensis unique secreted proteins was determined. Of these, 35 proteins possessed information on protein function whilst seven proteins were described as hypothetical in available protein databases. Many of the expressed proteins that were secreted by the M. fijiensis isolates were predicted to be involved in the degradation of plant derived compounds. These proteins were identified as exo-glucanases, cutinases, and pectate lyases, among others, indicating the importance of cell wall-related enzymes in the infection process of this fungus. Other important groups identified in the M. fijiensis secretome were proteases, represented by serine-proteases and glutamate carboxypeptidases, esterases, such as cholinesterases, feruloyl esterases and pectin esterases, in addition to enzymes that form part of metabolic pathways such as aldose 1epimerase and triosephosphate isomerase. Additionally, some poorly characterized fungal proteins such as cellobiose dehydrogenase, glyoxalase, cerato-platanin and cell wall protein PhiA were also identified (Table 1). Additionally, some isoforms of chitinase and the chitinolytic N-acetyl-beta-D-

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Comparative analysis of the in vitro and in planta secretomes

7

Fig 2 e Effect of the inoculation of the M. fijiensis proteins secreted in vitro on the abaxial surface of the youngest, fully unfolded in vitro ‘Yangambi Km 5’ and Grand Naine leaves under controlled conditions. (A) ‘Yangambi Km 5’ leaves inoculated with 20 mg of protein secreted by the avirulent fungal isolate. (B) ‘Yangambi Km 5’ leaves inoculated with 20 mg of protein secreted by the virulent isolate. (C) Grand Naine leaves inoculated with 20 mg of protein secreted by the virulent isolate. (D) ‘Yangambi Km 5’ leaf inoculated with the protein rehydration buffer, as a negative control. The inoculation sites consisted in small cuts made with a sterile scalpel. Arrows indicate necrotic lesions caused by fungal secreted proteins on ‘Yangambi Km 5’ leaves. In the susceptible Grand Naine, necrotic lesions extended to cause complete tissue death. In contrast, there were no visible lesions caused by the protein rehydration buffer when it was inoculated on ‘Yangambi Km 5’ leaves. Images were recorded at 96 hpi.

glucosaminidase enzymes were detected in the secretomes of M. fijiensis isolates. These are enzymes capable of altering the fungal cell wall structure, perhaps to adapt to changes in environmental conditions and/or to a vastly different milieu once the fungus penetrates plant tissues. Nevertheless, an important fraction of the fungal secretome included proteins having an unknown function (i.e. 24 %) or only a general predicted function (i.e. 9 %) (Fig 4A). RxLR-dEER and Y/F/WC motifs were not found into the sequences of unknown proteins in the secretome of both fungal isolates. Matched spots were assessed using ANOVA and Tukey’s tests to compare the differences in protein expression between the avirulent and virulent M. fijiensis in vitro secretomes. According to the comparative statistical analysis, a total of 35 protein spots identified by MS differed in their abundance or were uniquely secreted by either one of the fungal isolates (Table 2, Tables S2 and S3). Twenty five spots were present in greater abundance in the virulent M. fijiensis isolate compared to the avirulent isolate, 13 of which corresponded to unique proteins, whereas five spots, corresponding to two different proteins, showed higher accumulation in the avirulent fungal isolate when compared to the virulent isolate. Thirty spots corresponding to 20 unique proteins and seven spots corresponding to five unique proteins were specifically secreted by the virulent and avirulent isolates, respectively. From 35 differentially expressed unique proteins, only 26 were found to have predicted signal peptides, although some of the nine proteins lacking a signal peptide have been found experimentally to be secreted by other fungi (Table 2). Most of the differentially expressed proteins lacked transmembrane domains and were predicted to have extracellular localization (Table S3). Many of differentially expressed proteins in both fungal isolates were enzymes involved in modification of plant cell

wall, possibly to increase its permeability in order to allow faster penetration during infection. The virulent M. fijiensis isolate had a largest percentage of up-regulated glycosyl hydrolases (GHs) when compared to the avirulent isolate (Table 2 and Fig 4B). Peroxiredoxin isoforms were found in the secretome of the virulent fungal isolate only, indicating that they are probably an important virulence component of this isolate. Phenoloxidases, which form an important group of enzymes commonly associated with the production of melanins and which play an important role in fungal pathogenesis, were represented by different isoforms of up-regulated tyrosinases in the secretome of the virulent isolate. Other secreted enzymes differentially expressed in the M. fijiensis isolates and hypothesized to be involved in virulence, were an uncharacterized lipase, an acid trehalase, various cloroperoxidases, glutamate dehydrogenase isoforms, superoxide dismutases and cerato-platanin. Furthermore, the virulent fungal isolate had the highest percentage of unique and up-regulated unknown proteins with no indication of their possible function. Most of them were smaller than 17 kDa and were probably similar to effectors or pathogenicity factors needed for disease establishment. RxLR or Y/F/WC motif searches were performed in an attempt to identify novel secreted proteins or proteins with unknown function differentially secreted by both fungal isolates. The sequences were also examined for high cysteine content. No consensus or degenerative RxLR motifs situated in the N terminus were identified in the predicted, unknown, secreted proteins. However, spots 7, 114, 117 and 118, corresponding to the same protein, together with spot 121, were found to contain the YC motif in their sequence, which was in close proximity to the signal peptide (data not shown). This represents an interesting finding that merits further investigation.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

8

L. Escobar-Tovar et al.

Fig 3 e Two dimensional analysis of the in vitro secretomes of the M. fijiensis isolates. 2D gel profiles of M. fijiensis proteins secreted in vitro by the avirulent (A) and virulent (B) isolates. Molecular weight markers and pI ranges are indicated. Protein spots identified by MS are marked by arrows and numbered according to Table 1, Table 2, Table S1, Table S2 and Table S3.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Spot Protein accession numbera numberb

Protein description

Cellular processes and signaling Cell wall/membrane/envelope biogenesis 51 EME39308.1 Glycoside hydrolase family 17 protein 52 EME39308.1 Glycoside hydrolase family 17 protein Posttranslational modification, protein turnover, chaperones 61 XP_003857144.1 Subtilisin-like protease 62 EME38356.1 Subtilisin-like protein 168 EMR66064.1 Putative glutamate carboxypeptidase protein 169 EMR66064.1 Putative glutamate carboxypeptidase protein Signal transduction mechanisms 94 EMF13824.1 Cholinesterase 101 XP_003849555.1 Tyrosinase, partial 102 XP_003849555.1 Tyrosinase, partial 103 XP_003849555.1 Tyrosinase, partial Metabolism Energy production and conversion 30 XP_753622.2 Salicylate hydroxylase 108 ELA32851.1 FAD binding domain-containing protein 163 EMF11825.1 Malate dehydrogenase, NAD-dependent Amino acid transport and metabolism 113 EMF17457.1 Arginase/deacetylase Carbohydrate transport and metabolism 78 XP_003857743.1 Aldose 1-epimerase 81 XP_003857743.1 Aldose 1-epimerase 82 XP_003857743.1 Aldose 1-epimerase 97 EMF16003.1 Triosephosphate isomerase 126 EMF16003.1 Triosephosphate isomerase 127 EMF16003.1 Triosephosphate isomerase Lipid transport and metabolism 53 EMF16470.1 Tannase and feruloyl esterase 136 EMF16470.1 Tannase and feruloyl esterase Carbohydrate active enzymes (CAZy) Glycoside hydrolases (GHs) 54 XP_002487406.1 Endo-arabinase, putative 55 XP_002487406.1 Endo-arabinase, putative 56 XP_002487406.1 Endo-arabinase, putative 79 EKG11057.1 Six-hairpin glycosidase-like protein 80 EKG11057.1 Six-hairpin glycosidase-like protein 88 XP_003851857.1 N-acetyl-beta-D-glucosaminidase 89 XP_003849733.1 Alpha-1,2-mannosidase-like protein 90 XP_003849733.1 Alpha-1,2-mannosidase-like protein 91 XP_003854271.1 Putative beta-glucosidase 106 XP_003851857.1 N-acetyl-beta-D-glucosaminidase 110 EHY54159.1 Chitinase

Experimental Theoretical Matched Protein ID in the Signal Sequest Sequence [MW (kDa)/pI]c [MW (kDa)/pI]c peptides M. fijiensis genome peptided score coverage

38.0/3.72 38.0/3.60

58.7/4.67 58.7/4.67

4 4

216204 216204

Y Y

129.21 65.81

33.33 29.45

34.0/7.91 29.0/8.88 91.0/4.45 91.0/4.32

46.1/6.29 40.7/7.01 77.4/4.77 77.4/4.77

4 10 9 5

212921 35047 51270 51270

Y Y Y Y

132.24 246.15 52.12 215.55

24.60 51.53 12.69 25.07

45.0/4.47 34.0/4.62 36.0/5.21 40.0/5.24

62.9/4.50 85.5/5.20 85.5/5.20 85.5/5.20

2 8 2 2

134354 211783 211783 211783

Y Y Y Y

8.73 547.31 101.49 150.12

6.70 18.10 3.46 3.21

21.0/5.74 58.0/4.22 33.0/7.34

50.3/5.99 52.3/4.81 34.6/6.36

3 7 8

35872 186734 188930

N Y Y

47.06 145.12 85.38

8.38 22.37 44.94

10.0/6.52

43.5/5.59

4

129912

Y

43.70

5.93

52.0/5.48 52.0/5.03 52.0/5.19 25.0/6.63 24.0/5.98 24.0/6.36

43.8/5.32 43.8/5.32 43.8/5.32 26.9/5.88 26.9/5.88 26.9/5.88

6 5 7 3 7 8

89352 89352 89 352 52839 52839 52839

Y Y Y N N N

43.86 106.01 148.04 6.72 276.38 195.61

20.51 27.53 27.53 15.8 14.42 13.90

80.0/3.56 84.0/3.08

55.7/4.11 55.7/4.11

17 8

185007 185007

N N

1406.99 172.43

41.18 36.47

32.0/5.59 32.0/5.83 35.0/5.66 51.0/5.69 51.0/5.89 86.0/6.02 100.0/5.53 107.0/4.76 123.0/4.37 89.0/5.34 35.0/8.63

33.3/5.79 33.3/5.79 33.3/5.79 44.1/6.05 44.1/6.05 64.0/5.99 86.0/5.43 86.0/5.43 88.7/4.79 64.0/5.99 31.2/8.87

7 8 3 3 5 8 19 9 13 13 4

137750 137750 137750 211568 211568 49199 144702 144702 53765 49199 22691

N N N Y Y Y Y Y Y Y N

269.81 268.24 16.28 94.14 182.34 206.98 854.14 106.76 532.05 81.50 39.23

30.24 31.46 10.73 15.89 27.14 27.32 39.48 25.41 38.03 28.69 9.25

9

(continued on next page)

Comparative analysis of the in vitro and in planta secretomes

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 1 e The in vitro secreted proteins/isoforms by the avirulent and virulent M. fijiensis isolates.

10

Protein accession Spot numberb numbera 128 EHY54159.1 141 ADZ98860.1 142 XP_002487406.1 164 XP_003855997.1 Polysaccharide lyases (PLs) 49 EOO03315.1 50 EOO03315.1 83 ELA30738.1 Carbohydrate esterases (Es) 23 XP_003855273.1 35 XP_003855273.1 48 EJP70616.1 66 XP_006694183.1 154 XP_006694183.1 155 XP_006694183.1 Poorly characterized General function prediction only 84 XP_003849475.1

Experimental Theoretical Matched Protein ID in the Signal Sequest Sequence [MW (kDa)/pI]c [MW (kDa)/pI]c peptides M. fijiensis genome peptided score coverage

Chitinase Arabinofuranosidase Endo-arabinase, putative Putative exo-beta-1,3-glucanase

37.0/9.32 33.0/6.03 30.0/6.30 39.0/5.93

31.2/8.87 36.4/5.97 33.3/5.79 47.2/6.08

9 4 3 11

22691 46143 137750 52285

N Y N Y

263.05 100.26 35.49 411.44

29.44 41.24 22.78 15.34

Putative pectate lyase protein Putative pectate lyase protein Rhamnogalacturonase b

36.0/4.07 37.0/3.96 58.0/4.69

32.9/4.83 32.9/4.83 56.1/4.96

5 5 9

84159 84159 186852

Y Y Y

338.63 126.30 365.11

28.30 28.30 38.99

Cutinase Cutinase Cutinase-like protein Pectinesterase-like protein Pectinesterase-like protein Pectinesterase-like protein

20.0/3.31 27.0/3.39 26.0/4.29 42.0/3.81 41.0/3.32 39.0/3.67

25.4/4.32 25.4/4.32 24.1/4.93 34.5/4.24 34.5/4.24 34.5/4.24

3 7 4 6 3 6

39497 39497 57944 48229 48229 48229

Y Y Y Y Y Y

41.18 458.52 22.65 296.71 113.72 279.91

34.91 43.21 3.72 36.78 22.59 36.78

61.0/6.30

58.9/6.75

14

77759

Y

530.51

36.13

61.0/6.57

58.9/6.75

13

77759

Y

446.80

36.34

60.0/6.86

58.9/6.75

13

77759

Y

754.19

36.76

80.0/5.56 69.0/6.09

65.1/5.44 58.9/6.75

10 3

89063 77759

Y Y

511.54 5.88

44.75 7.35

68.0/6.40

58.9/6.75

3

77759

Y

5.81

8.78

EPE25616.1 EKD20028.1

Cellobiose dehydrogenase/glucose-methanol-choline oxidoreductase, partial Cellobiose dehydrogenase/glucose-methanol-choline oxidoreductase, partial Cellobiose dehydrogenase/glucose-methanol-choline oxidoreductase, partial Glucose-methanol-choline oxidoreductase Cellobiose dehydrogenase/glucose-methanol-choline oxidoreductase, partial Cellobiose dehydrogenase/glucose-methanol-choline oxidoreductase, partial Glyoxalase Glucose-methanol-choline oxidoreductase

29.0/6.05 70.0/5.57

29.4/5.75 62.0/5.82

7 16

213752 142650

N Y

325.11 627.85

55.39 41.40

EMF14096.1 EKG15107.1 EKG15107.1 EKG15107.1 EKG15107.1 EKG15107.1 XP_003008313.1 XP_003008313.1 EKG15107.1 EKG15107.1 XP_001257319.1 XP_001257319.1 EKG15107.1 EMF12490.1

Cerato-platanin Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA Cell wall protein PhiA IgE-binding protein IgE-binding protein Cell wall protein PhiA WSC-domain-containing protein

14.0/5.20 18.8/4.00 18.0/4.01 18.0/3.84 19.0/3.83 18.0/3.28 30.0/4.67 30.0/4.98 17.0/4.53 17.0/4.21 30.0/3.39 32.0/3.40 8.0/3.98 13.0/3.38

12.6/6.90 19.8/5.32 19.8/5.32 19.8/5.32 19.8/5.32 19.8/5.32 31.0/5.26 31.0/5.26 19.8/5.32 19.8/5.32 20.2/4.47 20.2/4.47 19.8/5.32 13.4/4.75

7 5 5 5 5 3 5 9 8 5 3 6 2 2

137490 210559 210559 210559 210559 210559 211515 211515 210559 210559 81493 81493 210559 77734

Y Y Y Y Y Y Y Y Y Y Y Y Y Y

797.80 619.28 138.38 231.00 138,02 112.23 60.82 207.21 532.46 285.29 104.67 96.79 12.15 79.30

87.50 54.97 34.03 50.26 34.00 16.23 28.72 34.12 75.39 47.64 25.51 26.53 16.67 24.43

85

XP_003849475.1

86

XP_003849475.1

87 104

EKG12247.1 XP_003849475.1

105

XP_003849475.1

167 171 Miscellaneous 12 18 19 20 21 22 40 41 63 64 99 100 116 156

Protein description

L. Escobar-Tovar et al.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 1 e (continued )

a b c d

Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical

protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein protein

16.0/5.17 15.0/4.64 16.0/4.70 16.0/4.29 16.0/4.32 17.0/3.00 18.0/7.32 19.0/5.40 21.0/4.99 22.0/5.00 21.0/4.62 22.0/4.70 34.0/3.53 20.0/4.16 18.0/6.55 17.0/5.52 19.0/5.99 18.0/6.94 21.0/6.31 24.0/3.68 14.0/5.17 18.0/6.36

20.4/5.89 20.4/5.89 20.4/5.89 20.4/5.89 20.4/5.89 20.4/5.89 19.9/7.74 20.7/5.60 20.6/6.07 20.6/6.07 20.6/6.07 20.6/6.07 26.8/4.22 20.1/4.67 19.9/7.74 19.9/7.74 20.6/6.07 19.9/7.74 19.9/7.74 25.8/4.87 20.4/5.89 19.9/7.74

12 9 11 10 11 7 7 2 8 7 5 5 4 2 7 6 6 12 6 6 9 7

210027 210027 210027 210027 210027 210027 88023 181415 210733 210733 210733 210733 80396 85220 88023 88023 210733 88023 88023 87993 210027 88023

Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y

1882.24 790.56 1826.62 872.50 1449.52 91.79 267.48 6.68 272.30 168.47 76.25 34.63 677.12 9.68 244.80 29.14 97.72 425.78 31.07 227.51 424.60 207.85

80.00 72.35 77.06 72.35 77.06 67.06 48.65 15.54 45.64 45.64 33.33 35.90 54.37 10.64 50.81 42.16 45.64 61.62 42.16 41.00 60.59 61.62

Comparative analysis of the in vitro and in planta secretomes

Spots were numbered according to Fig 2. GenBank general information identifier. MW: molecular weight, pI: isoelectric point. SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide.

11

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Unclassified proteins 13 EMF13439.1 14 EMF13439.1 15 EMF13439.1 16 EMF13439.1 17 EMF13439.1 25 EMF13439.1 28 EMF09223.1 29 EME43651.1 31 EME83924.1 32 EME83924.1 33 EME83924.1 34 EME83924.1 36 EMF12739.1 65 EMF10163.1 96 EMF09223.1 120 EMF09223.1 122 EME83924.1 123 EMF09223.1 124 EMF09223.1 130 EME81258.1 159 EMF13439.1 161 EMF09223.1

12

L. Escobar-Tovar et al.

Fig 4 e Prediction of biological functions categories of the M. fijiensis proteins secreted in vitro. (A) Functional category classification of proteins identified in the in vitro secretomes of both the avirulent and virulent M. fijiensis isolates. (B) Functional category classification of secreted proteins differentially expressed in vitro by the avirulent and virulent fungal isolates. Protein classification was performed using The euKaryotic Orthologous Groups (KOG) and the Carbohydrate-Active enZYmes (CAZY) databases.

The in planta secretomes of the Mycosphaerella fijiensis isolates A comparative analysis of proteins secreted in planta by the two different Mycosphaerella fijiensis isolates was performed with three biological replicates from each secretome. Extracellular proteins were extracted from ‘Yangambi Km 5’ leaves inoculated 12 d earlier with conidia of the avirulent or virulent fungal isolates. Likewise, proteins extracted from the apoplastic fluid of leaves of healthy ‘Yangambi Km 5’ plants grown in vitro were separated by 2D gels as a reference. One hundred and forty seven protein spots were not considered for the comparative secretome analyses because they were secreted by the host in the absence of the fungus (Fig 5A). Thus, 50 protein spots were detected in the proteome analyses, secreted in planta either by the avirulent M. fijiensis isolate or by ‘Yangambi Km 5’ plants in response to the fungus (Fig 5B). On the other hand, 101 proteins spots were secreted in planta either by the virulent isolate or by ‘Yangambi Km 5’ plants in response to the fungus (Fig 5C). Most of the spots detected in the 2D gels represented medium and low molecular weight proteins and very few of them consisted of high molecular weight proteins. Twelve protein spots secreted by both fungal isolates in contact with ‘Yangambi Km 5’ leaves were identified by MS, corresponding to 9 different proteins, and were analyzed for the presence of predicted signal peptides. Barring a transaldolase and a putative endo-arabinase, all the remaining proteins had signal peptides. Various enzymes identified were involved in carbohydrate transport and metabolism (i.e. 34 %), while 8 % of the proteins were identified as GHs and 58 % of them were annotated as unclassified proteins (Table 3 and Fig 6A). Fungal transaldolase, adenosine kinase isoforms and the unknown 201852 protein were only found in the in planta secretomes. On the other hand, aldose 1-epimerase, endoarabinase and unknown 210733, 181415, 210027, and 88023 proteins were secreted in vitro and in planta by both the avirulent and virulent M. fijiensis isolates. Approximately 10 % of the enzymes detected in the in planta secretomes are involved in carbohydrate transport and metabolism, and 10 % of GHs showed differential

expression, depending on which fungal isolate had been inoculated into the host (Fig 6B). Most of the up-regulated, unique proteins secreted in response to the inoculation of the virulent isolate into ‘Yangambi Km 5’ leaves are known to play an important role in stress adaptation and pathogenicity. Representative examples are a subtilisin-like protein, heme-thiolate peroxidase, haloacid dehalogenase and cerato-platanin. Additionally, the Ecp2 effector, presents in the pathogenic fungus Cladosporium fulvum, was identified in the protein mixture secreted by the virulent M. fijiensis isolate when in contact with the host leaf. Conversely, it was absent in the in planta secretome produced by the avirulent fungal isolate, perhaps because it was not secreted or was secreted at very low, undetectable amounts (Table 4). Furthermore, the unknown 80396 secreted protein, which did not differ significantly between the avirulent and virulent fungal isolates produced in vitro, was up-regulated by the virulent isolate in presence of the host. Additionally, the unknown 39450 secreted protein identified only in the virulent fungal isolate secretome, was also similarly identified in the in planta secretome produced in the presence of the virulent fungal isolate only, making it a potential virulence and pathogenicity factor. Conversely, the presence of various proteases in the in vitro and in planta secretomes of the M. fijiensis isolates was expected, considering that many pathogen fungi are known to secrete a variety of proteases, which are believed to be closely associated with disease progression. Accordingly, proteolytic activity, assayed using N-succinylated casein as substrate, was determined in the protein extracts of the avirulent and virulent M. fijiensis isolates. It was determined that equivalent concentrations of protein extracts from both fungal isolates did not produce the same level of activity with respect to digestion of the succinylated casein substrate. Thus, the avirulent and virulent isolate protein extracts had 1.17 mg ml1 and 2.93 mg ml1 with respect to the proteolytic activity of trypsin, respectively. Moreover, activity of two, differentially secreted, metallo- and a serine-protease was detected in the secretomes of M. fijiensis isolates, which was inhibited, accordingly, by the action of EDTA, and phenylmethylsulfonylfluoride (PMSF), aprotinin and leupeptin, respectively (data not shown).

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Protein accession Spot numberb numbera

Protein description

Cellular processes and signaling Posttranslational modification, protein turnover, chaperones 60 EMF14061.1 Subtilisin-like protein 119 EMF17339.1 Peroxiredoxin-2D 157 EMF17339.1 Peroxiredoxin-2D 158 EMF17339.1 Peroxiredoxin-2D Signal transduction mechanisms 75 XP_001823642.2 Tyrosinase 76 XP_001823642.2 Tyrosinase 77 XP_001823642.2 Tyrosinase 93 XP_001823642.2 Tyrosinase 137 XP_003849555.1 Tyrosinase, partial 138 XP_003849555.1 Tyrosinase, partial 139 XP_003849555.1 Tyrosinase, partial 140 XP_003849555.1 Tyrosinase, partial 170 EMF16108.1 Extracellular lipase 172 XP_003849555.1 Tyrosinase, partial Metabolism Energy production and conversion 57 EMF15780.1 Malate dehydrogenase 67 ELA32851.1 FAD binding domain-containing protein 68 ELA32851.1 FAD binding domain-containing protein 69 ELA32851.1 FAD binding domain-containing protein 70 EPE28884.1 Cloroperoxidase 107 EMF12738.1 FAD-binding domain-containing protein 129 EMF08575.1 Di-copper centre-containing protein 143 EPE26857.1 Cloroperoxidase 145 XP_003665852.1 Pyridine nucleotide-disulfide oxidoreductase-like protein Amino acid transport and metabolism 144 EMF08511.1 NADP-specific glutamate dehydrogenase 148 EMF08511.1 NADP-specific glutamate dehydrogenase Carbohydrate transport and metabolism 146 EMF13869.1 Glucose-6-phosphate isomerase 147 EMF13869.1 Glucose-6-phosphate isomerase 149 ETS87415.1 Exo-beta-D-glucosaminidase Inorganic ion transport and metabolism 26 EMF13078.1 Superoxide dismutase 27 EMF13078.1 Superoxide dismutase 44 EMF16693.1 Superoxide dismutase [Mn] 45 EMF16693.1 Superoxide dismutase [Mn]

Experimental Theoretical Matched Protein ID in Signal Sequest Sequence [MW (kDa)/pI]c [MW (kDa)/pI]c peptides the M. fijiensis peptided score coverage genome

Differential expressione

35.0/7.30 16.0/5.24 16.0/5.39 16.0/5.07

32.2/5.94 18.4/5.67 18.4/5.67 18.4/5.67

4 6 9 6

35823 55714 55714 55714

Y N N N

18.95 94.29 333.74 232.54

17.72 67.07 82.63 64.67

Avir Vir Vir Vir

49.0/5.07 48.0/5.24 49.0/5.48 45.0/5.24 49.0/4.70 49.0/4.58 46.0/4.59 47.0/4.71 60.0/5.37 47.0/6.45

44.3/5.43 44.3/5.43 44.3/5.43 44.3/5.43 85.5/5.20 85.5/5.20 85.5/5.20 85.5/5.20 61.5/6.01 85.5/5.20

11 15 12 5 10 10 8 7 15 10

210572 210572 210572 210572 211783 211783 211783 211783 57762 211783

Y Y Y Y Y Y Y Y Y Y

380.17 592.08 258.39 120.19 795.82 747.58 178.12 645.75 756.74 1158.24

37.15 40.20 35.37 22.14 23.13 23.13 19.54 15.15 42.16 14.79

Up-regulated Up-regulated Up-regulated Up-regulated Up-regulated Up-regulated Vir Vir Up-regulated Up-regulated

34.0/6.40 53.0/4.23 53.0/4.10 53.0/3.98 50.0/4.09 61.0/5.06 41.0/9.63 42.0/6.18 51.0/6.60

36.3/8.95 52.3/4.81 52.3/4.81 52.3/4.81 44.6/4.51 59.9/5.31 68.7/6.75 46.5/5.80 43.6/5.55

5 4 6 6 6 5 11 7 5

88245 186734 186734 186734 118760 215822 60660 141402 211423

Y Y Y Y N N Y Y Y

21.53 70.25 139.62 114.43 57.70 38.61 168.44 398.73 251.26

4.05 22.15 35.92 28.79 22.60 25.85 22.92 61.37 35.97

Down-regulated Avir Avir Avir Up-regulated Up-regulated Vir Vir Vir

47.0/6.45 47.0/6.17

48.1/6.11 48.1/6.11

7 15

214559 214559

N N

98.58 672.83

39.52 63.21

Vir Vir

55.0/6.29 55.0/6.41 100.0/6.04

61.1/5.97 61.1/5.97 97.9/5.60

15 7 18

87318 87318 86684

N N Y

351.30 109.71 468.88

50.82 42.05 17.02

Vir Vir Vir

16.0/6.29 16.0/6.57 27.0/6.39 27.0/6.65

15.8/6.10 15.8/6.10 27.4/6.10 27.4/6.10

5 8 7 8

210905 210905 209655 209655

N N N N

134.90 235.29 264.87 260.70

57.14 76.62 37.50 38.71

Up-regulated Up-regulated Up-regulated Up-regulated

Comparative analysis of the in vitro and in planta secretomes

(continued on next page)

13

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 2 e Differentially expressed in vitro secreted proteins/isoforms by the avirulent and virulent M. fijiensis isolates.

14

Protein accession Spot numberb numbera

Protein description

Carbohydrate active enzymes (CAZy) Glycoside hydrolases (GHs) 37 EMF13167.1 Glycoside hydrolase family 17 protein 38 EMF13167.1 Glycoside hydrolase family 17 protein 39 EMF13167.1 Glycoside hydrolase family 17 protein 42 EOD51808.1 Putative glycoside hydrolase family 16 protein 71 EOD48695.1 Putative-beta-glucanosyltransferase gel1 protein 72 EOD48695.1 Putative-beta-glucanosyltransferase gel1 protein 73 EOD48695.1 Putative-beta-glucanosyltransferase gel1 protein 74 EOD48695.1 Putative-beta-glucanosyltransferase gel1 protein 125 EOD51808.1 Putative glycoside hydrolase family 16 protein 131 XP_003856938.1 Putative glucan 1,3-beta-glucosidase, exo-beta-1,3-glucanase 132 XP_003856938.1 Putative glucan 1,3-beta-glucosidase, exo-beta-1,3-glucanase 133 XP_003856938.1 Putative glucan 1,3-beta-glucosidase, exo-beta-1,3-glucanase 134 EOD51808.1 Putative glycoside hydrolase family 16 protein 135 EMF13167.1 Glycoside hydrolase family 17 protein 150 XP_003852313.1 Putative beta-glucosidase 152 XP_003852859.1 Putative alpha-glucosidase 153 XP_003856938.1 Putative glucan 1,3-beta-glucosidase, exo-beta-1,3-glucanase 165 EME47787.1 Glycoside hydrolase family 79 protein 166 EME47787.1 Glycoside hydrolase family 79 protein Carbohydrate-binding modules (CBMs) 92 EMF14725.1 Carbohydrate-binding module family 21, glycoside hydrolase family 15 protein 151 XP_003854603.1 Putative acid trehalase Poorly characterized General function prediction only 43 EMF14919.1 Hydroxyacylglutathione hydrolase Miscellaneous 10 ELA24175.1 Secreted protein 24 EOD52258.1 Putative small secreted protein 160 EMF14096.1 Cerato-platanin Unclassified proteins 6 EME89099.1 Hypothetical protein 7 EME80563.1 Hypothetical protein 98 EME43949.1 Hypothetical protein 111 EME89099.1 Hypothetical protein 112 EME89099.1 Hypothetical protein 114 EME80563.1 Hypothetical protein

Experimental Theoretical Matched Protein ID in Signal Sequest Sequence [MW (kDa)/pI]c [MW (kDa)/pI]c peptides the M. fijiensis peptided score coverage genome

Differential expressione

30.0/4.05 30.0/4.19 30.0/4.39 29.0/5.49 45.0/4.58 45.0/4.72 47.0/4.63 46.0/4.80 25.0/5.69 30.0/4.77

26.3/4.86 26.3/4.86 26.3/4.86 27.6/6.02 47.6/5.17 47.6/5.17 47.6/5.17 47.6/5.17 27.6/6.02 33.0/4.95

9 9 4 3 7 5 5 12 5 18

6274 6274 6274 204877 209620 209620 209620 209620 204877 55415

N N N Y Y Y Y Y Y Y

627.33 514.35 97.84 49.99 127.17 73.86 82.44 99.97 146.18 685.80

35.07 35.07 37.69 32.73 37.74 9.72 43.16 31.13 45.00 62.33

Up-regulated Up-regulated Up-regulated Up-regulated Down-regulated Down- regulated Down-regulated Down-regulated Vir Vir

30.0/4.60

33.0/4.95

19

55415

Y

992.96

73.00

Vir

30.0/4.45

33.0/4.95

17

55415

Y

800.41

66.33

Vir

29.0/5.10 30.0/3.00 127.0/5.06 149.0/4.05 33.0/3.13

27.6/6.02 26.3/4.86 98.5/5.48 109.7/4.72 33.0/4.95

6 9 3 5 4

204877 6274 206185 215102 55415

Y N Y Y Y

280.44 320.30 41.39 163.78 12.77

45.00 69.44 7.43 11.67 22.63

Up-regulated Vir Vir Vir Vir

60.0/7.86 60.0/8.36

57.2/8.15 57.2/8.15

8 9

215037 215037

Y Y

217.95 149.97

39.14 26.22

Vir Vir

102.0/3.94

70.1/4.41

16

36361

Y

593.07

34.74

Up-regulated

175.0/4.42

111.0/4.60

4

158264

Y

85.89

10.97

Vir

27.0/6.11

27.1/6.68

7

59761

N

87.55

51.21

Up-regulated

11.0/4.15 19.0/3.52 12.0/5.18

13.1/4.87 15.0/4.58 12.6/6.90

2 2 3

211186 83583 137490

Y Y Y

15.05 8.22 62.75

3.43 22.30 64.29

Avir Avir Vir

9.0/8.52 8.0/6.38 26.0/4.74 9.0/7.06 9.0/6.70 8.0/5.67

13.1/6.87 12.5/6.00 20.9/5.20 13.1/6.87 13.1/6.87 12.5/6.00

4 3 2 4 4 3

209987 204618 199440 209987 209987 204618

Y Y Y Y Y Y

257.64 75.72 62.40 85.66 52.44 84.83

45.38 38.94 8.90 45.38 45.38 37.17

Up-regulated Up-regulated Avir Vir Vir Vir

L. Escobar-Tovar et al.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 2 e (continued )

a Spots were numbered according to Fig 2. b GenBank general information identifier. c MW: molecular weight, pI: isoelectric point. d SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide. e Avir: protein/isoform secreted by the avirulent fungal isolate, Vir: protein/isoform secreted by the virulent fungal isolate, up-regulated: protein/isoform secreted in greater abundance by the virulent fungal isolate compared to the avirulent isolate, down-regulated: protein/isoform secreted in lower abundance by the virulent fungal isolate compared to the avirulent isolate.

117 118 121 162

EME80563.1 EME80563.1 XP_001397381.2 EUC41499.1

Hypothetical Hypothetical Hypothetical Hypothetical

protein protein protein protein

8.0/6.03 8.0/6.24 17.0/4.39 20.0/6.50

12.5/6.00 12.5/6.00 19.9/4.95 18.8/6.18

3 4 5 5

204618 204618 39450 131203

Y Y Y Y

97.59 167.32 33.01 92.08

38.94 44.25 27.68 66.29

Up-regulated Up-regulated Vir Vir

Comparative analysis of the in vitro and in planta secretomes

15

Proteins secreted by ‘Yangambi Km 5’ ‘Yangambi Km 5’ leaves were found to secrete defense-related proteins in response to the fungal isolates, perhaps as a protective mechanism designed to avoid possible infection by the pathogen. Thus, a chitinase and a peroxidase were found to be secreted by the host after infection with the Mycosphaerella fijiensis isolates (Table 5), probably in response to fungal elicitors. However, two defense-related wound-induced WIN1 protein isoforms with a chitin binding domain, and a peroxidase 4-like protein were induced in ‘Yangambi Km 5’ leaves after infection with the virulent fungal isolate only (Table 6).

Discussion The breakdown of pathogen resistance in formerly immune plant varieties has been reported in various crop-pathogen systems. Kiyosawa (1982) reviewed some cases of disease resistance, in which the durability of pathogen resistance of wheat varieties to stripe rust, caused by Puccinia striiformis, was found to be of approximately 5.5 y, in the United States. For the rice blast disease (caused by Magnaporthe grisea) in Japan, the longevity resistance stability of rice varieties containing various resistance genes was similarly found to last less than 3 y. Fullerton & Olsen (1995) documented the first case of breakdown of Musa resistance to Mycosphaerella fijiensis when they inoculated 63 strains of the fungus, obtained from various Musa hosts in a range of different countries and localities, to juvenile plants of a standard set of Musa genotypes. Some genotypes (e.g., SF215, Saimea and Grand Naine) were susceptible to practically all isolates. Others (e.g., T8 and Calcutta) were resistant to some isolates but susceptible to others. These observations suggest that individual strains had consistent but different patterns of pathogenicity on the host. The Paka and T8 Musa genotypes case is a suitable example of this phenomenon, considering that, initially, both genotypes were highly resistant to black Sigatoka, but later, in 1989, both varieties became susceptible. Virulence on the Paka genotype was not found in strains isolated from diseased Cavendish plants in the same locality 3 y earlier. The rapid change in the responses of field and glasshouse cultivated plants to strains collected before and after the event confirmed that there had been changes within the pathogen population that led to virulence on Paka. Climatic differences between different areas can also significantly affect symptom expression of the Sigatoka diseases. In addition, breakdown of resistant varieties may be caused by mutated pathogens which become more virulent, sexual or asexual recombination, acreage of resistant varieties, genetic uniformity of varieties and lowering of field resistance (Kiyosawa 1982). The objective of this study was to test strains of M. fijiensis with defined, differential virulence on banana, in order to determine which protein factors may contribute to fungal pathogenicity and, perhaps, to the breakdown of resistance in the ‘Yangambi Km 5’ variety. In this study, a proteomic strategy with 2D gels was applied for the first time to identify proteins secreted by the M. fijiensis isolates with differing pathogenicity. Interestingly, fungal isolates grew in vitro at relatively

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

16

Fig 5 e Two dimensional analysis of the in planta secretomes of the M. fijiensis isolates. (A) 2D gel profile of proteins extracted from the apoplastic fluid of ‘Yangambi Km 5’ healthy leaves. 2D gel profiles of the M. fijiensis proteins secreted by the avirulent (B) and virulent (C) isolates in ‘Yangambi Km 5’ leaves at 9 dpi. Molecular weight markers and pI ranges are indicated. Protein spots identified by MS are marked by arrows and numbered according to data listed in Table 3, Table 4, Table S4, Table S5 and Table S6.

L. Escobar-Tovar et al.

similar rates (data not shown). To obtain a representative overview of the secretome of M. fijiensis, it was necessary to standardize and optimize the extraction protocol of proteins secreted in vitro by first precipitating proteins with TCA, resolubilizing them in an extraction buffer containing sucrose, followed by a clean-up step with phenol and an additional precipitation with ammonium acetate in methanol. This methodology permitted the high resolution detection of approximately 400 protein spots on 2D patterns, which were distributed along the pH 3e10 range. Most of proteins secreted by both avirulent and virulent M. fijiensis isolates were predicted to have signal peptide sequences. However, proteins lacking a predicted N-terminal signal peptide sequence were also detected in the respective secretomes. Similarly, Yang et al. (2012) identified 21 out of 71 unique proteins that lacked the predicted N-terminal signal peptides in the secreted proteome of Fusarium graminearum, cultured with barley or wheat flour as the only nutrient source. Several factors could be responsible for this result, including secretion via yet unknown or non-classical pathways, as demonstrated in fungi such as Saccharomyces cerevisiae, Candida albicans and Aspergillus fumigatus (Yang et al. 2012) and/or due to miscoding of sequence databases or in silico prediction errors (Wang et al. 2013). Lysis of fungal cells during growth or protein extraction could have also contributed to this unexpected finding. However, cell lysis would have led to the detection of highly abundant intracellular proteins in the secreted proteome (Shah et al. 2009), which was not the case in this study. Almost all host plant surfaces are coated by a waxy cuticle, which represents the first barrier to pathogen entry. The plant cell wall, localized just underneath the cuticle, consists of cellulose microfibrils cross-linked by an amorphous matrix of hemicellulose and pectin, often encased in lignin polymers as the plant matures (Brown et al. 2012). Both the avirulent and virulent M. fijiensis isolates secrete an array of proteins and enzymes that target the plant cuticle and several cellwall related carbohydrates, including callose, pectin, cellobiose, arabinose and mannose, among others (Table 1). Curiously, no members of the GH family 61 associated with enzymes that facilitate cellulose breakdown, were found in this study. This absence was consistent with a previous study reporting that Mycosphaerella graminicola possessed only two members of this GH family (do Amaral et al. 2012). Hence, we hypothesize that partial polysaccharide hydrolysis could weaken the cell wall structure and consequently increase its plasticity, but not lead to full tissue collapse, which could interfere with fungal development in the early stages of infection. In contrast, M. fijiensis secreted proteins which are not involved in plant cell degradation, but are associated with metabolism or pathogenicity. The presence of a diverse set of extracellular metabolic enzymes suggests that this pathogenic fungus can interfere in several plant metabolic pathways, thereby modifying the production of metabolites such that if favors the growth of the fungus (Mueller et al. 2008). One of the pathogenicity factors detected was salicylate hydroxylase, which is capable of degrading salicylic acid (SA), a crucial plant defense signaling molecule. SA has been shown to be required for maintaining basal defense against Fusarium in the floral tissues of Arabidopsis, while a delay in SA signaling

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Spot numbera

Protein accession numberb

Metabolism Carbohydrate transport and metabolism 13 EMF13077.1 16 XP_003857743.1 17 EME85398.1 20 EME85398.1 Carbohydrate active enzymes (CAZy) Glycoside hydrolases (GHs) 21 XP_002487406.1 Poorly characterized Unclassified proteins 7 EME83924.1 8 EME83924.1 9 EME43651.1 10 EMF13439.1 12 EME49198.1 15 EME43651.1 22 EMF09223.1 a b c d

Protein description

Experimental [MW (kDa)/pI)c

Theoretical [MW (kDa)/pI)c

Matched peptides

Protein ID in the M. fijiensis genome

Signal peptided

Sequest score

Sequence coverage

Transaldolase Aldose 1-epimerase Adenosine kinase Adenosine kinase

35.0/5.66 51.0/5.28 46.0/5.44 40.0/5.24

35.8/5.95 43.8/5.32 37.6/5.45 37.6/5.45

11 9 7 3

210907 89352 71050 71050

N Y Y Y

53.51 253.30 48.42 9.89

39.20 28.93 23.68 12.87

Endo-arabinase, putative

32.0/5.51

33.3/5.79

10

137750

N

326.88

27.49

Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical

20.0/4.70 22.0/5.21 22.0/4.99 16.0/4.76 26.0/4.29 20.0/4.05 18.0/7.27

20.6/6.07 20.6/6.07 20.7/5.60 20.4/5.89 18.6/4.97 20.0/4.16 19.9/7.74

6 3 6 8 7 7 7

210733 210733 181415 210027 201852 181415 88023

Y Y Y Y Y Y Y

239.91 248.66 37.65 611.20 433.72 506.56 688.44

36.41 32.82 29.53 60.59 41.24 42.49 48.65

protein protein protein protein protein protein protein

Comparative analysis of the in vitro and in planta secretomes

Spots were numbered according to Fig 5. GenBank general information identifier. MW: molecular weight, pI: isoelectric point. SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide.

17

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 3 e The in planta secreted proteins/isoforms by the avirulent and virulent M. fijiensis isolates.

18

L. Escobar-Tovar et al.

Fig 6 e Prediction of biological functions categories of the M. fijiensis proteins secreted in planta. (A) Functional category classification of proteins identified in the in planta secretomes of both the avirulent and virulent M. fijiensis isolates. (B) Functional category classification of secreted proteins differentially expressed in planta by the avirulent and virulent fungal isolates. Protein classification was performed according to The euKaryotic Orthologous Groups (KOG) and the CarbohydrateActive enZYmes (CAZY) databases.

has been associated with increased Fusarium susceptibility in wheat ears (Brown et al. 2012). Another possible pathogenicity factor was cerato-platanin, a secreted protein that acts as an elicitor and, in some cases, enhances pathogenicity (Pazzagli et al. 1999). Genes coding for proteins similar to the ceratoplatanin detected in this study have previously been identified
et al. 2006). Proteins such as in other pathogenic fungi (Chague triosephosphate isomerase and cell-wall PhiA were similarly detected in the secretomic analyses of the M. fijiensis isolates. Interestingly, these proteins have been shown to have a positive relationship with virulence (Pereira et al. 2007) and may also be strong allergens (Glaser et al. 2009). There were unique up-regulated proteins, detected only in the in vitro secretome of the virulent M. fijiensis isolate that could explain the aggressiveness of this strain. Representative examples were several other GHs and enzymes involved in fungal metabolism. Other cell compounds targeted by the up-regulated secreted proteins were plant lipids, which have been proposed to represent one of the signals required for the filamentous growth of Ustilago maydis in the host environment (Klose et al. 2004). Lipases aid in the partial degradation of the host cell walls and play an important role in wax layer penetration and surface adhesion. Moreover, cutinases, serine-esterases, lipases and other non-specified esterases are reported to be involved in the adhesion of several plant € ller pathogenic fungi, for instance, Alternaria brassicicola (Ko et al. 1995) and Colletotrichum graminicola (Pascholati et al. 1993). Several up-regulated manganese and Copper/Zinc superoxide dismutases were identified in the secretomes. These proteins are part of the physiological response to oxygen toxicity and are potentially involved in the establishment of pathologic conditions related to oxidative stress. Conversely, the generation of reactive oxygen species (ROS) has been associated with defense responses in plantefungus interactions
lez-Ferna
ndez et al. 2014). (Rolke et al. 2004; Gonza Seven up-regulated tyrosinase isoforms were exclusively identified in the in vitro secretome of the virulent isolate. This interesting finding might explain why the liquid medium of the virulent M. fijiensis isolate was darker than that of the avirulent isolate. Tyrosinase is a catechol oxidase that

catalyses a two-step oxidation of tyrosine, an enzyme involved in the melanin biosynthesis pathway. Melanins are thought to play a protective role in pathogenicity, since they are important in the protection against UV irradiation, enzymatic lysis, oxidants, and in some instances, temperature extremes (reviewed in Butler & Day 1998; Jacobson 2000). Many of these features influence fungal persistence and may determine the level of severity or aggressiveness of the invasive attack on crops. Peroxiredoxin, a protein also exclusively detected in the virulent fungal isolate secretome, plays an essential role as an an~ eyro et al. (2008) tioxidant due to its peroxidase activity. Pin demonstrated that parasites overexpressing peroxiredoxins showed a significant increase in infectivity with respect to the controls and concluded that Trypanosoma cruzi peroxiredoxins are important in the survival, replication and differentiation of parasites and could constitute virulence factors. Chloroperoxidase was another protein found to be secreted only by the virulentfungal isolate. Its possible role in virulence is supported by a previous report that identified this protein as a secreted virulence factor in Serratia marcescens (Hejazi & Falkiner 1997). Glutamate dehydrogenase and acid trehalase proteins, associated with the pathogenic potential of a microorganism, were also secreted exclusively by the virulent M. fijiensis isolate (Hammer & Jhonson 1988; Tournu et al. 2013). For Phytophthora pathogens, a domain characterized by the aa motif RxLR-dEER is sufficient to deliver effectors into host cells. Not surprisingly, this domain has been found in all oomycete Avr proteins and Avr homologs (Govers & Bouwmeester 2008). Following this lead, all unknown proteins secreted by the M. fijiensis isolates were inspected for the presence of this motif; however, no matching sequences were found. Conversely, when effector candidate proteins were searched for the Y/F/WC motif in the N-terminal domain, two proteins were found with a mature length of <165 aa, in which cysteine residues represented over 5 % of the mature protein length sequence. The degenerative Y/F/WC motif discovered in Blumeria graminis f. sp. hordei has been proposed to be conserved among some intracellular ascomycetes effector proteins (Godfrey et al. 2010). Brown et al. (2012) and do Amaral et al. (2012) reported similar results showing that no

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Spot numbera

Protein accession numberb

Protein description

Cellular processes and signaling Posttranslational modification, protein turnover, chaperones 14 EMF14061.1 Subtilisin-like protein Metabolism Energy production and conversion 3 EMR80434.1 Putative heme-thiolate peroxidase aromatic peroxygenase protein Carbohydrate transport and metabolism 1 EMF16024.1 NAD-dependent epimerase/dehydratase Carbohydrate active enzymes (CAZy) Glycoside hydrolases (GHs) 18 XP_003855997.1 Putative exo-beta-1,3-glucanase Poorly characterized General function prediction only 2 XP_007285179.1 Aldehyde reductase I 19 EMF13527.1 HAD-superfamily hydrolase Miscellaneous 4 CAA78401.1 Ecp2 5 EMF14096.1 Cerato-platanin Unclassified proteins 6 XP_001397381.2 Hypothetical protein 11 EMF12739.1 Hypothetical protein

Experimental [MW (kDa)/pI]c

Theoretical [MW (kDa)/pI)c

Matched peptides

Protein ID in the M. fijiensis genome

Signal peptided

Sequest score

Sequence coverage

Differential expressione

35.0/5.91

32.2/5.94

2

35823

Y

123.42

8.73

Up-regulated

38.0/8.96

43.8/8.65

5

34402

Y

37.08

19.37

Up-regulated

23.0/7.54

26.9/7.90

10

210362

N

96.43

57.72

Up-regulated

45.0/5.85

47.2/6.08

4

52285

Y

18.43

14.17

Up-regulated

38.0/5.98 26.0/4.74

36.7/5.86 27.6/5.13

16 9

152559 214620

N N

392.49 50.83

55.18 51.22

Up-regulated Up-regulated

10.0/6.67 14.0/4.59

16.9/6.70 12.6/6.90

3 5

52972 137490

Y Y

120.12 424.09

18.01 49.11

Vir Up-regulated

19.0/3.83 33.0/3.39

19.9/4.95 26.8/4.22

6 8

39450 80396

Y Y

87.07 476.31

61.58 42.86

Vir Up-regulated

Comparative analysis of the in vitro and in planta secretomes

a Spots were numbered according to Fig 5. b GenBank general information identifier. c MW: molecular weight, pI: isoelectric point. d SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide. e Avir: protein/isoform secreted by the avirulent fungal isolate, Vir: protein/isoform secreted by the virulent fungal isolate, up-regulated: protein/isoform secreted in greater abundance by the virulent fungal isolate compared to the avirulent isolate, down-regulated: protein/isoform secreted in lower abundance by the virulent fungal isolate compared to the avirulent isolate.

19

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Table 4 e Differentially expressed in planta secreted proteins/isoforms by the avirulent and virulent M. fijiensis isolates.

27.52 47.87

a b c d

Spots were named according to Fig 5. GenBank general information identifier. MW: molecular weight, pI: isoelectric point. SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide.

Y GSMUA_Achr4T05250_001 31.7/8.06 31.0/7.81

6

15.24 29.70 N GSMUA_Achr3T26890_001 5 33.2/6.68 31.0/7.31

Biological process Chitin catabolic process C ACP43629.2 Chitinase Response to oxidative stress and cellular response to hypoxia D XP_002531317.1 Peroxidase, putative

Spot lettera

Protein accession numberb

Protein description

Experimental [MW (kDa)/pI]c

Theoretical [MW (kDa)/pI]c

Matched peptides

Protein name in the banana genome

Signal peptided

Sequest score

Sequence coverage

L. Escobar-Tovar et al.

Table 5 e The in planta secreted proteins/isoforms by M. acuminata var. ‘Yangambi Km 5’ artificially infected with the avirulent and virulent M. fijiensis isolates.

20

exact RxLR-dEER matches were found within the refined F. graminearum and M. graminicola secretomes. By contrast, a YC motif was present in approximately 1 % of the 574 proteins detected in F. graminearum secretome and various Y/F/ WC motifs were found in ten hypothetical proteins with no annotation in the in silico secretome of M. graminicola. Besides, proteases were identified in the in vitro secretomes of both fungal isolates and during the infection of ‘Yangambi Km 5’ leaves. However, the number of proteases identified in the M. fijiensis secretomes was very low compared to secretomes from other fungi such as U. maydis (Mueller et al. 2008), Botrytis cinerea (Shah et al. 2009), A. fumigatus (Wartenberg et al. 2011) and F. graminearum (Yang et al. 2012). Extracellular proteases play an important role in different fungal physiological contexts, for instance in the formation and germination of spores, in their pathogenicity and in post-translational regulation (Mercado-Flores, et al., 2003). Chuc-Uc et al. (2011) demonstrated enzymatic proteolytic activity in the M. fijiensis secreted proteins, both in native and denaturant polyacrylamide gels. Using the same protocol reported by the above workers, differential protease activity bands between both fungal isolates were detected, one corresponding to a metalloprotease secreted by the virulent isolate only and the other to a serine-protease secreted exclusively by the avirulent isolate. This is in accordance with the high content of metallo-carboxypeptidases of the M14 subfamily and exopeptidases M28 and serinepeptidases of the S10 subfamily secreted by members of the Dothideomycetes. These MEROPS subfamilies are known to have a potential role in pathogenicity and to be putatively involved in direct cell wall degradation by plant pathogens, a process in which hydroxyproline-rich glycoproteins are believed to be the main targets of these enzymes (Dow et al. 1998; Sreedhar et al. 1999). The next objective after identifying several proteins in the secretome of the M. fijiensis isolates, was to determine whether the secretome samples themselves produced host tissue necrosis. Necrotic lesions were observed on host leaves inoculated with the secretome of the avirulent isolate, which did not increase in size 48 hpi. These could be the consequence of a rapid hypersensitive response associated with resistance. According to Lepoivre et al. (2003), the rapid death of only a few host cells, associated with the blockage of the progression of the infecting agent in the highly resistant cultivar ‘Yangambi Km 5’, is usually defined as a hypersensitive reaction. In contrast, leaves inoculated with the secretome produced by the virulent isolate curiously showed a delay in the appearance of necrotic lesions, when compared to the avirulent isolate. When susceptible Grand Naine leaves were similarly treated, they produced larger and more severe necrotic lesions than those that developed in ‘Yangambi Km 5’ leaves. These results were in agreement with observations made by other workers (Chuc-Uc et al. 2011). It is known that toxins are involved in the development of BLSD (Lepoivre et al. 2003; Chuc-Uc et al. 2011). However, there is no evidence of toxic compounds having an early effect in the long period of biotrophy which precedes the generation of the first visible cytological alterations in the mesophyll cells. Such evidence has led to the proposal that proteins could be early determinants of pathogenicity.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

a Spots were named according to Fig 5. b GenBank general information identifier. c MW: molecular weight, pI: isoelectric point. d SignalP 3.0 was used to predict a signal peptide for secretion, Y indicates presence and N indicates absence of signal peptide. e Induced: protein/isoform secreted by ‘Yangambi Km 5’, artificially infected with the virulent fungal isolate, Repressed: protein/isoform secreted by ‘Yangambi Km 5’, artificially infected with the avirulent fungal isolate.

Repressed 30.71 24.58 Y GSMUA_Achr10T27840_001 25.1/4.53 164.0/3.25

5

Induced 41.38 34.69 Y GSMUA_Achr6T01380_001 15.6/7.93 10.0/6.39

3

Induced 75.86 761.13 Y GSMUA_Achr6T01380_001 9 15.6/7.93 8.0/9.12

Biological process Defense response to the fungus A XP_002531285.1 Wound-induced protein WIN1w WIN1w fragment precursor, putative B XP_002531285.1 Wound-induced protein WIN1w WIN1w fragment precursor, putative Response to oxidative stress E XP_006657008.1 PREDICTED: peroxidase 4-like

Differential expressione Sequence coverage Sequest score Signal peptided Protein name in the banana genome Matched peptides Theoretical [MW (kDa)/pI]c Experimental [MW (kDa)/pI]c Protein description Protein accession numberb Spot lettera

Table 6 e Differentially expressed in planta secreted proteins/isoforms by M. acuminata var. ‘Yangambi Km 5’ artificially infected with the avirulent and virulent M. fijiensis isolates.

Comparative analysis of the in vitro and in planta secretomes

21

On the other hand, the identification of fungal proteins secreted in planta is extremely challenging because of the small amount of fungal biomass produced in infected plants. Taking this factor into account, an attempt was made to obtain in planta secreted proteins from banana leaf pieces inoculated with M. fijiensis and incubated under controlled conditions. Its objective was to determine whether genes encoding the secreted proteins identified in vitro were also expressed in planta. Among the fungal proteins identified, were enzymes involved in carbohydrate transport and metabolism, which were found to be predominant in the in planta secretomes from both fungal isolates. A chloroperoxidase was found as an up-regulated protein secreted by the virulent M. fijiensis isolate, thereby suggesting that either the avirulent isolate secretes this protein in minute amounts under in vitro conditions or that it is only expressed in presence of the host. Most fungal effectors characterized so far facilitate virulence in a limited range of host plants (Stergiopoulos et al. 2010). Interestingly, we were able to detect a homolog of the Ecp2 effector in the in planta secretome obtained from the virulent M. fijiensis isolate. Stergiopoulos et al. (2010) have demonstrated the existence of three homologs of the Cladosporium fulvum Ecp2 in the M. fijiensis genome. This MfEcp2 effector likely promotes virulence by interacting with a putative host target that leads to host cell necrosis. However, the intrinsic function of Ecp2 has not yet been elucidated. Five proteins differentially expressed in vitro were of unknown function and only one (201852) was found in the in planta secretomes produced by both fungal isolates. The unknown 39450 protein was exclusively detected in both the in vitro and in planta secretomes of the virulent M. fijiensis isolate. Considering that this protein is secreted by the virulent isolate and has the YC-motif in its protein sequence, it is valid to propose that it could be considered as a viable virulence factor or effector candidate in M. fijiensis. These results suggest that the virulent isolate secretes various components, such as the putative Ecp2 effector and a number of proteins of unknown function that, together, contribute to increase its virulence. However, many secreted protein effectors identified in other phytopathogenic fungi and oomycetes are unique to these species, which complicates the identification of other key effector proteins, namely those putatively identified in this work. On the other hand, the differences found between the in planta secretomes of M. fijiensis isolates may have also been a consequence of how much leaf tissue was colonized by each isolate. This hypothesis stems from the heterogeneous virulence of M. fijiensis on Musa plants observed in the course of this study. Many factors could have contributed to the observed heterogeneity, e.g., the geographical origin of the isolates, which were adapted to grow in different environmental conditions and on two different varieties of banana, and/or the possible mutation of key effector genes. Finally, we detected some common plant defense-related proteins in the in planta secretomes of the M. fijiensis isolates, such as chitinases, peroxidases and a homolog of the antifungal protein WIN1. This was not surprising considering that these proteins are known to play an important role during fungal pathogen infection.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

22

Conclusions This report is the first description of representative secretomes of the Mycosphaerella fijiensis isolates that differ in pathogenicity. The data provided here indicates that there are significant changes in the relative abundance and composition of the secreted enzymes from both fungal isolates. This study enabled the identification of enzymes involved in plant cell wall degradation, primary and secondary metabolism, ROS detoxification, protein degradation/turnover, and melanin biosynthesis, together with the detection of possible virulence factors. A finding of particular interest was the identification of a secreted, low molecular weight protein of unknown function that has a YC motif, which could also be a potential virulence factor or effector candidate. However, its molecular function, biological role and participation in cellular processes remain to be elucidated. These results demonstrated that the difference between both M. fijiensis isolates is strongly manifested in the secretome. The findings herewith reported will provide a useful platform for further investigations designed to provide new information about the diverse mechanisms of pathogenesis and epidemiology of M. fijiensis and of potential targets for its control.

Acknowledgments
pez, Ana Gloria We gratefully acknowledge Alicia Chagolla-Lo
nVallejo-Vargas, Armando Guerrero-Rangel and Claudia Leo Ram
ırez for important technical assistance. We also thank Claudiana Carr, Donny Vargas and the molecular biology lab
n Bananera Nacional (CORBANA) oratory of the Corporacio from Costa Rica for support on the in vitro establishment and characterization of fungal isolates. We are particularly grateful to Dr. John Delano-Frier for reading the manuscript and providing useful comments. The support of a CONACYT predoctoral fellowship to LET (#219897) is also gratefully acknowledged. This work was supported by CONACYT grant number 152939 to MAGL.

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2015.01.002.

references

Abadie C, Zapater MF, Pignolet L, Carlier J, Mourichon X, 2008. Artificial inoculation on plants and banana leaf pieces with Mycosphaerella spp., responsible for Sigatoka leaf spot diseases. Fruits 63: 319e323. Agrawal GK, Jwa NS, Lebrun MH, Job D, Rakwal R, 2010. Plant secretome: unlocking secrets of the secreted proteins. Proteomics 10: 799e827. Brown NA, Antoniw J, Hammond-Kosack KE, 2012. The predicted secretome of the plant pathogenic fungus Fusarium graminearum: a refined comparative analysis. PLoS One 7: e33731.

L. Escobar-Tovar et al.

Butler MJ, Day AW, 1998. Fungal melanins: a review. Canadian Journal of Microbiology 44: 1115e1136.
E, Gauhl F, Jones DR, Lepoivre P, Mourichon X, Carlier J, Foure Pasberg-Gauhl C, Romero RA, 2000. Fungal diseases of the fo
and Enset. CABI liage. In: Jones DR (ed.), Disease of Banana, Abaca Publishing, Oxon, UK, pp. 37e141. Carlile AJ, Bindschedler LV, Bailey AM, Bowyer P, Clarkson JM, Cooper RM, 2000. Characterization of SNP1, a cell walldegrading trypsin, produced during infection by Stagonospora nodorum. Molecular Plant-Microbe Interactions 13: 538e550. Ceballos I, Mosquera S, Angulo M, Mira JJ, Argel LE, Uribe-Velez D, Romero-Tabarez M, Orduz-Peralta S, Villegas V, 2012. Cultivable bacteria populations associated with leaves of banana and plantain plants and their antagonistic activity against Mycosphaerella fijiensis. Microbial Ecology 64: 641e653.
V, Danit LV, Siewers V, Gronover CS, Tudzynski P, Chague Tudzynski B, Sharon A, 2006. Ethylene sensing and gene activation in Botrytis cinerea: a missing link in ethylene regulation of fungus-plant interactions. Molecular Plant-Microbe Interactions 19: 33e42. Cho Y, Hou S, Zhong S, 2008. Analysis of expressed sequence tags from the fungal banana pathogen Mycosphaerella fijiensis. The Open Mycology Journal 2: 61e73.
ez L, Canto-Canche
B, Tzec-Sima
M, Chuc-Uc J, Brito-Arga Rodr
ıguez-Garc
ıa C, Peraza-Echeverr
ıa L, Peraza-Echeverr
ıa S, ~ a-Rodr
ıguez LM, Islas-Flores I, James-Kay A, Cruz-Cruz CA, Pen 2011. The in vitro secretome of Mycosphaerella fijiensis induces cell death in banana leaves. Plant Physiology and Biochemistry 49: 572e578. Churchill ACL, 2011. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control. Molecular Plant Pathology 12: 307e328. € ldener U, Xu JR, Trail F, Turgeon BG, Di Pietro A, Cuomo CA, Gu Walton JD, Ma LJ, Baker SE, Rep M, Adam G, Antoniw J, Baldwin T, Calvo S, Chang YL, DeCaprio D, Gale LR, Gnerre S, Goswami RS, Hammond-Kosack K, Harris LJ, Hilburn K, Kennell JC, Kroken S, Magnuson JK, Mannhaupt G, Mauceli E, € tter M, € nsterko Mewes HW, Mitterbauer R, Muehlbauer G, Mu Nelson D, O’Donnell K, Ouellet T, Qi W, Quesneville H, Roncero MIG, Seong KY, Tetko IV, Urban M, Waalwijk C, Ward TJ, Yao J, Birren BW, Kistler HC, 2007. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317: 1400e1402. Deising H, Nicholson RL, Haug M, Howard RJ, Mendgen K, 1992. Adhesion pad formation and the involvement of cutinase and esterases in the attachment of uredospores to the host cuticle. The Plant Cell Online 4: 1101e1111. do Amaral AM, Antoniw J, Rudd JJ, Hammond-Kosack KE, 2012. Defining the predicted protein secretome of the fungal wheat leaf pathogen Mycosphaerella graminicola. PloS One 7: e49904. Dobinson KF, Lecomte N, Lazarovits G, 1997. Production of an extracellular trypsin-like protease by the fungal plant pathogen Verticillum dahliae. Canadian Journal of Microbiology 43: 227e233. Dow JM, Davies HA, Daniels MJ, 1998. A metalloprotease from Xanthomonas campestris that specifically degrades proline/hydroxyproline-rich glycoproteins of the plant extracellular matrix. Molecular Plant-Microbe Interactions 11: 1085e1093. Fullerton RA, Olsen TL, 1995. Pathogenic variability in Mycosphaerella fijiensis Morelet, cause of black Sigatoka in banana and plantain. New Zealand Journal of Crop and Horticultural Science 23: 39e48.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

Comparative analysis of the in vitro and in planta secretomes

23

Glaser AG, Kirsch AI, Zeller S, Menz G, Rhyner C, Crameri R, 2009. Molecular and immunological characterization of Asp f 34, a novel major cell wall allergen of Aspergillus fumigatus. Allergy 64: 1144e1151. € hlenius H, Pedersen C, Zhang Z, Emmersen J, Godfrey D, Bo Thordal-Christensen H, 2010. Powdery mildew fungal effector candidates share N-terminal Y/F/WxC-motif. BMC Genomics 11: 317.
lez-Ferna
ndez R, Aloria K, Valero-Galva
n J, Redondo I, Gonza Arizmendi JM, Jorr
ın-Novo JV, 2014. Proteomic analysis of mycelium and secretome of different Botrytis cinerea wild-type strains. Journal of proteomics 97: 195e221. Govers F, Bouwmeester K, 2008. Effector trafficking: RXLR-dEER as extra gear for delivery into plant cells. The Plant Cell Online 20: 1728e1730. Hammer BA, Johnson EA, 1988. Purification, properties, and metabolic roles of NADþ-glutamate dehydrogenase in Clostridium botulinum 113B. Archives of Microbiology 150: 460e464. Hejazi A, Falkiner FR, 1997. Serratia marcescens. Journal of Medical Microbiology 46: 903e912. Jacobson ES, 2000. Pathogenic roles for fungal melanins. Clinical Microbiology Reviews 13: 708e717. Johanson A, Jeger MJ, 1993. Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain. Mycological Research 97: 670e674. Kiyosawa S, 1982. Genetics and epidemiological modeling of breakdown of plant disease resistance. Annual Review of Phytopathology 20: 93e117.
MM, Kronstad JW, 2004. Lipid-induced filamenKlose J, De Sa tous growth in Ustilago maydis. Molecular Microbiology 52: 823e835. € ller W, Yao C, Trial F, Parker DM, 1995. Role of cutinase in the Ko invasion of plants. Canadian Journal of Botany 73: 1109e1118. Lepoivre P, Busogoro JP, Etame JJ, El Hadrami A, Carlier J,
G, Harelimana G, Mourichon X, Panis B, Riveros AS, Salle Strosse H, Swennen R, 2003. Banana-Mycosphaerella fijiensis interactions. In: Jacome L (ed.), Mycosphaerella Leaf Spot Diseases of Bananas: Present Status and Outlook. Proceedings of the Workshop on Mycosphaerella Leaf Spot Diseases, San Jos
e, Costa Rica, 20-23 May 2002. Montpellier, France, pp. 151e159.
n M, Sutton TB, 2003. Black SigaMar
ın DH, Romero RA, Guzma toka: an increasing threat to banana cultivation. Plant Disease 87: 208e222.
ndez-Rodr
ıguez C, Ruiz-Herrera J, VillaMercado-Flores Y, Herna Tanaca L, 2003. Proteinases and exopeptidases from the phytopathogenic fungus Ustilago maydis. Mycologia 95: 327e339. Mouliom-Pefoura A, 1999. First observation of the breakdown of high resistance in Yangambi km 5 (Musa sp.) to the black leaf Sigatoka disease in Cameroon. Plant Disease 83 78.4. Mueller O, Kahmann R, Aguilar G, Trejo-Aguilar B, Wu A, de Vries RP, 2008. The secretome of the maize pathogen Ustilago maydis. Fungal Genetics and Biology 45: S63eS70. Murphy JM, Walton JD, 1996. Three extracellular proteases from Cochliobolus carbonum: cloning and targeted disruption of ALP1. Molecular Plant-Microbe Interactions 9: 290e297. Ohm RA, Feau N, Henrissat B, Schoch CL, Horwitz BA, Barry KW, Condon BJ, Copeland AC, Dhillon B, Glaser F, Hesse CN, Kosti I, LaButti K, Lindquist EA, Lucas S, Salamov AA, Bradshaw RE, Ciuffetti L, Hamelin RC, Kema GHJ, Lawrence C, Scott JA, Spatafora JW, Turgeon BG, de Wit PJGM, Zhong S, Goodwin SB, Grigoriev IV, 2012. Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi. PLoS Pathogens 8: e1003037. Orozco-Santos M, 2013. La Sigatoka negra y su manejo integrado en
n, Tecoma
n. SAGARPA, banano Campo experimental Tecoma INIFAP, CIRPAC, Mexico, 152 p..

Pascholati SF, Deising H, Leiti B, Anderson D, Nicholson RL, 1993. Cutinase and non-specific esterase activities in the conidial mucilage of Colletotrichum graminicola. Physiological and Molecular Plant Pathology 42: 37e51. Pazzagli L, Cappugi G, Manao G, Camici G, Santini A, Scala A, 1999. Purification, characterization, and amino acid sequence of cerato-platanin, a new phytotoxic protein from Ceratocystis fimbriata f. sp. platani. Journal of Biological Chemistry 274: 24959e24964. Peraza-Echeverr
ıa L, Rodr
ıguez-Garc
ıa CM, Zapata-Salazar DM, 2008. A rapid, effective method for profuse in vitro conidial production of Mycosphaerella fijiensis. Australasian Plant Pathology 37: 460e463.
o SN, Barbosa MS, da Silva JLM, Felipe MSS, de Pereira LA, Ba Santana JM, Mendes-Giannini MJS, Soares CMA, 2007. Analysis of the Paracoccidioides brasiliensis triosephosphate isomerase suggests the potential for adhesin function. FEMS Yeast Research 7: 1381e1388. ~ eyro MD, Parodi-Talice A, Arcari T, Robello C, 2008. PeroxirePin doxins from Trypanosoma cruzi: Virulence factors and drug targets for treatment of Chagas disease? Gene 408: 45e50. Punekar NS, Suresh Kumar SV, Jayashri TN, Anuradha R, 2003. Isolation of genomic DNA from acetone-dried Aspergillus mycelia. Fungal Genetics Newsletter 50: 15e16. Rep M, 2005. Small proteins of plant-pathogenic fungi secreted during host colonization. FEMS Microbiology Letters 253: 19e27. Rodrigo I, Vera P, Van Loon LC, Conejero V, 1991. Degradation of tobacco pathogenesis-related proteins. Evidence for conserved mechanisms of degradation of pathogenesis-related proteins in plants. Plant Physiology 95: 616e622. Rolke Y, Liu S, Quidde T, Williamson B, Schouten A, Weltring KM, Siewers V, Tenberge KB, Tudzynski B, Tudzynski P, 2004. Functional analysis of H2O2-generating systems in Botrytis cinerea: The major Cu-Zn-superoxide dismutase (BCSOD 1) contributes to virulence on French bean, whereas a glucose oxidase (BCGOD 1) is dispensable. Molecular Plant Pathology 5: 17e27. Shah P, Atwood III JA, Orlando R, El Mubarek H, Podila GK, Davis MR, 2009. Comparative proteomic analysis of Botrytis cinerea secretome. Journal of Proteome Research 8: 1123e1130. Shevchenko A, Wilm M, Vorm O, Mann M, 1996. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Analytical Chemistry 68: 850e858. Sreedhar L, Kobayashi DY, Bunting TE, Hillman BI, Belanger FC, 1999. Fungal proteinase expression in the interaction of the plant pathogen Magnaporthe poae with its host. Gene 235: 121e129. € Stergiopoulos I, van den Burg HA, Okmen B, Beenen HG, van Liere S, Kema GHJ, de Wit PJGM, 2010. Tomato Cf resistance proteins mediate recognition of cognate homologous effectors from fungi pathogenic on dicots and monocots. Proceedings of the National Academy of Sciences 107: 7610e7615. Tournu H, Fiori A, Van Dijck P, 2013. Relevance of trehalose in pathogenicity: some general rules, yet many exceptions. PLoS Pathogens 9: e1003447. Vargas A, Sandoval JA, 2005. Agronomic evaluation of production
til” (AA). The and quality of “Yangambi Km 5” (AAA) and “Da International Journal on Banana and Plantain 14: 6e10. € fer W, Salomon S, 2005. A secreted lipase of FusaVoigt CA, Scha rium graminearum is a virulence factor required for infection of cereals. The Plant Journal 42: 364e375. Wang Y, Kim SG, Wu J, Huh HH, Lee SJ, Rakwal R, Agrawal GK, Park ZY, Kang KY, Kim ST, 2013. Secretome analysis of the rice bacterium Xanthomonas oryzae (Xoo) using in vitro and in planta systems. Proteomics 13: 1901e1912. Wartenberg D, Lapp K, Jacobsen ID, Dahse HM, Kniemeyer O, Heinekamp T, Brakhage AA, 2011. Secretome analysis of Aspergillus fumigatus reveals Asp-hemolysin as a major secreted protein. International Journal of Medical Microbiology 301: 602e611.

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002

24

Yang FEN, Jensen JD, Svensson B, Jørgensen HJ, Collinge DB, Finnie C, 2012. Secretomics identifies Fusarium graminearum proteins involved in the interaction with barley and wheat. Molecular Plant Pathology 13: 445e453.

Abbreviations 2D: Two Dimensional 2-DE: Two-Dimensional gel Electrophoresis Aa: Amino acid ANOVA: Analysis of Variance BLASTP: Basic Local Alignment Search Tool of proteins BLSD: Black Leaf Streak Disease BSA: Bovine Serum Albumin CAZY: Carbohydrate-Active enZYmes CHAPS: 3-[(3-cholamidopropyl)dimethylammonio]-1propanesulfonate CID: Collision-Induced Dissociation Dpi: Days post-inoculation DTT: Dithiothreitol EDTA: Ethylenediaminetetraacetic acid

L. Escobar-Tovar et al.

Hpi: Hours post-inoculation IEF: IsoElectric Focusing IPG: Immobilized pH Gradient ITS: Internal Transcribed Spacer KOG: The EuKaryotic Orthologous Groups MS: Mass Spectrometry MS/MS: Mass Spectrometry in Tandem NCBInr: Non-redundant National Center for Biotechnology Information protein database PAGE: PolyAcrylamide Gel Electrophoresis PCR: Polymerase Chain Reaction PDA: Potato Dextrose Agar pI: Isoelectric point PMSF: Phenylmethylsulfonylfluoride PR: Pathogenesis-Related protein PQD: Pulsed Q collision induced Dissociation ROS: Reactive Oxygen Species SA: Salicylic Acid SD: Standard Deviation SDS: Sodium Dodecyl Sulfate TCA: Trichloroacetic acid

Please cite this article in press as: Escobar-Tovar L, et al., Comparative analysis of the in vitro and in planta secretomes from Mycosphaerella fijiensis isolates, Fungal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.01.002