- Email: [email protected]
Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain
Mycol. Res. 97 (6): 670--674 (1993)
670
Printed in Great Britain
Use of peR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain
A. JOHANSON AND M. J. JEGER Natural Resources Institute, Central Avenue, Chatham Maritime, Chatham, Kent ME44TB, u.K.
There are two Sigaroka leaf spot diseases of banana and plantain, yellow Sigatoka and black Sigatoka. Yellow Sigatoka is caused by Mycosphaerella musicola, and black Sigatoka by M. jijiensis. Because unambiguous diagnosis of these leaf spots is often not possible by symptoms alone, we have used the polymerase chain reaction (peR) to distinguish between the two species, and to detect the pathogens in DNA from infected leaf tissue. Two 21-base oligonucleotide primers were synthesised from a variable region identified in the nucleotide sequence of the internally transcribed spacer (ITS) 1 region of ribosomal DNA (rDNA) of Mycosphaerella jijiensis and M. musicola. These primers (MF137 and MM137 respectively) were used in association with primer R635 (from a conserved sequence of the rDNA). Primers MF137 and R635 produced an amplification product of approximately 1000 bp in size with DNA from M. jijiensis. This product was not formed when DNA of M. musicola, M. minima, or a number of other fungi which are commonly found on banana leaves, was amplified. Primer combination MM1l7 and R635 produced an amplification product of approximately 1000 bp with DNA from M. musicola. The primers amplified similar sized fragments from the DNA extracted from banana leaf tissue infected with M. jijiensis and M. musicola. Southern hybridization analysis confirmed the fungal origin of these fragments.
There are two fonns of Sigatoka leaf spots which affect bananas - yellow Sigatoka, caused by the fungus Mycosphaerella musicola Leach ex Mulder (anamorph Pseudocercospora musae (Zimm.) Deighton), and the more economically destructive black Sigatoka, caused by M. fijiensis Morelet (anamorph Paracercospora fijiensis (Morelet) Deighton) (Stover, 1980). Although black Sigatoka can often be recognized visually, unambiguous diagnosis is complicated by the presence of other pathogens found on banana leaves. Isolation of the pathogen, which is most successfully achieved by ascospore discharge from necrotic leaf material. is often confounded by the absence of mature perithecia, and even when obtained in culture, M. fijiensis and M. musicola are not readily differentiated (Pons, 1990). A technique for rapid and accurate identification of these species therefore would be of great value in epidemiological research and particularly, for diseasemonitoring programmes in areas such as the Caribbean islands, which have so far been free of the pathogen. Previous work Oohanson & Templeton, 1991) has shown that randomly amplified polymorphic DNA markers (RAPDs) as described by Welsh & McClelland (1990) and Williams et al. (1990) are able to differentiate between the species of Mycosphaerella found on banana leaves. The 10-oligonucleotide primers used in this previous study were of use when analysing DNA extracted from pure cultures of the fungus, but not when infected plant DNA was amplified. Such lO-mers also find homology in the banana genome and although the fungal-specific band is amplified from infected plant DNA, many additional bands are also produced
Oohanson, unpublished data). In order to detect the fungi in plant tissue, more speCific primers are needed which have no homology with banana DNA. PCR has been used quite successfully for some time by biomedical researchers to detect pathogens in infected animal tissues, but only recently has this method been applied to detect phytopathogenic organisms, e.g. direct detection of bean yellow mosaic potyvirus in gladiolus (Vunsh et at 1990), Phoma tracheiphila, a fungal pathogen of lemon in infected woody tissue (Rollo et at 1991), and the take-all fungus Gaumannomyces graminis in infected wheat plants (Schesser et al., 1991). Ribosomal genes make good molecular probes because of their ease of isolation and relatively high gene copy number. Although the nucleotide sequences of mature RNAs are highly conserved, both non-transcribed and transcribed spacer sequences, which often make up approximately half of the rDNA repeating unit, are usually poorly conserved and may contain large sequence differences. This represents opportunity for the development of rDNA-specific probes, and a number of researchers are developing such assays (Gobel et a/., 1987). Amongst plant pathogenic fungi, this approach has been used by Nazar et a/. (1991) for detection and typing of isolates of the Verticillium wilt pathogens. From sequence infonnation of the internal transcribed spacer (ITS) regions between the mature 18S and the 28S rDNA subunits (Uu et al., 1991), we designed oligonucleotide primers which might be specific for M. fijiensis and M. musicoIa, and sensitive enough to detect these fungi in infected plant material.
A. Johanson and M. J. Jeger
671
Table 1. Source of fungal isolates used in this study Isolate
Species
Origin
Source
MQI03 CU823 StU )YI2I AU590 HSB4 CM85 NG722 RT655 PNG29I MQ78 TG78I AspI
M. musicola M. musicola
Martinique Cuba St Lucia Java Australia Honduras Cameroon Nigeria Rarotonga Papua New Guinea Martinique Tonga Windward Islands Windward Islands Windward Islands Windward Islands
X.Mourichon,IRFA IMI,Kew A. Johanson, NRI R. Fullerton, DSIR R. Fullerton, DSIR G. Molina, FHIA X. Mourichon, IRFA R. Fullerton, DSIR R. Fullerton, DSIR R. Fullerton, DSIR X. Mourichon, IRFA R. Fullerton, DSIR A. Johanson, NRI A. Johanson, NRI A. Johanson, NRI A. Johanson, NRI
Btl FrnI CgI
M. musicola M. musicola M. musicola M. jijiensis M. jijiensis M. jijiensis M. jijiensis M. jijiensis M. minima M. musae Aspergillus niger Botryodiplodia theobromae Fusarium moniliforme Colletotrichum gloeosporioides
MF137
-
I TS2
- ITS4
R635
Fig. 1. Locations of peR primers on fungal ribosomal DNA. Adapted from White et al., (1990).
MATERIALS AND METHODS Fungal isolates and genomic DNA extraction Geographical origin and source of the isolates used in this study are shown in Table 1. Cultures of the fungi were grown in Czapek-Dox (Oxoid) liquid medium plus yeast extract (I g I~l). Conical flasks (250 ml) containing approximately 50 ml of liquid medium were inoculated with mycelial fragments of the isolates from cultures on PDA (Oxoid).Cultures were incubated on an orbital shaker at approximately 26°C for 14-28 d, depending on the growth rate of each isolate. Cultures were filtered through a Buchner funneL the mycelia collected on Whatman No. 3 filter paper, and then freeze-dried. Freeze-dried mycelia were ground in liquid nitrogen and total genomic DNA was extracted using the protocols of Raeder &: Broda (1985) and Lee et al. (1990).
Plant genomic DNA extraction Most of the samples were of dried leaf material, which had been harvested from the field when already necrotic and which usually contained mature perithecia. Other samples were inoculated with the pathogen in the glasshouse, and leaves were harvested when still green and showing young leaf spot lesions. The leaf samples which showed symptoms of yellow 5igatoka were collected from Jamaica and 5t Lucia, where M. ftjiensis does not occur. Leaf samples showing typical black Sigatoka symptoms were taken from areas where M. ftjiensis is thought to predominate. Where possible, several single ascospore isolations were made from each leaf sample
and identification confirmed subsequently from conidial characteristics. All samples were freeze-dried and ground in liquid nitrogen. Total plant DNA was extracted using the same methods as those for the fungal DNA. however, the extracts were then passed through a sepharose CL-6B (Sigma) spin column (1'5 ml disposable syringe) in order to remove phenolic compounds and pigments, the presence of which appeared to inhibit subsequent DNA amplification.
Oligonucleotide synthesis Oligonucleotide synthesis was carried out by Operon Technologies Inc., Alameda, California and the John Innes Institute, Norwich, U.K. The sequence of primer R635, situated in the 255 subunit of rDNA was taken from Liu et al. (1991). Primers MF137 and MM137 were designed from the ITS sequences of isolates of M. ftjiensis and M. musicola obtained from Dr E. Stewart, Department of Plant Pathology, University of Minnesota. Primer sequences were as follows: MFI37: 5'GGCGCCCCCGGAGGCCGTCTA3'; MM137: 5'GCGGCCCCCGGAGGTCTCCTT3'; R635: 5'GGTCCGTGTTTCAAGACGG3'. Locations of PCR primers on the fungal rDNA are shown in Fig. 1. peR amplifications and product analysis
Amplification reactions were performed in 50 mM-KCL 1'5 mM-MgCl 2 , 10 mM-Tris HCL pH 8'3, containing 100 mM
PCR detection of Mycosphaerella spp. on banana of each ciATP, dCTP, dGTP, and dTTP, 200 nM primer, 2 units of Taq DNA polymerase (Promega) and approximately 25-50 ng of genomic template DNA in a final volume of 50 \,.ll. DNA amplification was performed by the polymerase chain reaction in a thermal cycler (Techne PHC-3) programmed for 3 min at 94° followed by 35 cycles of one minute at 94°, I min at 65° and 3 min at 72°. After the 35th cycle the extension reaction was continued for a further 5 min at 72° and products were held at 4° until analysed. PCR reaction samples (10-20 \,.ll) were mixed with sample buffer and run on a 1'5 % agarose gel containing 0'5 \,.ll ml- l ethidium bromide at 100 V for up to I h with Tris-borate EDTA as running buffer.
DNA blot hybridization analyses Following depurination in 0'25 M-HCl for IS min, and denaturation (1'5 \,.l-NaCl, 0'5 M-NaOH) the gels were neutralised in 1'0 M-Tris, 2'0 M-NaCl (pH 5'0) and the DNA was transferred by capillary blotting to a nitrocellulose membrane using 20 X SSe. Amplified PCR fragments from PCR reactions with primer combinations MM137jR635 (with M. musicola) and MF137 j R635 (M. fijiensis) were exised from low melting point agarose gels, placed in a 2 ml disposable syringe at - 20° for I h. The PCR fragment in buffer was then squeezed from the syringe as it thawed. The fragments were then labelled overnight using the Boehringer Mannheim Dig-DNA labelling and detection kit (non-radioactive). Filters were washed, hybridized and immunological detection was carried out according to the manufacturer's instructions.
672 product was observed in reactions containing DNA from the plant infected with M. musicola, or in the uninfected plant control (Fig. 4a). After Southern blotting, the PCR fragment from M. fijiensis was found to hybridize to the PCR product from the infected plant DNA (Fig. 4 b). DNA from two leaf samples with symptoms of yellow Sigatoka was amplified with primers MM137 and R635. Leaf material infected with M. fijiensis and uninfected material were used as controls. Amplification products were produced only in reactions containing DNA from those plants infected with M. musicola (Fig. 5 a). After Southern blotting, the PCR fragment from M. musicola was found to hybridize to the PCR products produced from the infected plant DNA (Fig. 5 b). Further work has shown that the separate annealing step may be omitted from the PCR reaction, shortening it to two steps, one of 94° (denaturation) and one of 68° (annealing and extension combined) without any reduction in the sensitivity of the technique. The specificity of the primers is consistent 2
3
4
5
6
7
8
9 10 11 12 13 14
KB 1636 1018 506
RESULTS
Specificity of primers DNA from five isolates of M. fijiensis from a wide geographical area was amplified using primers MF137 and R635. DNA from one isolate of M. musicola, one of M. musae, M. minima and a number of other fungi commonly found on banana leaves was also amplified. Amplification of DNA from all isolates of M. fijiensis produced one PCR product of approximately 1000 bp. No PCR products were observed with DNA amplified from any of the other species tested (Fig. 2). Primers MM137 and R635 were used to amplify a 1000 bp product from five isolates of M. musicola. These primers did not amplify DNA from the other Mycosphaerella species or from any other fungi tested (Fig. 3).
Fig. 2. Agarose gel of PCR products from amplification of fungal DNA with primers MF137 and R635 (stained with ethidium bromide). Lanes: 1, kb ladder size standard (Gibco-BRL); 2-6, isolates of M.fijiensis; 7, M. musicola; 8, M. minima; 9, M. musae; 10, Aspergillus niger; 11, Botryodiplodia theobromae; 12, Fusarium moniliforme; 13, C. gloeosporioides, 14, kb ladder.
2
3 4
5 6
7
8
9
10 11 12 13 14
KB 1636 1018 506
Defection from plant tissue DNA from three leaf samples which showed symptoms of black Sigatoka was amplified using primers MF137 and R63S. Leaf material infected with M. musicola and uninfected leaf material were used as controls in the PCR reaction. An amplification product of the same size as that produced from purified fungal DNA was produced in reactions containing DNA from those plants infected with M. fijiensis. No PCR
Fig. 3. Agarose gel of PCR products from amplification of fungal DNA with primers MM137 and R635 stained with ethidium bromide. Lanes: 1, kb ladder size standard (Gibco-BRL); 2-6, isolates of M. musicola; 7, M. fijiensis; 8, M. minima; 9, M. musae; 10, Aspergillus niger; 11, Botryodiplodia theobromae; 12, Fusarium moniliforme; 13, C. gloeosporioides; 14, kb ladder.
A. Johanson and M. J. Jeger
673 (b)
(a)
2
3
5
4
6
7
8
2
3
4
5
7
6
8
KB
1636 1018 506
Fig. 4. (a) Agarose gel of PCR products with primers MFI37 and R635 stained with ethidium bromide, (b) hybridized with Dig-labelled PCR fragment from M. fijiensis. Lanes: 1, kb ladder size standard (Gibco-BRL); 2, M. fijiensis (fungal DNA); 3, green leaf with early M. fijiensis infection; 4, dried leaf sample with M. fijiensis (Cook Islands); 5, dried leaf sample with M. fijiensis (Costa Rica); 6, dried leaf sample with M. musicola (Jamaica); 7, dried, uninfected leaf sample; 8, kb ladder. (b)
(a)
2
3
4
5
6
7
2
3
4
5
6
7
KB
1636 1018 506
Fig. 5. (a) Agarose gel of PCR products with primers MMI37 and R635 stained with ethidium bromide; (b) hybridized with Diglabelled peR fragment from M. musicola. Lanes: 1, kb ladder size standard (Gibco-BRL); 2, M. musicola (fungal DNA); 3, dried leaf sample with M. musicola (St Lucia); 4, dried leaf sample with M. musicola (Jamaica); 5, green leaf material with M. fijiensis; 6, dried, uninfected leaf sample; 7, kb ladder.
over a wide range of annealing temperatures. Primer MM137 does not produce a specific amplification product with M. fijiensis, and primer MF137 does not produce a product with M. musicoia even with an annealing temperature as low as 35°. Species-specific amplification products have also been obtained by using primers MF13 7 and MM13 7 in combination with other primers from the conserved regions of the rDNA. Primers MM137 and MF137 in combination with primer ITS4 (White, et ai., 1990), which is located in the 28S rDNA subunit, produces specific PCR fragments of approximately 400 bp when both fungal and infected plant DNA are amplified. Primer ITS2 produces a fragment of approximately 200 bp (data not shown).
DISCUSSION Primers designed from the ITS region between the 18S and 5·8S ribosomal DNA subunits of M. fijiensis and M. musicoia used in conjunction with a primer in the 25S rDNA subunit produce a specific amplification product when fungal DNA is amplified by the polymerase chain reaction. Primers MFI37 and R635 amplify a product of approximately 1000 bp in size only with DNA from M. fijiensis, and primers MMI37 and 43
R635 amplify a product only with M. musicoia. For both species, this specificity holds for as many isolates as have been tested. Neither set of primers amplify M. musae, M. minima, or a number of other fungi commonly found on banana leaves. These primers are also sufficiently specific, and the PCR technique sufficiently sensitive, to detect fungal DNA from infected leaf material. The fungi can be detected both at early stages of infection, and at a much later stage when the leaves are completely necrotic. Fungal DNA has been amplified from dried leaf samples up to 3 yr old, suggesting that this technique may be useful for even older herbarium specimens. In this study the banana leaf DNA was extracted by standard procedures involving phenol and chloroform. Simpler methods with fewer steps which do not require the use of phenol have been reported to have been successful with other plant species (Edwards et al., 1991). This has not so far been useful for banana tissue as it does not remove the pigmented phenolics which inhibit the PCR reaction. Other protocols are being investigated and would be expected to reduce the time necessary for processing the tissue. The sensitivity of detection has not yet been determined accurately, but is in the region of picograms of target fungal DNA. Preliminary results suggest that the use of primer ITS4, MYC 97
674
PCR detection of Mycosphaerella spp. on banana instead of R635, increases the sensitivity of detection and decreases the levels of smearing of DNA occasionally found when products are run on agarose gels. This is thought to be due to the greater errors which are likely in the amplification of a larger PCR product. The sensitivity of detection is also affected by the levels of inhibitors of DNA amplification which may be present in the plant DNA extract. In addition to using a range of dilutions of the extract for PCR, it is therefore also recommended that a control reaction is carried out with the plant extract 'spiked' with a known amount of target fungal DNA to avoid false negatives which may be due to such inhibition. The authors would like to thank Dr R. Fullerton (DSIR, New Zealand) and Dr X. Mourichon (IRF A, France) for supplying some of the isolates used in this study, Prof. P. D. S. Caligari (University of Reading) for his advice and support, and Dr A. Brown and Dr P. Mills (The Queen's University of Belfast) for assistance in the preparation of this manuscript.
Lee, S. B.. Milgroom, M. G. & Taylor, J. W. (1990). A rapid, high-yield miniprep method for isolation of total genomic DNA from fungi. Fungal Genetics Newsletter 35, 23-24. Uu, Z., Stewart, E. L. & Szabo, L. ). (1991). Phylogenetic relationships among Cercospora and allied genera on banana based on rONA sequence comparisons. Phytopathology 81, 1240 (abstract). Nazar, R. N., Hu, x., Schmidt, J., Culham, D. & Robb, J. (1991). Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of verticillium wilt pathogens. Physiological and Molecular Plant Pathology 39, 1-11. Pons, N. (1990). Taxonomy of Cl!rcospora and related genera. In 5igatoka leaf spot diseases of bananas, Proceedings of an International Workshop held at San Jose, Costa Rica, 28 March-1 April, 1989. (ed. R. A. Fullerton & R. H. Stover). Raeder, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi. Letters in Applied Microbiology 1, 17-20. Rollo, F., Salvi, R. & Torchia, P. (1991). Highly sensitive and fast detection of Phoma tracheiphila by polymerase chain reaction. Applied Microbiology and Biotechnology 32, 572-576. Schesser, K., Luder, A. & Henson, J. M. (1991). Use of polymerase chain reaction to detect the take-all fungus, Gaeumannomyces graminis in infected wheat plants. Applied and Environmental Microbiology 57, 553-556. Stover, R. H. (1980). Sigatoka leaf spot of bananas and plantains. Plant Disease 64, 750-755.
REFERENCES Edwards, K.. Johnstone, C. & Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19, 1349. Gobel. U., Geiser, A. & Stanbridge, E. O. J. (1987). Oligonucleotide probes complementary to variable regions of ribosomal RNA discriminate between mycoplasma species. Journal of General Microbiology 133, 1969--1974. Johanson, A. & Templeton, M. D. (1991). Preliminary studies of the use of PCR for random amplification of polymorphic DNA markers (RAPDs) in MycosphaereIIa fijiensis and M. musicola. In Proceedings of the X Reunion Meeting of ACORBAT, ViIIahermosa, Mexico, 2-9 November, 1991, in press.
(Accepted 3 October 1992)
Vunsh, R., Rosner, A. & Stein, A. (1990). The use of the polymerase chain readion (PCR) for the detection of bean yellow mosaic virus in gladiolus. Allnals of Applied Biology 117, 561-569. Welsh, J. & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18, 7213-7218. White, T. J., Bruns, T., Lee, S. & Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications. (ed. M. A. Innis, D. H. Gelfand, J. j. Sninsky, & T. J. White), pp. 315-322. Academic Press Inc: San Diego. Williams, J. G. K., Kubelik, A. R., Uvak. J., Rafalski, J. A. & Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, 6531-6535.
670
Printed in Great Britain
Use of peR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain
A. JOHANSON AND M. J. JEGER Natural Resources Institute, Central Avenue, Chatham Maritime, Chatham, Kent ME44TB, u.K.
There are two Sigaroka leaf spot diseases of banana and plantain, yellow Sigatoka and black Sigatoka. Yellow Sigatoka is caused by Mycosphaerella musicola, and black Sigatoka by M. jijiensis. Because unambiguous diagnosis of these leaf spots is often not possible by symptoms alone, we have used the polymerase chain reaction (peR) to distinguish between the two species, and to detect the pathogens in DNA from infected leaf tissue. Two 21-base oligonucleotide primers were synthesised from a variable region identified in the nucleotide sequence of the internally transcribed spacer (ITS) 1 region of ribosomal DNA (rDNA) of Mycosphaerella jijiensis and M. musicola. These primers (MF137 and MM137 respectively) were used in association with primer R635 (from a conserved sequence of the rDNA). Primers MF137 and R635 produced an amplification product of approximately 1000 bp in size with DNA from M. jijiensis. This product was not formed when DNA of M. musicola, M. minima, or a number of other fungi which are commonly found on banana leaves, was amplified. Primer combination MM1l7 and R635 produced an amplification product of approximately 1000 bp with DNA from M. musicola. The primers amplified similar sized fragments from the DNA extracted from banana leaf tissue infected with M. jijiensis and M. musicola. Southern hybridization analysis confirmed the fungal origin of these fragments.
There are two fonns of Sigatoka leaf spots which affect bananas - yellow Sigatoka, caused by the fungus Mycosphaerella musicola Leach ex Mulder (anamorph Pseudocercospora musae (Zimm.) Deighton), and the more economically destructive black Sigatoka, caused by M. fijiensis Morelet (anamorph Paracercospora fijiensis (Morelet) Deighton) (Stover, 1980). Although black Sigatoka can often be recognized visually, unambiguous diagnosis is complicated by the presence of other pathogens found on banana leaves. Isolation of the pathogen, which is most successfully achieved by ascospore discharge from necrotic leaf material. is often confounded by the absence of mature perithecia, and even when obtained in culture, M. fijiensis and M. musicola are not readily differentiated (Pons, 1990). A technique for rapid and accurate identification of these species therefore would be of great value in epidemiological research and particularly, for diseasemonitoring programmes in areas such as the Caribbean islands, which have so far been free of the pathogen. Previous work Oohanson & Templeton, 1991) has shown that randomly amplified polymorphic DNA markers (RAPDs) as described by Welsh & McClelland (1990) and Williams et al. (1990) are able to differentiate between the species of Mycosphaerella found on banana leaves. The 10-oligonucleotide primers used in this previous study were of use when analysing DNA extracted from pure cultures of the fungus, but not when infected plant DNA was amplified. Such lO-mers also find homology in the banana genome and although the fungal-specific band is amplified from infected plant DNA, many additional bands are also produced
Oohanson, unpublished data). In order to detect the fungi in plant tissue, more speCific primers are needed which have no homology with banana DNA. PCR has been used quite successfully for some time by biomedical researchers to detect pathogens in infected animal tissues, but only recently has this method been applied to detect phytopathogenic organisms, e.g. direct detection of bean yellow mosaic potyvirus in gladiolus (Vunsh et at 1990), Phoma tracheiphila, a fungal pathogen of lemon in infected woody tissue (Rollo et at 1991), and the take-all fungus Gaumannomyces graminis in infected wheat plants (Schesser et al., 1991). Ribosomal genes make good molecular probes because of their ease of isolation and relatively high gene copy number. Although the nucleotide sequences of mature RNAs are highly conserved, both non-transcribed and transcribed spacer sequences, which often make up approximately half of the rDNA repeating unit, are usually poorly conserved and may contain large sequence differences. This represents opportunity for the development of rDNA-specific probes, and a number of researchers are developing such assays (Gobel et a/., 1987). Amongst plant pathogenic fungi, this approach has been used by Nazar et a/. (1991) for detection and typing of isolates of the Verticillium wilt pathogens. From sequence infonnation of the internal transcribed spacer (ITS) regions between the mature 18S and the 28S rDNA subunits (Uu et al., 1991), we designed oligonucleotide primers which might be specific for M. fijiensis and M. musicoIa, and sensitive enough to detect these fungi in infected plant material.
A. Johanson and M. J. Jeger
671
Table 1. Source of fungal isolates used in this study Isolate
Species
Origin
Source
MQI03 CU823 StU )YI2I AU590 HSB4 CM85 NG722 RT655 PNG29I MQ78 TG78I AspI
M. musicola M. musicola
Martinique Cuba St Lucia Java Australia Honduras Cameroon Nigeria Rarotonga Papua New Guinea Martinique Tonga Windward Islands Windward Islands Windward Islands Windward Islands
X.Mourichon,IRFA IMI,Kew A. Johanson, NRI R. Fullerton, DSIR R. Fullerton, DSIR G. Molina, FHIA X. Mourichon, IRFA R. Fullerton, DSIR R. Fullerton, DSIR R. Fullerton, DSIR X. Mourichon, IRFA R. Fullerton, DSIR A. Johanson, NRI A. Johanson, NRI A. Johanson, NRI A. Johanson, NRI
Btl FrnI CgI
M. musicola M. musicola M. musicola M. jijiensis M. jijiensis M. jijiensis M. jijiensis M. jijiensis M. minima M. musae Aspergillus niger Botryodiplodia theobromae Fusarium moniliforme Colletotrichum gloeosporioides
MF137
-
I TS2
- ITS4
R635
Fig. 1. Locations of peR primers on fungal ribosomal DNA. Adapted from White et al., (1990).
MATERIALS AND METHODS Fungal isolates and genomic DNA extraction Geographical origin and source of the isolates used in this study are shown in Table 1. Cultures of the fungi were grown in Czapek-Dox (Oxoid) liquid medium plus yeast extract (I g I~l). Conical flasks (250 ml) containing approximately 50 ml of liquid medium were inoculated with mycelial fragments of the isolates from cultures on PDA (Oxoid).Cultures were incubated on an orbital shaker at approximately 26°C for 14-28 d, depending on the growth rate of each isolate. Cultures were filtered through a Buchner funneL the mycelia collected on Whatman No. 3 filter paper, and then freeze-dried. Freeze-dried mycelia were ground in liquid nitrogen and total genomic DNA was extracted using the protocols of Raeder &: Broda (1985) and Lee et al. (1990).
Plant genomic DNA extraction Most of the samples were of dried leaf material, which had been harvested from the field when already necrotic and which usually contained mature perithecia. Other samples were inoculated with the pathogen in the glasshouse, and leaves were harvested when still green and showing young leaf spot lesions. The leaf samples which showed symptoms of yellow 5igatoka were collected from Jamaica and 5t Lucia, where M. ftjiensis does not occur. Leaf samples showing typical black Sigatoka symptoms were taken from areas where M. ftjiensis is thought to predominate. Where possible, several single ascospore isolations were made from each leaf sample
and identification confirmed subsequently from conidial characteristics. All samples were freeze-dried and ground in liquid nitrogen. Total plant DNA was extracted using the same methods as those for the fungal DNA. however, the extracts were then passed through a sepharose CL-6B (Sigma) spin column (1'5 ml disposable syringe) in order to remove phenolic compounds and pigments, the presence of which appeared to inhibit subsequent DNA amplification.
Oligonucleotide synthesis Oligonucleotide synthesis was carried out by Operon Technologies Inc., Alameda, California and the John Innes Institute, Norwich, U.K. The sequence of primer R635, situated in the 255 subunit of rDNA was taken from Liu et al. (1991). Primers MF137 and MM137 were designed from the ITS sequences of isolates of M. ftjiensis and M. musicola obtained from Dr E. Stewart, Department of Plant Pathology, University of Minnesota. Primer sequences were as follows: MFI37: 5'GGCGCCCCCGGAGGCCGTCTA3'; MM137: 5'GCGGCCCCCGGAGGTCTCCTT3'; R635: 5'GGTCCGTGTTTCAAGACGG3'. Locations of PCR primers on the fungal rDNA are shown in Fig. 1. peR amplifications and product analysis
Amplification reactions were performed in 50 mM-KCL 1'5 mM-MgCl 2 , 10 mM-Tris HCL pH 8'3, containing 100 mM
PCR detection of Mycosphaerella spp. on banana of each ciATP, dCTP, dGTP, and dTTP, 200 nM primer, 2 units of Taq DNA polymerase (Promega) and approximately 25-50 ng of genomic template DNA in a final volume of 50 \,.ll. DNA amplification was performed by the polymerase chain reaction in a thermal cycler (Techne PHC-3) programmed for 3 min at 94° followed by 35 cycles of one minute at 94°, I min at 65° and 3 min at 72°. After the 35th cycle the extension reaction was continued for a further 5 min at 72° and products were held at 4° until analysed. PCR reaction samples (10-20 \,.ll) were mixed with sample buffer and run on a 1'5 % agarose gel containing 0'5 \,.ll ml- l ethidium bromide at 100 V for up to I h with Tris-borate EDTA as running buffer.
DNA blot hybridization analyses Following depurination in 0'25 M-HCl for IS min, and denaturation (1'5 \,.l-NaCl, 0'5 M-NaOH) the gels were neutralised in 1'0 M-Tris, 2'0 M-NaCl (pH 5'0) and the DNA was transferred by capillary blotting to a nitrocellulose membrane using 20 X SSe. Amplified PCR fragments from PCR reactions with primer combinations MM137jR635 (with M. musicola) and MF137 j R635 (M. fijiensis) were exised from low melting point agarose gels, placed in a 2 ml disposable syringe at - 20° for I h. The PCR fragment in buffer was then squeezed from the syringe as it thawed. The fragments were then labelled overnight using the Boehringer Mannheim Dig-DNA labelling and detection kit (non-radioactive). Filters were washed, hybridized and immunological detection was carried out according to the manufacturer's instructions.
672 product was observed in reactions containing DNA from the plant infected with M. musicola, or in the uninfected plant control (Fig. 4a). After Southern blotting, the PCR fragment from M. fijiensis was found to hybridize to the PCR product from the infected plant DNA (Fig. 4 b). DNA from two leaf samples with symptoms of yellow Sigatoka was amplified with primers MM137 and R635. Leaf material infected with M. fijiensis and uninfected material were used as controls. Amplification products were produced only in reactions containing DNA from those plants infected with M. musicola (Fig. 5 a). After Southern blotting, the PCR fragment from M. musicola was found to hybridize to the PCR products produced from the infected plant DNA (Fig. 5 b). Further work has shown that the separate annealing step may be omitted from the PCR reaction, shortening it to two steps, one of 94° (denaturation) and one of 68° (annealing and extension combined) without any reduction in the sensitivity of the technique. The specificity of the primers is consistent 2
3
4
5
6
7
8
9 10 11 12 13 14
KB 1636 1018 506
RESULTS
Specificity of primers DNA from five isolates of M. fijiensis from a wide geographical area was amplified using primers MF137 and R635. DNA from one isolate of M. musicola, one of M. musae, M. minima and a number of other fungi commonly found on banana leaves was also amplified. Amplification of DNA from all isolates of M. fijiensis produced one PCR product of approximately 1000 bp. No PCR products were observed with DNA amplified from any of the other species tested (Fig. 2). Primers MM137 and R635 were used to amplify a 1000 bp product from five isolates of M. musicola. These primers did not amplify DNA from the other Mycosphaerella species or from any other fungi tested (Fig. 3).
Fig. 2. Agarose gel of PCR products from amplification of fungal DNA with primers MF137 and R635 (stained with ethidium bromide). Lanes: 1, kb ladder size standard (Gibco-BRL); 2-6, isolates of M.fijiensis; 7, M. musicola; 8, M. minima; 9, M. musae; 10, Aspergillus niger; 11, Botryodiplodia theobromae; 12, Fusarium moniliforme; 13, C. gloeosporioides, 14, kb ladder.
2
3 4
5 6
7
8
9
10 11 12 13 14
KB 1636 1018 506
Defection from plant tissue DNA from three leaf samples which showed symptoms of black Sigatoka was amplified using primers MF137 and R63S. Leaf material infected with M. musicola and uninfected leaf material were used as controls in the PCR reaction. An amplification product of the same size as that produced from purified fungal DNA was produced in reactions containing DNA from those plants infected with M. fijiensis. No PCR
Fig. 3. Agarose gel of PCR products from amplification of fungal DNA with primers MM137 and R635 stained with ethidium bromide. Lanes: 1, kb ladder size standard (Gibco-BRL); 2-6, isolates of M. musicola; 7, M. fijiensis; 8, M. minima; 9, M. musae; 10, Aspergillus niger; 11, Botryodiplodia theobromae; 12, Fusarium moniliforme; 13, C. gloeosporioides; 14, kb ladder.
A. Johanson and M. J. Jeger
673 (b)
(a)
2
3
5
4
6
7
8
2
3
4
5
7
6
8
KB
1636 1018 506
Fig. 4. (a) Agarose gel of PCR products with primers MFI37 and R635 stained with ethidium bromide, (b) hybridized with Dig-labelled PCR fragment from M. fijiensis. Lanes: 1, kb ladder size standard (Gibco-BRL); 2, M. fijiensis (fungal DNA); 3, green leaf with early M. fijiensis infection; 4, dried leaf sample with M. fijiensis (Cook Islands); 5, dried leaf sample with M. fijiensis (Costa Rica); 6, dried leaf sample with M. musicola (Jamaica); 7, dried, uninfected leaf sample; 8, kb ladder. (b)
(a)
2
3
4
5
6
7
2
3
4
5
6
7
KB
1636 1018 506
Fig. 5. (a) Agarose gel of PCR products with primers MMI37 and R635 stained with ethidium bromide; (b) hybridized with Diglabelled peR fragment from M. musicola. Lanes: 1, kb ladder size standard (Gibco-BRL); 2, M. musicola (fungal DNA); 3, dried leaf sample with M. musicola (St Lucia); 4, dried leaf sample with M. musicola (Jamaica); 5, green leaf material with M. fijiensis; 6, dried, uninfected leaf sample; 7, kb ladder.
over a wide range of annealing temperatures. Primer MM137 does not produce a specific amplification product with M. fijiensis, and primer MF137 does not produce a product with M. musicoia even with an annealing temperature as low as 35°. Species-specific amplification products have also been obtained by using primers MF13 7 and MM13 7 in combination with other primers from the conserved regions of the rDNA. Primers MM137 and MF137 in combination with primer ITS4 (White, et ai., 1990), which is located in the 28S rDNA subunit, produces specific PCR fragments of approximately 400 bp when both fungal and infected plant DNA are amplified. Primer ITS2 produces a fragment of approximately 200 bp (data not shown).
DISCUSSION Primers designed from the ITS region between the 18S and 5·8S ribosomal DNA subunits of M. fijiensis and M. musicoia used in conjunction with a primer in the 25S rDNA subunit produce a specific amplification product when fungal DNA is amplified by the polymerase chain reaction. Primers MFI37 and R635 amplify a product of approximately 1000 bp in size only with DNA from M. fijiensis, and primers MMI37 and 43
R635 amplify a product only with M. musicoia. For both species, this specificity holds for as many isolates as have been tested. Neither set of primers amplify M. musae, M. minima, or a number of other fungi commonly found on banana leaves. These primers are also sufficiently specific, and the PCR technique sufficiently sensitive, to detect fungal DNA from infected leaf material. The fungi can be detected both at early stages of infection, and at a much later stage when the leaves are completely necrotic. Fungal DNA has been amplified from dried leaf samples up to 3 yr old, suggesting that this technique may be useful for even older herbarium specimens. In this study the banana leaf DNA was extracted by standard procedures involving phenol and chloroform. Simpler methods with fewer steps which do not require the use of phenol have been reported to have been successful with other plant species (Edwards et al., 1991). This has not so far been useful for banana tissue as it does not remove the pigmented phenolics which inhibit the PCR reaction. Other protocols are being investigated and would be expected to reduce the time necessary for processing the tissue. The sensitivity of detection has not yet been determined accurately, but is in the region of picograms of target fungal DNA. Preliminary results suggest that the use of primer ITS4, MYC 97
674
PCR detection of Mycosphaerella spp. on banana instead of R635, increases the sensitivity of detection and decreases the levels of smearing of DNA occasionally found when products are run on agarose gels. This is thought to be due to the greater errors which are likely in the amplification of a larger PCR product. The sensitivity of detection is also affected by the levels of inhibitors of DNA amplification which may be present in the plant DNA extract. In addition to using a range of dilutions of the extract for PCR, it is therefore also recommended that a control reaction is carried out with the plant extract 'spiked' with a known amount of target fungal DNA to avoid false negatives which may be due to such inhibition. The authors would like to thank Dr R. Fullerton (DSIR, New Zealand) and Dr X. Mourichon (IRF A, France) for supplying some of the isolates used in this study, Prof. P. D. S. Caligari (University of Reading) for his advice and support, and Dr A. Brown and Dr P. Mills (The Queen's University of Belfast) for assistance in the preparation of this manuscript.
Lee, S. B.. Milgroom, M. G. & Taylor, J. W. (1990). A rapid, high-yield miniprep method for isolation of total genomic DNA from fungi. Fungal Genetics Newsletter 35, 23-24. Uu, Z., Stewart, E. L. & Szabo, L. ). (1991). Phylogenetic relationships among Cercospora and allied genera on banana based on rONA sequence comparisons. Phytopathology 81, 1240 (abstract). Nazar, R. N., Hu, x., Schmidt, J., Culham, D. & Robb, J. (1991). Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of verticillium wilt pathogens. Physiological and Molecular Plant Pathology 39, 1-11. Pons, N. (1990). Taxonomy of Cl!rcospora and related genera. In 5igatoka leaf spot diseases of bananas, Proceedings of an International Workshop held at San Jose, Costa Rica, 28 March-1 April, 1989. (ed. R. A. Fullerton & R. H. Stover). Raeder, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi. Letters in Applied Microbiology 1, 17-20. Rollo, F., Salvi, R. & Torchia, P. (1991). Highly sensitive and fast detection of Phoma tracheiphila by polymerase chain reaction. Applied Microbiology and Biotechnology 32, 572-576. Schesser, K., Luder, A. & Henson, J. M. (1991). Use of polymerase chain reaction to detect the take-all fungus, Gaeumannomyces graminis in infected wheat plants. Applied and Environmental Microbiology 57, 553-556. Stover, R. H. (1980). Sigatoka leaf spot of bananas and plantains. Plant Disease 64, 750-755.
REFERENCES Edwards, K.. Johnstone, C. & Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19, 1349. Gobel. U., Geiser, A. & Stanbridge, E. O. J. (1987). Oligonucleotide probes complementary to variable regions of ribosomal RNA discriminate between mycoplasma species. Journal of General Microbiology 133, 1969--1974. Johanson, A. & Templeton, M. D. (1991). Preliminary studies of the use of PCR for random amplification of polymorphic DNA markers (RAPDs) in MycosphaereIIa fijiensis and M. musicola. In Proceedings of the X Reunion Meeting of ACORBAT, ViIIahermosa, Mexico, 2-9 November, 1991, in press.
(Accepted 3 October 1992)
Vunsh, R., Rosner, A. & Stein, A. (1990). The use of the polymerase chain readion (PCR) for the detection of bean yellow mosaic virus in gladiolus. Allnals of Applied Biology 117, 561-569. Welsh, J. & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18, 7213-7218. White, T. J., Bruns, T., Lee, S. & Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications. (ed. M. A. Innis, D. H. Gelfand, J. j. Sninsky, & T. J. White), pp. 315-322. Academic Press Inc: San Diego. Williams, J. G. K., Kubelik, A. R., Uvak. J., Rafalski, J. A. & Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, 6531-6535.