- Email: [email protected]
Comparative studies on the sensitivity of polymerase chain reaction and microscopic examination for the detection of Trypanosoma evansi in experimentally infected mice
Comparative Immunology, Microbiology & Infectious Diseases 21 (1998) 215±223
PERGAMON
C I M I D
OMPARATIVE MMUNOLOGY ICROBIOLOGY & NFECTIOUS ISEASES
Comparative studies on the sensitivity of polymerase chain reaction and microscopic examination for the detection of Trypanosoma evansi in experimentally infected mice M.K. Ijaz a, M.S.A. Nur-E-Kamal b, A.I.A. Mohamed a, F.K. Dar c, * a
Division of Infectious Diseases, H. H. Shaikh Khalifa Research Centre for Racing Camels, P O Box 17292, United Arab Emirates b Department of Biochemistry, Faculty of Medicine and Health Sciences, UAE University, P O Box 17666, United Arab Emirates c Department of Medical Microbiology, Faculty of Medicine and Health Sciences, UAE University, P O Box 17666, Al Ain, United Arab Emirates
Received for publication 27 January 1998
Abstract Trypanosoma evansi, a protozoan parasite in the blood of camels is routinely diagnosed by ®nding the ¯agellates in the wet ®lms or stained smear of peripheral blood, examined under a microscope. Although speci®c, this method is not sensitive at early stages of infection. We have tested the use of polymerase chain reaction (PCR) in the identi®cation of T. evansi in dierent stages of infection in mice and compared its sensitivity with that of the standard microscopic examination method. Using a speci®c pair of primers, it was possible to identify T. evansi in the blood of infected mice. Experimentally, groups of mice were infected with T. evansi, isolated from a naturally infected local camel and blood samples were collected every day for 30 days post-infection. Direct microscopy or PCR was applied to detect parasitaemia. Results showed that during the acute phase of infection, parasites were detected by PCR three days earlier than by microscopy. Furthermore, the infected mice were consistently positive by PCR during the chronic phase while the parasites could not be demonstrated during this period using microscopic examination. These ®ndings suggest that PCR may be applied to camel trypanosomosis during both acute and chronic phase of infection. Furthermore, it would provide an excellent tool in the evaluation of treatment of anti-trypanocidal drugs. # 1998 Elsevier Science Ltd. All rights reserved.
* Author for correspondence. 0911-6044/98/$19.00 # 1998 Elsevier Science Ltd. All rights reserved. PII: S 0 1 4 7 - 9 5 7 1 ( 9 8 ) 0 0 0 0 2 - 2
216
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
ReÂsume Trypanosoma evansi, protozoaire preÂsent dans le sang des chameaux est couramment mis en eÂvidence en trouvant les ¯agelleÂs dans les couches minces ou les gouttes de sang, examine sous microscope. Quoique speÂci®que, cette meÂthode n'est pas sensible aÁ des stades d'infection deÂbutant. Nous avons expeÂrimente l'utilisation de la PCR dans l'identi®cation de T. evansi dans les dieÂrents stades de l'infection chez les souris et compare sa sensibilite avec celle des meÂthodes d'examens microscopiques standards. Utilisant une paire speÂci®que d'amorces, il est possible d'identi®er T. evansi dans le sang infecte des souris. Experimentalement, des groupes de souris eÂtaient infecteÂs avec T. evansi, isole d'un chameau local infecte naturellement et des eÂchantillons de sang eÂtaient collecteÂs chaque jour pendant 30 jours apreÁs l'infection. Microscopie directe ou PCR eÂtaient appliqueÂs pour deÂtecter le parasiteÂmie. Les reÂsultats ont montre que durant la phase d'infection aiguÈe, des parasites eÂtaient deÂtecteÂs par PCR trois jours plus toÃt que par microscopie. De plus, les souris infecteÂes eÂtaient reÂgulieÁrement positives par PCR pendant la phase chronique alors que les parasites ne pouvaient pas eÃtre trouveÂs pendant cette peÂriode par examen microscopique. Ces conclusions montrent que le PCR peut eÃtre applique aux chameaux trypanosomiques pendant la phase d'infection aiguÈe et chronique. De plus, cela fournirait un excellent outil dans l'eÂvaluation du traitement des meÂdicaments anti-trypanocides. # 1998 Elsevier Science Ltd. All rights reserved.
1. Introduction Trypanosomosis, caused by Trypanosoma evansi is an important disease of camels (Camelus dromedarius), bovines, ovines, caprines and equines [1±5]. The disease caused by T. evansi can be acute, causing early death if untreated, or chronic aecting the health and performance of infected animals. We have observed that T. evansi infection can drastically compromise the health and performance of the racing camel. Therefore, a highly speci®c and sensitive method of disease detection is of prime importance in wealthy Arab countries where the camel now is a highly prized blood stock animal rather than the traditional supplier of milk and meat. A number of factors can in¯uence the number of parasites found in the peripheral blood of the infected animals and these vary from host to host. Animals which recover from an acute disease are often clinically normal with a low number of circulating trypanosomes. Chronic infection can also be characterized by sub-patent or low parasitaemia, and an increase in parasitaemia can take place following stress-induced immunosuppression. Additionally low parasitaemia can also be due to the localization of parasites in tissues [2, 6] or as a result of the dynamics of antigenic variation [7]. Thus, routine microscopic methods of diagnosis of trypanosomosis are unsatisfactory for their low sensitivity. These methods are useful only when there is high parasitaemia (>2.5 105/ml of blood). Mouse inoculation test is of diagnostic value but it takes many days to obtain the results [8]. Recognition of the limitations of the current routine methods has led to the application of novel techniques of molecular biology in the diagnosis of trypanosomosis.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
217
Applications of the polymerase chain reaction (PCR) have proved to be highly sensitive in the detection of various infectious agents of both medical and veterinary importance [9, 10]. Recently, the sensitivity and speci®city of PCR has been utilized even to detect the presence of parasites in speci®c vectors, and reportedly ®nd a single trypanosome [11]. The speci®cities of these assays, however, have yet to be de®ned for practical purposes. We have used, with some modi®cation, a PCR technique, using Trypanosoma brucei set of primers, to compare the sensitivity and accuracy of PCR with routine microscopy, in the diagnosis of T. evansi infections in mice.
2. Materials and methods 2.1. Animals infection and production of parasites BALB/c mice were purchased from Harlan Sprague Dawley Inc. (U.K.). The strain of T. evansi used in this study was isolated from blood samples taken from a local camel earlier in 1995. This isolate was passaged and maintained in BALB/c mice. For the present study a group of ten mice were given 0104 T. evansi trypomastigotes by intraperitoneal injection. 2.2. Microscopic examination of fresh blood for parasites For microscopic examination of the fresh blood, samples of blood were collected by tail snip of mice and examined for motile trypanosomes under a 12 mm-diameter coverslip at 400 magni®cation using an Olympus microscope model BH2 (Japan) and parasitaemia was measured using methods previously described [12]. Essentially, at various time intervals post infection, a drop of tail blood was obtained from each of the ten mice and each `wet ®lm' was scanned systematically until a hundred high power ®elds (HPF), at 10 (eye-piece) 40 (objective) magni®cation had been examined. 2.3. Blood sample collection and preparation of DNA samples For the extraction of T. evansi DNA two methods were compared. Firstly, 30 ml of whole blood was centrifuged at 10,000 g for 5 min. Plasma was discarded and 5 ml lysis buer (0.3 M NaCl, 10 mM Tris-HCl, 10 mM EDTA, 7 M urea and 2% SDS) was added and vortexed. The resultant solution was incubated in a water bath at 378C for 10 min. After incubation, 5 ml of phenol-chloroform-isoamylalcohol (25:24:1) was added and vortexed. The mixture was centrifuged at 10,000 g for 10 min and the aqueous phase was collected. The process of phenolchloroform-isoamyl-alcohol extraction was repeated and the aqueous phase was collected. The aqueous phase was extracted with chloroform-isoamyl-alcohol (24:1). The aqueous phase was mixed with 2.5 volume of ethanol (kept at ÿ208C)
218
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
Table 1 Primer sequences and predicted ampli®cation product sizes Primers TBR1 TBR2 TVW1 TVW2
Trypanosome species for subgroup T. brucei T. vivax West Africa
Primer sequences* GAATATTAAACAATGCGCAG CCATTTATTAGCTTTGTTGC CTGAGTGCTCCATGTGCC CCACCAGAACACCAACCT
Expected size of PCR products 164 150$
* Primer sequences are shown in the 5'±3' orientation. The sequences of TBR1 and TBR2 are the same as used by Masiga et al., [11] and are ®ve base pairs shorter than the primers used by Moser et al., [13]. TVW1 and TVW2 are the same as used by Masiga et al., [11] except that they are two base pairs shorter than the primers used by Masiga et al., [11]. $ Sizes approximate since the complete sequences are unavailable.
for the precipitation of genomic DNA. DNA was precipitated by centrifugation at 10,000 g for 10 min, dried and then dissolved in sterile deionised water. The DNA sample was kept at ÿ208C until used for ampli®cation by PCR. Secondly, 30 ml of whole blood was collected by tail snip and was added to tubes containing 0.2 M EDTA (®nal concentration, 16 mM) to prevent coagulation. The samples were processed immediately or stored at ÿ208C. To process 30 ml of the whole blood sample, was mixed with 100 ml of 0.1 M NaOH and the mixture was boiled for 5 min. The solution was centrifuged and the supernatant was collected. The supernatant was stored at ÿ208C until used in PCR. 2.4. PCR ampli®cation The primer sets used in these experiments were commercially prepared and are presented in Table 1. PCR reaction was performed in a 50 ml reaction mixture containing 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 250 nM each of dNTP, 0.125% glycerol, 1.25 units of taq DNA polymerase, 250 nM of primer sets and approximately 0.20% (1 ml) of the total DNA extracted from 30 ml of each of the blood samples. The reaction mixture was overlayed with paran oil and tubes containing the mixture were subjected to 30 cycles of ampli®cation in a thermocycler (Biometra). During each cycle, the samples of DNA were denatured at 948C for 1 min, annealed at 558C for 1 min and extended at 728C for 1.5 min. Prior to the cycling the mixture was subjected to 948C incubation for a period of 4 min. PCR product was then characterized by 2.5% of agarose electrophoresis. 2.5. Detection of PCR ampli®ed target DNA To detect the ampli®ed product, 5 ml each of the ampli®ed samples were mixed with 1 ml of gel loading buer (Sigma) (40% w/v sucrose, 0.1 M, pH 8.0 EDTA,
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
219
Fig. 1. Detection of T. evansi in mouse blood by PCR. Total DNA was extracted from mouse blood samples as described in ``Materials and Methods''. PCR was performed using total DNA as template and TBR1 and TBR2 or TVW1 and TVW2 primer sets. The PCR products were visualized by ethidium bromide staining and photographed. Electrophoresed ampli®cation products are shown in an ethidium bromide-stained agarose gel representing negative controls in lane 1 (containing uninfected mouse blood templates), and lane 4 (blood sample taken from T. evansi-infected mouse but ampli®ed using TWV1 and TWV2 (T. vivax speci®c primer set). Lane 11 shows T. evansi DNA as a positive control. Lanes 2, 3, 5, 6, 7, 8, 9, and 10 represent 4, 8, 12, 24, 36, 48, 72 and 720 hours post infection respectively.
0.5% w/v SDS, and bromophenol blue 0.05% w/v) and loaded in a gel containing 2.5% agarose with ethidium bromide (at a ®nal concentration of 0.4 mg/ml). The electrophoresis was carried out at a constant voltage of 80 V for 1.5 h. Following electrophoresis the gels were visualized under UV illumination and photographed. 3. Results Total DNA from T. evansi infected mouse blood samples were ampli®ed by PCR, using a pair of T. brucei speci®c primers (TBR1 and TBR2). A DNA fragment of the same size (164 bp) was ampli®ed (Fig. 1). This suggests that T. brucei and T. evansi are very closely related and have conserved sequences at least between TBR1 and TBR2. Since infection of camels and cattle by T. evansi is
220
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
common in the Arabian peninsula, these infections could be diagnosed by using TBR1 and TBR2 primers. When DNA samples extracted from dierent stages of T. evansi infection were tested by PCR, in all cases, we observed ampli®cation of the same single band of 164 bp length (Fig. 1). We could not identify any ampli®cation when DNA was extracted from non-infected murine blood indicating parasite±genome speci®c ampli®cation of PCR product. Also, no ampli®cation was observed when PCR was performed using primers (TVW1 and TVW2) speci®c for T. vivax. This further con®rms the speci®city of TBR1 and TBR2 primers for brucei group organisms but not for T. vivax. We used two methods for extraction of DNA from T. evansi infected murine blood samples: (i) Phenol:chloroform:isoamylalcohol extraction (PCM), and (ii) sodium hydroxide extraction method (SM). PCR ampli®cation of both extracts produced the same products; because of the simplicity of the sodium hydroxide extraction, this method was used in subsequent extractions. In a parallel experiment, we compared the sensitivity of PCR method and microscopic examination method to identify the limit of T. evansi infection in mice. As shown in Table 2, T. evansi infection could be identi®ed by PCR after only 4 h while no parasites were found microscopically before 72 h post-infection. The overall results obtained with the two diagnostic approaches during the one month course of T. evansi infection in mice are shown in Table 2. These results indicate clearly that the PCR assay is much more sensitive detector of T. evansi parasitaemia than microscopic examination of fresh blood. One of the aims of the present study was to determine if the PCR assay could detect acute T. evansi
Table 2 Comparison of results of PCR assays and examination for. T. evansi in mice Time post-infection (h)
Microscopy (number of parasites/HPF*)
PCR
0 4 8 12 24 (1 day) 36 48 (2 days) 72 (3 days) 150 (5 days) 240 (10 days) 360 (15 days) 720 (30 days)
ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿ +(50±100) +(100±200) +(100±200) ÿ
ÿ + + + + + + + + + + +
* HPFÐhigh power ®eld (400). Mice were infected intraperitonealy with 0104 trypanosomes; tail blood samples were taken to examine the presence of parasites by microscopy and PCR assays.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
221
infection earlier than microscopy could. Examination of the data from the ®rst 3 days of the experiment depicted in Table 2 indicates that this is the case. The PCR assay gave the diagnosis of T. evansi infection 3 days earlier than microscopic examination. Furthermore, during the chronic phase of infection when microscopy was negative, animals were shown to be parasitaemic by PCR. 4. Discussion Diagnosis of T. evansi infection in livestock and bloodstock is of considerable economic importance. Detection of trypanosomes in blood has been the `gold standard', however, ®nding the organisms, or establishing patency of parasitaemia has not always been possible even in symptomatic infections. Pre-patent periods following infection may be quite long and parasitaemia may remain sub-patent all during the chronic phase of infection. Microscopy of wet blood ®lm or of stained thick ®lms is also the least sensitive method of detecting infections with hemoprotozoa. Introduction of the Hct method of hematocrit centrifugation of blood followed by buy-coat examination [14] and elution of blood through an ion-exchange column [15] and miniature ion-exchange [16] increased the sensitivity of the microscopic methods manifold. Indirect methods of diagnosis based on the demonstration of speci®c antibodies or parasite antigens in the host blood or tissue, have higher sensitivity and a greater variability and therefore are more dicult to interpret in terms of disease status. Franke et al. [17] have shown that the variable sensitivity of the more advanced methods of detecting antibodies (Ab ELISA, CATT/T. evansi) or antigens (Ag ELISA) was determined by the phase of infection at the time of examination. Ampli®cation of minute amounts of nucleic acid, down to a single organism, by various modi®cations of the PCR has been demonstrated for a number of infectious organisms including trypanosomes [11, 13, 18], and the primers used have sucient speci®city to detect species dierences. With the brucei-subgroup though, it would appear that there is a signi®cant degree of homology in the conserved regions of DNA to allow for `cross-reaction'. Thus the present study showed that our T. brucei primers, TBR1 and TBR2 were able to detect experimental T. evansi infection in mice whereas the T. vivax primers, TVW1 and TVW2, were not able to amplify T. evansi DNA. At this stage, we are unable to distinguish between T. evansi and T. brucei infection by PCR. However, an early infection of either T. evansi or T. brucei or both could be detected by PCR using TBR1 and TBR2 primers. It may be that the PCR product that was ampli®ed from T. evansi DNA with a pair of T. brucei primers (TBR1 and TBR2) does not have exactly the same sequence as T. brucei. Determination of nucleotide sequence of T. evansi PCR product may provide information that would help to design T. evansi speci®c primers. Work is now in progress to determine the nucleotide sequence of PCR product obtained from T. evansi.
222
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
It is interesting to note that Nantulya et al. [19] demonstrated a similar bruceisubgroup homology, by using T. brucei group speci®c monoclonal antibodies to detect circulating trypanosomal antigens in T. evansi infected animals. Our results again showed that PCR was demonstrably more sensitive in detecting infections only 4 h after intraperitoneal inoculation of trypanosomes; whereas microscopy only became positive some 72±150 h (3±5 days) later. The infective dose in our experimental mice was probably much higher than would obtain in ®eld conditions where natural infections are initiated by inoculation of a much lower number of parasites. This is particularly true of T. evansi which is thought to be transmitted `mechanically' by non-speci®c blood sucking ¯y vectors (Chrysops and Tabanus species). Parasites are not thought to `develop' in these vectors; unlike other trypanosomes (e.g. T. brucei in Glossina or T. cruzi in Triatoma) which are `biologically' transmitted by speci®c insect vectors in which the parasites undergo physiological development and reproduction and multiplication. As a consequence of low dose infection, the pre-patent periods in T. evansi may be longer, and even when symptoms have developed, trypanosomes may still not be demonstrable in blood, thus delaying treatment and thereby increasing morbidity and mortality. Application of PCR to ®eld diagnosis of T. evansi is therefore clearly indicated by our results. As the T. evansi infection in our experimental mice progressed into a chronic phase (>30 days), the animals became aparasitaemic by our conventional microscopic examinations. PCR, however, remained positive. This again highlights the problem of sub-patent infections in ®eld conditions when treatment may be withheld or stopped prematurely, leading to recrudescence of infection and possible development of drug resistance of organisms. Field application of PCR would again not only ensure early diagnosis and treatment in individual animals, but the identi®cation of the animal reservoir of infection would help eliminate the threat to camel (and equine) herds which are grazed and housed together and where blood-sucking mechanical ¯y vectors are ever present. Studies are in progress at the moment in experimental as well as ®eld camels.
References [1] Boid R, El Amin G, Mahmoud NM, Luckins AG. Infection with Trypanosoma evansi and antibodies in goats, sheep, and camels in Kassala Province, Sudan. Trop. Anim. Hlth. Prod. 1981;13:141±6. [2] Losos GJ. Diseases caused by Trypanosoma evansi. A review. Vet. Res. Commun. 1980;4:165±81. [3] Luckins AG, Boid R, Rae PF, Mahmoud MM, El Malik KH, Gray AR. Serodiagnosis of infection with Trypanosoma evansi in camels in Sudan. Trop. Anim. Hlth Prod. 1979;11:1±16. [4] Luckins AG. Trypanosoma evansi in Asia. Parasitol. Today 1988;4:137±41. [5] Lun ZR, Fang Y, Wang CJ, Brun R. Trypanosomosis of domestic animals in China. Parasitol. Today 1993;9:41±5. [6] Boid R, Hunter AG, Jones TW, Ross CA, Sutherland D, Luckins AG. Trop. Anim. Hlth. Prod. 1996;28:5±22.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
223
[7] Jones TW, McKinnell CD. Antigenic variation in Trypanosoma evansi. Isolation and characterization of variable antigen type populations from rabbit infected with stock of T. evansi. Tropenmed. Parasit. 1984;35:237±41. [8] Godfrey DG, Killick-Kendrick R. Trypanosoma evansi of camels in Nigeria: A high incidence demonstrated by the inoculation of blood into rats. Ann. Trop. Med. Parasit. 1962;56:14±19. [9] Peter JB. The polymerase chain reaction. Amplifying our option. Rev. Infect. Dis. 1991;13:166±71. [10] Wilson SM. Nucleic acid techniques and the detection of parasitic diseases. Parasitol. Today 1991;7:255±9. [11] Masiga DK, Smyth AJ, Hayes P, Bromidge TJ, Gibson WC. Sensitive detection of Trypanosomes in tsetse ¯ies by DNA ampli®cation. Int. J. Parasitol. 1992;22:909±18. [12] Coulombe LS. Hematologic procedures. In: Macinnis AJ, Voge M, editors. Experiments and Techniques in Parasitology. WH Freeman and Company, San Francisco, 1970:149±155. [13] Moser DR, Cook GA, Ochs DE, Baily CP, McKane MR, Donelson JE. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA ampli®cation using the polymerase chain reaction. Parasitol. 1989;99:57±66. [14] Woo PTK. The haematocrit centrifuge for the detection of trypanosomes in blood. Can. J. Zool. 1969;47:921±3. [15] Lanham SM, Godfrey DG. Isolation of salivarian trypanosomes from man and other mammals using DEAE-cellulose. Exp. Parasitol. 1970;28:521±34. [16] Lumsden WHR, Kimber CD, Evans DA, Doig SJ. Trypanosoma brucei: miniature-anion exchange centrifugation technique for detection of low parasitaemias: adaptation for ®eld use. Trans. R. Soc. Trop. Med. Hyg. 1979;73:312±7. [17] Franke CR, Greiner M, Mehlitz D. Monitoring of clinical, parasitological and serological parameters during an experimental infection of capybaras (Hydrochaeris hydrochaeris) with Trypanosoma evansi. Acta Trop. 1994;58:171±4. [18] Russomando G, Figueredo A, Almiron M, Sakamoto M, Morita K. Polymerase chain reactionbased detection of Trypanosoma cruzi DNA in serum. J. Clin. Microbiol. 1992;30:2864±8. [19] Nantulya VM, Bajyana Songa E, Hamers R. Detection of circulating trypanosomal antigens in Trypanosoma evansi infected animals using a T. brucei group-speci®c monoclonal antibody. Trop. Med. Parasitol. 1989;40:263±6.
PERGAMON
C I M I D
OMPARATIVE MMUNOLOGY ICROBIOLOGY & NFECTIOUS ISEASES
Comparative studies on the sensitivity of polymerase chain reaction and microscopic examination for the detection of Trypanosoma evansi in experimentally infected mice M.K. Ijaz a, M.S.A. Nur-E-Kamal b, A.I.A. Mohamed a, F.K. Dar c, * a
Division of Infectious Diseases, H. H. Shaikh Khalifa Research Centre for Racing Camels, P O Box 17292, United Arab Emirates b Department of Biochemistry, Faculty of Medicine and Health Sciences, UAE University, P O Box 17666, United Arab Emirates c Department of Medical Microbiology, Faculty of Medicine and Health Sciences, UAE University, P O Box 17666, Al Ain, United Arab Emirates
Received for publication 27 January 1998
Abstract Trypanosoma evansi, a protozoan parasite in the blood of camels is routinely diagnosed by ®nding the ¯agellates in the wet ®lms or stained smear of peripheral blood, examined under a microscope. Although speci®c, this method is not sensitive at early stages of infection. We have tested the use of polymerase chain reaction (PCR) in the identi®cation of T. evansi in dierent stages of infection in mice and compared its sensitivity with that of the standard microscopic examination method. Using a speci®c pair of primers, it was possible to identify T. evansi in the blood of infected mice. Experimentally, groups of mice were infected with T. evansi, isolated from a naturally infected local camel and blood samples were collected every day for 30 days post-infection. Direct microscopy or PCR was applied to detect parasitaemia. Results showed that during the acute phase of infection, parasites were detected by PCR three days earlier than by microscopy. Furthermore, the infected mice were consistently positive by PCR during the chronic phase while the parasites could not be demonstrated during this period using microscopic examination. These ®ndings suggest that PCR may be applied to camel trypanosomosis during both acute and chronic phase of infection. Furthermore, it would provide an excellent tool in the evaluation of treatment of anti-trypanocidal drugs. # 1998 Elsevier Science Ltd. All rights reserved.
* Author for correspondence. 0911-6044/98/$19.00 # 1998 Elsevier Science Ltd. All rights reserved. PII: S 0 1 4 7 - 9 5 7 1 ( 9 8 ) 0 0 0 0 2 - 2
216
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
ReÂsume Trypanosoma evansi, protozoaire preÂsent dans le sang des chameaux est couramment mis en eÂvidence en trouvant les ¯agelleÂs dans les couches minces ou les gouttes de sang, examine sous microscope. Quoique speÂci®que, cette meÂthode n'est pas sensible aÁ des stades d'infection deÂbutant. Nous avons expeÂrimente l'utilisation de la PCR dans l'identi®cation de T. evansi dans les dieÂrents stades de l'infection chez les souris et compare sa sensibilite avec celle des meÂthodes d'examens microscopiques standards. Utilisant une paire speÂci®que d'amorces, il est possible d'identi®er T. evansi dans le sang infecte des souris. Experimentalement, des groupes de souris eÂtaient infecteÂs avec T. evansi, isole d'un chameau local infecte naturellement et des eÂchantillons de sang eÂtaient collecteÂs chaque jour pendant 30 jours apreÁs l'infection. Microscopie directe ou PCR eÂtaient appliqueÂs pour deÂtecter le parasiteÂmie. Les reÂsultats ont montre que durant la phase d'infection aiguÈe, des parasites eÂtaient deÂtecteÂs par PCR trois jours plus toÃt que par microscopie. De plus, les souris infecteÂes eÂtaient reÂgulieÁrement positives par PCR pendant la phase chronique alors que les parasites ne pouvaient pas eÃtre trouveÂs pendant cette peÂriode par examen microscopique. Ces conclusions montrent que le PCR peut eÃtre applique aux chameaux trypanosomiques pendant la phase d'infection aiguÈe et chronique. De plus, cela fournirait un excellent outil dans l'eÂvaluation du traitement des meÂdicaments anti-trypanocides. # 1998 Elsevier Science Ltd. All rights reserved.
1. Introduction Trypanosomosis, caused by Trypanosoma evansi is an important disease of camels (Camelus dromedarius), bovines, ovines, caprines and equines [1±5]. The disease caused by T. evansi can be acute, causing early death if untreated, or chronic aecting the health and performance of infected animals. We have observed that T. evansi infection can drastically compromise the health and performance of the racing camel. Therefore, a highly speci®c and sensitive method of disease detection is of prime importance in wealthy Arab countries where the camel now is a highly prized blood stock animal rather than the traditional supplier of milk and meat. A number of factors can in¯uence the number of parasites found in the peripheral blood of the infected animals and these vary from host to host. Animals which recover from an acute disease are often clinically normal with a low number of circulating trypanosomes. Chronic infection can also be characterized by sub-patent or low parasitaemia, and an increase in parasitaemia can take place following stress-induced immunosuppression. Additionally low parasitaemia can also be due to the localization of parasites in tissues [2, 6] or as a result of the dynamics of antigenic variation [7]. Thus, routine microscopic methods of diagnosis of trypanosomosis are unsatisfactory for their low sensitivity. These methods are useful only when there is high parasitaemia (>2.5 105/ml of blood). Mouse inoculation test is of diagnostic value but it takes many days to obtain the results [8]. Recognition of the limitations of the current routine methods has led to the application of novel techniques of molecular biology in the diagnosis of trypanosomosis.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
217
Applications of the polymerase chain reaction (PCR) have proved to be highly sensitive in the detection of various infectious agents of both medical and veterinary importance [9, 10]. Recently, the sensitivity and speci®city of PCR has been utilized even to detect the presence of parasites in speci®c vectors, and reportedly ®nd a single trypanosome [11]. The speci®cities of these assays, however, have yet to be de®ned for practical purposes. We have used, with some modi®cation, a PCR technique, using Trypanosoma brucei set of primers, to compare the sensitivity and accuracy of PCR with routine microscopy, in the diagnosis of T. evansi infections in mice.
2. Materials and methods 2.1. Animals infection and production of parasites BALB/c mice were purchased from Harlan Sprague Dawley Inc. (U.K.). The strain of T. evansi used in this study was isolated from blood samples taken from a local camel earlier in 1995. This isolate was passaged and maintained in BALB/c mice. For the present study a group of ten mice were given 0104 T. evansi trypomastigotes by intraperitoneal injection. 2.2. Microscopic examination of fresh blood for parasites For microscopic examination of the fresh blood, samples of blood were collected by tail snip of mice and examined for motile trypanosomes under a 12 mm-diameter coverslip at 400 magni®cation using an Olympus microscope model BH2 (Japan) and parasitaemia was measured using methods previously described [12]. Essentially, at various time intervals post infection, a drop of tail blood was obtained from each of the ten mice and each `wet ®lm' was scanned systematically until a hundred high power ®elds (HPF), at 10 (eye-piece) 40 (objective) magni®cation had been examined. 2.3. Blood sample collection and preparation of DNA samples For the extraction of T. evansi DNA two methods were compared. Firstly, 30 ml of whole blood was centrifuged at 10,000 g for 5 min. Plasma was discarded and 5 ml lysis buer (0.3 M NaCl, 10 mM Tris-HCl, 10 mM EDTA, 7 M urea and 2% SDS) was added and vortexed. The resultant solution was incubated in a water bath at 378C for 10 min. After incubation, 5 ml of phenol-chloroform-isoamylalcohol (25:24:1) was added and vortexed. The mixture was centrifuged at 10,000 g for 10 min and the aqueous phase was collected. The process of phenolchloroform-isoamyl-alcohol extraction was repeated and the aqueous phase was collected. The aqueous phase was extracted with chloroform-isoamyl-alcohol (24:1). The aqueous phase was mixed with 2.5 volume of ethanol (kept at ÿ208C)
218
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
Table 1 Primer sequences and predicted ampli®cation product sizes Primers TBR1 TBR2 TVW1 TVW2
Trypanosome species for subgroup T. brucei T. vivax West Africa
Primer sequences* GAATATTAAACAATGCGCAG CCATTTATTAGCTTTGTTGC CTGAGTGCTCCATGTGCC CCACCAGAACACCAACCT
Expected size of PCR products 164 150$
* Primer sequences are shown in the 5'±3' orientation. The sequences of TBR1 and TBR2 are the same as used by Masiga et al., [11] and are ®ve base pairs shorter than the primers used by Moser et al., [13]. TVW1 and TVW2 are the same as used by Masiga et al., [11] except that they are two base pairs shorter than the primers used by Masiga et al., [11]. $ Sizes approximate since the complete sequences are unavailable.
for the precipitation of genomic DNA. DNA was precipitated by centrifugation at 10,000 g for 10 min, dried and then dissolved in sterile deionised water. The DNA sample was kept at ÿ208C until used for ampli®cation by PCR. Secondly, 30 ml of whole blood was collected by tail snip and was added to tubes containing 0.2 M EDTA (®nal concentration, 16 mM) to prevent coagulation. The samples were processed immediately or stored at ÿ208C. To process 30 ml of the whole blood sample, was mixed with 100 ml of 0.1 M NaOH and the mixture was boiled for 5 min. The solution was centrifuged and the supernatant was collected. The supernatant was stored at ÿ208C until used in PCR. 2.4. PCR ampli®cation The primer sets used in these experiments were commercially prepared and are presented in Table 1. PCR reaction was performed in a 50 ml reaction mixture containing 20 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 250 nM each of dNTP, 0.125% glycerol, 1.25 units of taq DNA polymerase, 250 nM of primer sets and approximately 0.20% (1 ml) of the total DNA extracted from 30 ml of each of the blood samples. The reaction mixture was overlayed with paran oil and tubes containing the mixture were subjected to 30 cycles of ampli®cation in a thermocycler (Biometra). During each cycle, the samples of DNA were denatured at 948C for 1 min, annealed at 558C for 1 min and extended at 728C for 1.5 min. Prior to the cycling the mixture was subjected to 948C incubation for a period of 4 min. PCR product was then characterized by 2.5% of agarose electrophoresis. 2.5. Detection of PCR ampli®ed target DNA To detect the ampli®ed product, 5 ml each of the ampli®ed samples were mixed with 1 ml of gel loading buer (Sigma) (40% w/v sucrose, 0.1 M, pH 8.0 EDTA,
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
219
Fig. 1. Detection of T. evansi in mouse blood by PCR. Total DNA was extracted from mouse blood samples as described in ``Materials and Methods''. PCR was performed using total DNA as template and TBR1 and TBR2 or TVW1 and TVW2 primer sets. The PCR products were visualized by ethidium bromide staining and photographed. Electrophoresed ampli®cation products are shown in an ethidium bromide-stained agarose gel representing negative controls in lane 1 (containing uninfected mouse blood templates), and lane 4 (blood sample taken from T. evansi-infected mouse but ampli®ed using TWV1 and TWV2 (T. vivax speci®c primer set). Lane 11 shows T. evansi DNA as a positive control. Lanes 2, 3, 5, 6, 7, 8, 9, and 10 represent 4, 8, 12, 24, 36, 48, 72 and 720 hours post infection respectively.
0.5% w/v SDS, and bromophenol blue 0.05% w/v) and loaded in a gel containing 2.5% agarose with ethidium bromide (at a ®nal concentration of 0.4 mg/ml). The electrophoresis was carried out at a constant voltage of 80 V for 1.5 h. Following electrophoresis the gels were visualized under UV illumination and photographed. 3. Results Total DNA from T. evansi infected mouse blood samples were ampli®ed by PCR, using a pair of T. brucei speci®c primers (TBR1 and TBR2). A DNA fragment of the same size (164 bp) was ampli®ed (Fig. 1). This suggests that T. brucei and T. evansi are very closely related and have conserved sequences at least between TBR1 and TBR2. Since infection of camels and cattle by T. evansi is
220
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
common in the Arabian peninsula, these infections could be diagnosed by using TBR1 and TBR2 primers. When DNA samples extracted from dierent stages of T. evansi infection were tested by PCR, in all cases, we observed ampli®cation of the same single band of 164 bp length (Fig. 1). We could not identify any ampli®cation when DNA was extracted from non-infected murine blood indicating parasite±genome speci®c ampli®cation of PCR product. Also, no ampli®cation was observed when PCR was performed using primers (TVW1 and TVW2) speci®c for T. vivax. This further con®rms the speci®city of TBR1 and TBR2 primers for brucei group organisms but not for T. vivax. We used two methods for extraction of DNA from T. evansi infected murine blood samples: (i) Phenol:chloroform:isoamylalcohol extraction (PCM), and (ii) sodium hydroxide extraction method (SM). PCR ampli®cation of both extracts produced the same products; because of the simplicity of the sodium hydroxide extraction, this method was used in subsequent extractions. In a parallel experiment, we compared the sensitivity of PCR method and microscopic examination method to identify the limit of T. evansi infection in mice. As shown in Table 2, T. evansi infection could be identi®ed by PCR after only 4 h while no parasites were found microscopically before 72 h post-infection. The overall results obtained with the two diagnostic approaches during the one month course of T. evansi infection in mice are shown in Table 2. These results indicate clearly that the PCR assay is much more sensitive detector of T. evansi parasitaemia than microscopic examination of fresh blood. One of the aims of the present study was to determine if the PCR assay could detect acute T. evansi
Table 2 Comparison of results of PCR assays and examination for. T. evansi in mice Time post-infection (h)
Microscopy (number of parasites/HPF*)
PCR
0 4 8 12 24 (1 day) 36 48 (2 days) 72 (3 days) 150 (5 days) 240 (10 days) 360 (15 days) 720 (30 days)
ÿ ÿ ÿ ÿ ÿ ÿ ÿ ÿ +(50±100) +(100±200) +(100±200) ÿ
ÿ + + + + + + + + + + +
* HPFÐhigh power ®eld (400). Mice were infected intraperitonealy with 0104 trypanosomes; tail blood samples were taken to examine the presence of parasites by microscopy and PCR assays.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
221
infection earlier than microscopy could. Examination of the data from the ®rst 3 days of the experiment depicted in Table 2 indicates that this is the case. The PCR assay gave the diagnosis of T. evansi infection 3 days earlier than microscopic examination. Furthermore, during the chronic phase of infection when microscopy was negative, animals were shown to be parasitaemic by PCR. 4. Discussion Diagnosis of T. evansi infection in livestock and bloodstock is of considerable economic importance. Detection of trypanosomes in blood has been the `gold standard', however, ®nding the organisms, or establishing patency of parasitaemia has not always been possible even in symptomatic infections. Pre-patent periods following infection may be quite long and parasitaemia may remain sub-patent all during the chronic phase of infection. Microscopy of wet blood ®lm or of stained thick ®lms is also the least sensitive method of detecting infections with hemoprotozoa. Introduction of the Hct method of hematocrit centrifugation of blood followed by buy-coat examination [14] and elution of blood through an ion-exchange column [15] and miniature ion-exchange [16] increased the sensitivity of the microscopic methods manifold. Indirect methods of diagnosis based on the demonstration of speci®c antibodies or parasite antigens in the host blood or tissue, have higher sensitivity and a greater variability and therefore are more dicult to interpret in terms of disease status. Franke et al. [17] have shown that the variable sensitivity of the more advanced methods of detecting antibodies (Ab ELISA, CATT/T. evansi) or antigens (Ag ELISA) was determined by the phase of infection at the time of examination. Ampli®cation of minute amounts of nucleic acid, down to a single organism, by various modi®cations of the PCR has been demonstrated for a number of infectious organisms including trypanosomes [11, 13, 18], and the primers used have sucient speci®city to detect species dierences. With the brucei-subgroup though, it would appear that there is a signi®cant degree of homology in the conserved regions of DNA to allow for `cross-reaction'. Thus the present study showed that our T. brucei primers, TBR1 and TBR2 were able to detect experimental T. evansi infection in mice whereas the T. vivax primers, TVW1 and TVW2, were not able to amplify T. evansi DNA. At this stage, we are unable to distinguish between T. evansi and T. brucei infection by PCR. However, an early infection of either T. evansi or T. brucei or both could be detected by PCR using TBR1 and TBR2 primers. It may be that the PCR product that was ampli®ed from T. evansi DNA with a pair of T. brucei primers (TBR1 and TBR2) does not have exactly the same sequence as T. brucei. Determination of nucleotide sequence of T. evansi PCR product may provide information that would help to design T. evansi speci®c primers. Work is now in progress to determine the nucleotide sequence of PCR product obtained from T. evansi.
222
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
It is interesting to note that Nantulya et al. [19] demonstrated a similar bruceisubgroup homology, by using T. brucei group speci®c monoclonal antibodies to detect circulating trypanosomal antigens in T. evansi infected animals. Our results again showed that PCR was demonstrably more sensitive in detecting infections only 4 h after intraperitoneal inoculation of trypanosomes; whereas microscopy only became positive some 72±150 h (3±5 days) later. The infective dose in our experimental mice was probably much higher than would obtain in ®eld conditions where natural infections are initiated by inoculation of a much lower number of parasites. This is particularly true of T. evansi which is thought to be transmitted `mechanically' by non-speci®c blood sucking ¯y vectors (Chrysops and Tabanus species). Parasites are not thought to `develop' in these vectors; unlike other trypanosomes (e.g. T. brucei in Glossina or T. cruzi in Triatoma) which are `biologically' transmitted by speci®c insect vectors in which the parasites undergo physiological development and reproduction and multiplication. As a consequence of low dose infection, the pre-patent periods in T. evansi may be longer, and even when symptoms have developed, trypanosomes may still not be demonstrable in blood, thus delaying treatment and thereby increasing morbidity and mortality. Application of PCR to ®eld diagnosis of T. evansi is therefore clearly indicated by our results. As the T. evansi infection in our experimental mice progressed into a chronic phase (>30 days), the animals became aparasitaemic by our conventional microscopic examinations. PCR, however, remained positive. This again highlights the problem of sub-patent infections in ®eld conditions when treatment may be withheld or stopped prematurely, leading to recrudescence of infection and possible development of drug resistance of organisms. Field application of PCR would again not only ensure early diagnosis and treatment in individual animals, but the identi®cation of the animal reservoir of infection would help eliminate the threat to camel (and equine) herds which are grazed and housed together and where blood-sucking mechanical ¯y vectors are ever present. Studies are in progress at the moment in experimental as well as ®eld camels.
References [1] Boid R, El Amin G, Mahmoud NM, Luckins AG. Infection with Trypanosoma evansi and antibodies in goats, sheep, and camels in Kassala Province, Sudan. Trop. Anim. Hlth. Prod. 1981;13:141±6. [2] Losos GJ. Diseases caused by Trypanosoma evansi. A review. Vet. Res. Commun. 1980;4:165±81. [3] Luckins AG, Boid R, Rae PF, Mahmoud MM, El Malik KH, Gray AR. Serodiagnosis of infection with Trypanosoma evansi in camels in Sudan. Trop. Anim. Hlth Prod. 1979;11:1±16. [4] Luckins AG. Trypanosoma evansi in Asia. Parasitol. Today 1988;4:137±41. [5] Lun ZR, Fang Y, Wang CJ, Brun R. Trypanosomosis of domestic animals in China. Parasitol. Today 1993;9:41±5. [6] Boid R, Hunter AG, Jones TW, Ross CA, Sutherland D, Luckins AG. Trop. Anim. Hlth. Prod. 1996;28:5±22.
M. Ijaz et al. / Comp. Immun. Microbiol. Infect. Dis. 21 (1998) 215±223
223
[7] Jones TW, McKinnell CD. Antigenic variation in Trypanosoma evansi. Isolation and characterization of variable antigen type populations from rabbit infected with stock of T. evansi. Tropenmed. Parasit. 1984;35:237±41. [8] Godfrey DG, Killick-Kendrick R. Trypanosoma evansi of camels in Nigeria: A high incidence demonstrated by the inoculation of blood into rats. Ann. Trop. Med. Parasit. 1962;56:14±19. [9] Peter JB. The polymerase chain reaction. Amplifying our option. Rev. Infect. Dis. 1991;13:166±71. [10] Wilson SM. Nucleic acid techniques and the detection of parasitic diseases. Parasitol. Today 1991;7:255±9. [11] Masiga DK, Smyth AJ, Hayes P, Bromidge TJ, Gibson WC. Sensitive detection of Trypanosomes in tsetse ¯ies by DNA ampli®cation. Int. J. Parasitol. 1992;22:909±18. [12] Coulombe LS. Hematologic procedures. In: Macinnis AJ, Voge M, editors. Experiments and Techniques in Parasitology. WH Freeman and Company, San Francisco, 1970:149±155. [13] Moser DR, Cook GA, Ochs DE, Baily CP, McKane MR, Donelson JE. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA ampli®cation using the polymerase chain reaction. Parasitol. 1989;99:57±66. [14] Woo PTK. The haematocrit centrifuge for the detection of trypanosomes in blood. Can. J. Zool. 1969;47:921±3. [15] Lanham SM, Godfrey DG. Isolation of salivarian trypanosomes from man and other mammals using DEAE-cellulose. Exp. Parasitol. 1970;28:521±34. [16] Lumsden WHR, Kimber CD, Evans DA, Doig SJ. Trypanosoma brucei: miniature-anion exchange centrifugation technique for detection of low parasitaemias: adaptation for ®eld use. Trans. R. Soc. Trop. Med. Hyg. 1979;73:312±7. [17] Franke CR, Greiner M, Mehlitz D. Monitoring of clinical, parasitological and serological parameters during an experimental infection of capybaras (Hydrochaeris hydrochaeris) with Trypanosoma evansi. Acta Trop. 1994;58:171±4. [18] Russomando G, Figueredo A, Almiron M, Sakamoto M, Morita K. Polymerase chain reactionbased detection of Trypanosoma cruzi DNA in serum. J. Clin. Microbiol. 1992;30:2864±8. [19] Nantulya VM, Bajyana Songa E, Hamers R. Detection of circulating trypanosomal antigens in Trypanosoma evansi infected animals using a T. brucei group-speci®c monoclonal antibody. Trop. Med. Parasitol. 1989;40:263±6.