- Email: [email protected]
The use of the polymerase chain reaction for the detection of Simian immunodeficiency virus in experimentally infected macaques
Journal of Virologicul Methods, 28 (1990) 85-100 Elsevier
85
VIRMET 1001
The use of the polymerase chain reaction for the detection of Simian immunodeficiency virus in experimentally infected macaques P.A. Kitchinl, N. Almond’, Z. Szotyoril, C.E. Fromholcl, L. McAlpinel9*, P. Silvera’, E.J. Stott’, M. Cranage2, A. Baskerville2 and G. Schikl’ ‘WHO AIDS CollaboratingCentre, NationalInstitutefor Biological Standards and Control, South Mimms, Potters Bar, U.K. and ‘Centre for Applied Microbiology and Research, Division of Pathology, Porton Down, Salisbury, U.K. (Accepted 8 December 1989)
Summary A rapid, non-radioactive assay for the detection of proviral Simian immunodeficiency virus (SIV) in tissue-culture cells is described. The assay is based on the co-amplification of the SIV env and gag genes by the polymerase chain reaction (PCR). When the gag PCR product is blotted onto a nylon membrane and hybridised to a radioactive oligonucleotide probe, the assay can also be used to detect the SIV gag gene in DNA isolated directly from experimentally infected cynomolgus macaque lymphocytes. This provides a valuable assay for the presence of proviral SIV during animal trials of AIDS vaccines and chemotherapeutics. Simian immunodeficiency virus; Polymerase AIDS; Simian AIDS; Macaca fascicularis
chain reaction;
Animal model for
Correspondence to: P.A. Kitchin, WHO AIDS Collaborating Centre, National Institute for Biological Standards and Control, South Mimms, Potters Bar, Herts EN6 3QG, U.K. ‘Present address: Virus Research Laboratory, Public Health Laboratory Service, Colindale, London, U.K. 0166-0934/90/$03.50 0 1990 Elsevier Science Publishers B.V. (Biomedical Division)
86
Introduction
Several experimental primate models of human AIDS have been described, based on the infection of macaques with various strains of simian immunodeficiency virus (SIV) (Fultz et al., 1986; Kannagi et al., 1986; Murphy-Corb et al., 1986). These models can be used for studying the interactions of immunodeficiency viruses with their hosts, as well as for challenge studies and potential vaccine trials (Desrosiers et al., 1989). The study of these animals typically involves an assessment of their viraemic, serological, haematological and pathological status. Although such analyses reveal much about the overall status of each animal, there is, at present, no assay which can easily assess the proviral burden of these animals. Such information would be of great value for pathological studies, as well as vaccination and therapeutic trials. In this context, the recently described nucleic acid amplification procedure, known as the polymerase chain reaction (PCR) has been used to assess the proviral status of human AIDS patients, infected with the human immunodeficiency virus (Ou et al., 1988). The polymerase chain reaction utilises two primers of known sequence, homologous to regions flanking the DNA segment to be amplified. The target DNA is denatured by heating, and the primers are allowed to anneal to their complementary regions. The primers are subsequently extended at high temperature by the enzymatic action of the DNA polymerase isolated from Thermus aquaticus (Tuq). Since these newly synthesised DNA strands will serve as templates themselves, repeated cycles of denaturation, primer annealing and extension, result in an exponential increase in copies of the DNA flanked by the primers (Kwok et al., 1987; Saiki et al., 1988). By using primers complementary to specific DNA regions of HIV, it is possible to amplify the viral genes to levels where they can be easily detected. We report here the conditions for a rapid and specific PCR assay facilitating the identification of SIV sequences in tissue culture material. A modified version of this assay is also capable of detecting proviral SIV sequences in DNA isolated directly from infected monkey lymphocytes.
Materials
and Methods
Animal infections and derivation of SIVmac251
(32H isolate)
As part of a much wider study (Kitchin et al., 1989), a rhesus macaque (number 32H) was injected intravenously with SIVmac251 (low passage), kindly supplied by Dr R. Desrosiers of the New England Regional Primate Research Center. Peripheral blood lymphocytes (PBL) were isolated from Rhesus 32H, 57 days post inoculation (p.i.) by centrifugation of blood diluted 1:l with RPM1 1640 on Ficollhypaque cushions. After culture of the PBLs for 3 days in the presence of phytohaemagglutinin (PHA), PHA stimulated human cord blood lymphocytes (CBL) and 400 IU of recombinant human Interleukin 2 were added. Cultures were fed
with freshly stimulated CBL on a further three occasions over a 17-day period and were monitored for cytopathic effect and the production of cell-free reverse transcriptase activity. Virus was subsequently adapted to C8166 cells (Salahuddin et al., 1983) by addition of C8166 cells to the adherent cell population remaining in the primary cell culture flask after draining. These cultures were fed every 3 to 4 days with freshly fed C8166 cells in a ratio of 1:3 v/v. Extensive cytopathic effect was seen within 5 days of culture. Three secondary cultures were used as a source of DNA for the subsequent PCR experiments. The virus is denoted as SIVmac251 (32H isolate). Virus re-isolation from infected animals
PBLs were isolated on Percoll gradients and co-cultivated with C8166 cells in the presence of PI-IA. The cultures were subsequently fed twice weekly with RPMI 1640 containing 10% foetal calf serum and 10 II-J/ml of IL2. The appearance of syncytia indicated the presence of SIV which was also confirmed by detection of p24 antigen (DuPont ELISA). DNA extractions
SIV infected 03166 cells from 1 ml of culture (about 5 x 10s cells) were resuspended in 100 ~1 of TidElo buffer (10 mM Tris-HCl, pH 7.4; 10 mM EDTA). SDS and proteinase K were added to final concentrations of 0.5% w/v and 100 @ml, respectively. After 1 h at 37°C the DNA was extracted with a phenol-chloroform mix, precipitated with ethanol and resuspended in 50 ~1 of T,,JE, buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA). DNA extractions made directly from isolated monkey PBLs were from the equivalent of 500 ~1 original blood volume (about 5 x 105 lymphocytes). Standard polymerclse chain reaction conditions
Each reaction was performed in a 1.5 ml Eppendorf tube in a total volume of 50 p,l containing the following: 10 mM Tris-HCl, pH 8.3 (at 25°C); 50 mM KCl; 1.5 mM MgCl,; 0.01% w/v gelatin; 200 PM each of dATP, dCIP, dGTP, dlTP; 1 p,M of each primer (see Table 1); 1.7 ng DNA template; 1.25 units of Taq polymerase (Cetus). Reactions were overlayed with 100 l.i.1of mineral oil and amplified for 25 cycles using an automated temperature cycler (Hybaid Intelligent Heating Block). The program was operated in mode 4 as follows: 94°C for 1 min 3 s (X 1); 36°C for 2 min, 72°C for 2 min 50 s, 94°C for 35 s (X 25); 37°C for 2 min, 72°C for 10 min (X 1). Modified PCR conditions
The reaction was as described above, but with the following modifications: mM MgClz and both pairs of primers at 0.1 p_Mfinal concentration.
1.0
88 Precautions taken when the PCR is applied to macaque PBLs
Misleading results can occur during PCR amplification from the ‘carry-over’ of DNA as contamination from one positive sample to another. In addition to ensuring close adherence to the meticulous practices outlined by Kwok and Higuchi, (1989), we observed the following additional precautions: at least one co-processed negative control was included for every four test samples; these took the form of clean, empty tubes that were processed in an identical manner alongside the test samples; the test samples were coded and their exact nature unknown to the experimenter until the end of the assay; the positive control was set up last of all and only after all other tubes had been sealed. Analysis of PCR products
Twenty microliters from the post-PCR reactions were analysed on a 1.5% agarose gel. After electrophoresis for 1 h at 200 V, 200 mA, the gel was stained with ethidium bromide and photographed under ultra-violet illumination. The DNA was transferred to a Hybond-N membrane (Amersham) by Southern blotting using standard techniques (Southern, 1975). Hybridisation was carried out with 2-4 x 10” cpm of radiolabelled probe at 42°C in 20% formamide, for 14 h, using standard techniques (Maniatis et al., 1982). Membranes were washed at 42°C in 0.1 x SSC and 0.1% SDS for 60 min. Autoradiography was carried out at -70°C for 15 h with an intensifying screen. Preparation of probes
The env and gag specific probes were prepared exactly as described previously (Saluz and Jost, 1989). In brief, equimolar concentrations of the primers (see Table 1) in 10 mM Tris (pH 7.5), 50 mM NaCl, 10 mM MgClz and 1 mM DTT were placed at 72°C for 2 minutes and then allowed to cool slowly to 4°C. dCTP, dGTP and dlTP were added to 300 pm final; 50 l&i of 32P dATP (3000 Wmmol), and 1 unit of Sequenase 2.0 (United States Biochemical Corporation) were added and the reaction allowed to proceed for 20 min at room temperature. The labelled product was separated from unlabelled primer and complementary template by elution from a sequencing gel. The specific activity was about 0.5-l x lo9 cpm/p,g. Radiolabelled $X174 DNA digested with ZfaeIII was prepared by the random priming method (Feinberg and Vogelstein, 1983). Oligonucleotide
primers
All sequences were based on the published sequence for SIVmacl42 or SIVmac251 (Chakrabarti et al., 1987; Franchini et al., 1987; Kestler et al., 1988). Actual sequences were taken from the Los Alamos 1989 AIDS database entries SIVMM 142 and SIVMM 251. Primers were made on an Applied Biosystems synthesizer at the NIBSC. The primers were precipitated from ammonia with ethanol, and used directly without further purification.
Sequencing of PCR products DNA from the PCR was centrifuged through a Sephadex G-50 spin column (Maniatis et al., 1982) precipitated with ethanol and redissolved in 50 ~1 of T&i. The sequencing primers (see Table 1) were 5’ end-labelled with 32P using polynucleotide kinase aud y q-ATP ztamdhgtostandard techniques (Maniatis et al., 1982). Sequence analysis was performed using a Sequenase Kit (U.S.B. Corp.) according to the manufacturer’s protocols, except that the initial labelling step was omitted as the radio-label was already present in the primer. Sequence infonnation was processed on an IBM personal computer using the DNASIS software package from LKB-Pharmacia Ltd. SN ELlSA C8166 cells infected with the 32H isolate of SIVmac251 were resuspended in 0.5% Nonidet P4O in distilled water at 10’ celWml. After centrifugation at 10000 x g for 1 min the supematant constituted viral antigen. Control antigen was derived in the same way from uninfected C8166 cells. The wells of micro-ELISA plates (Falcon Plastics) were coated with antigen diluted 1:lOO in distilled water and allowed to dry overnight at 37°C. Plates were blocked for 30 min in phosphate buffered saline containing 5% pig serum and 0.05% Tween 20. After washings, serial dilutions of monkey sera were added and plates incubated for 1 h. Bound antibody was detected using goat anti-human antibody coupled to horseradish peroxidase and tetramethyl benzidine as substrate. After stopping the reaction with 2 M sulphuric acid, optical density was measured at 450 nm using a Titertek plate reader. The readings with control antigen were subtracted from those with viral antigen to obtain specific anti-SIV values. These were plotted against serum dilutions and the end point calculated by regression analysis. Titres were taken as the reciprocal of the serum dilution giving an ODdW of 0.15.
RC!Sllhi
PCR detection of the SW gag gene in tissue-culture ceUs Genomic DNA was extracted from human C8166 cells infected with SIVmac251 (32H isolate) and analysed using SIV gag specific primers in a standard PCR(see Table 1 and Fig. 1). At the highest concentrations of DNA used (85 ng, lane l), a major band of the expected size, 4% bp, was observed (arrow) along with a considerable smear of additional amplified DNA. The distilled water negative control (lane 2) showed only the original primers and no other amplified bands. An additional negative control, using 1.7 ng of DNA extracted from uninfected C8166 cells displayed no observable PCR product even after Southern transfer and hybridisation to the gag specific probe (data not shown). As the amount of template DNA in the reaction was decreased, the specific product at 4% bp became the only
91
observable band under ultra-violet fluorescence. All further experiments were performed using 1.7 ng of template DNA (lane 4). This represents DNA extracted from 2 pl of the original culture, or about 10s cells. The effect of the final MgCl, concentration upon the efficiency and specificity of the SIV gag primed PCR is shown in Fig. 2A. At 0.5 mM MgC& or lower, the PCR did not work (lanes 1 and 2). At alI concentrations between 1.0-15 mM MgCl,, the specific product at 4% bp was observed (lanes 3-14). However, two optima existed at 1.0 mM and 5.0 mM MgQ, where the smear of additional amplified bands became insignificant (lanes 3 and 8). At concentrations in excess of 6.0 mM MgC12 (lanes lO-14), a second DNA band was observed of about 560 bp. The effect of the concentration of the primer on the PCR was examined (Fig. 2B). The PCR was supported by all tinal concentrations of the gag primers in excess of 0.05 p,M (lanes l-4). Above this value there was little increase in the amount of PCR product observed, and 0.1 fl (lane 3) was chosen for future studies. The effect of the deoxynucleotide and Tuq concentrations upon the gag PCR was examined (Fig, 3). The PCR was supported at all deoxynucleotide concentrations between 25 HAMand 200 FM (Fig. 3A, lanes l-5), and all Taq concentrations between 5 units and 1.25 units (Pig. 3B, lanes l-3). A concentration of 200 p,M for the deoxynucleotides and 1.25 units for the Tuq polymerase were chosen for further assays. Conjknation
of the SIV gag PCR product identity
The identity of the gag PCR product was demonstrated in two ways: first, the PCR product shown in Fig. 3B was transferred to a nitrocellulose membrane and hybrid&d with a radiolabelled oligonucleotide specific for the SIV gag gene (see Table 1). A single band of about 4% bp was observed (Fig. X). Second, the noncloned gag PCR product was examined by direct primer extension sequence analysis. The sequence of a contiguous region of 336 bases (of the 496 bp product) was identical to the corresponding region of the published sequence for SIVmac251 taken from the Los Alamos 1989 AIDS database entry SIVMM 251. Three separate PCR amplifications were performed, on different genomic DNA preparations, and each gave the identical sequence. In total, about 1000 bases were sequenced. PCR detection of the SIV env gene in tissue-culture celLF
The effect of the final MgClz concentration upon the specificity of the SIV env primed PCR is shown in Fig. 4A. Again, at 0.5 mM MgCl, or lower, the PCR did not work (lanes 1 and 2). A specific single product at the expected size of 875 bp was observed at 1.0 mM MgC12 (lane 3, arrow). At all other concentrations of MgCl* (1.5-15 mM) a large amount of additional, heterogeneous sized, amplified DNA was observed (lanes 4-14). This amplified DNA became shorter in length as the MgCl, concentration increased and the amount of env specific PCR product became greatly reduced above 2 mM MgCl, (lane 5). Southern transfer and hy-
92 A Ml2345678
3
456
Ml
23
4
56
P
Fig. 3. (A) Deoxynucleotide titration. (B) Tuq polymerase titration. C. Hybridisation to agag specific oligonucleotide. The SIV gag primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final deoxynucleotide concentration in each reaction was varied. Lane 1, 400 PM; lane 2, 200 FM; lane 3, 100 PM; lane 4,50 uM; lane $25 PM; lane 6, 10 uM; lane 7, 5 p.M; lane 8, 1 uM. (B) The amount of Z’aqpolymerase in each reaction was varied. Lane 1, 5 units; lane 2, 2.5 units; lane 3, 1.25 units; lane 4,0.625 units; lane 5, 0.31 units; lane 6, 0.15 units. (C) The DNA shown in Fig. 3B was transferred to a Hybond-N membrane and simultaneously hybrid&d with a gag specific, radiolabekd oligonucleotide (see Table 1) and radiolabelled $X174/HaeIII DNA. M, +X174 DNA digested with HueIII. The arrow indicates the specific gag PCR product at 496 bp (G). P indicates the position of the primers.
93 TABLE 1 Primers and
probes used for SIV PCR and sequence analysis size of
SfV gene region
Primer sequence
SGllZlNP’ SG1617CP’
gag gag
‘I-TAGACTACGACCCGGCGGAAAGA ATAGGGGAGGCAGCCI-KTGACAG
SG1146NSL3 SGl%?CS’*’
gag gag
AAAGTACATGTTGAAGCATGT GCCI’GAAATCCTGACACTAC
-
SG1457Ns5 SG1484CzJ
gag gag
AATAGGTGGTMCTATGTCCACCTGCCAlTAAG TGGCAGGTGG
-
SE6561NP’ SE7436CP’
env env
AAGMGGCTMGGCTMTACA ACCMGTAGMGTCTGTGTCT
SE7282w*6 SE7309CPs~6
env env
GTGCACCTCCAGGATGTA CTMGCAAAG
Primer code
zc* 4%bp
r375bp
-
‘Number in primer code refers to the nuckotide number of the most 5’ base of the primer in the sequence of SIVmac142. *umber in primer code refers to the nucleotide number of the most 5’ base of the primer in the sequence of SIVmac251. %-imer used for sense-strand direct sequencing of PCR gag product. ‘Primer used for complementary strand direct sequencing of PCR gag product. %imers used to prepare gag specihc oligonucleotide probe. %imers used to prepare env specific ofigonucleotide probe.
bridisation of the products of the env PCR to a radiolabelled env specific oligonucleotide, demonstrated the presence of a single band of about 875 bp (Fig. 4B). Simultaneous detection of the NV env and gag genes in tissue culture celLF
The effect of the MgCl, concentrations upon the specificity of the PCR products, when both sets of primers were simultaneously present in the reaction, is shown in Fig. SA. A finer range of MgClr concentrations were used and the most specific reaction was found to occur between 0.75-1.0 mM MgCl* (lanes 2 and 3). As before, the PCR did not work at 0.5 mM or lower MgCl, concentrations. The SIV env primer concentration was titrated in the presence of a constant amount of SIV gag primer (0.1 PM) at 1.0 mM MgCl, (Fig. 5B). The amount of the SIV gag PCR product was roughly constant at all concentrations of SIV env primer (lanes l-5). However, the SIV env PCR was only supported at env primer concentrations of 0.1 p.M or greater (lanes l-3). At these concentrations, the amount of SIV env PCR product was also roughly constant, irrespective of env primer concentration. The optimal concentration for both sets of primers was chosen to be 0.1 u.M (lane 3).
94
Fig. 4. (A) MgCI, titration using the SW env primers. (B) Specificity of the env PCR. The SIV env primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final MgCl, concentration in each reaction was varied. Lane 1, zero; lane 2,0.5 mM; lane 3, 1.0 mM; lane 4, 1.5 mM; lane 5, 2.0 mM; lane 6, 3.0 mM; lane 7, 4.0 mM; lane 8, 5.0 mM; lane 9,6.0 mM; lane 10,7.0 mM; lane 11,8.0 mM; lane 12,g.O mM; lane 13,lO mM; lane 14,15 mM. (B) Product from a standard env PCR was separated on an agarose gel, transferred to a Hybond-N membrane and simultaneously hybridised with a radiolabelled env specific oligonucleotide (Table 2) and radiolabelled +X174/HueIII DNA. Lane 1, 1.7 ng uninfected C8166 DNA; lane 2, 1.7 ng template DNA. M, +X174 DNA digested with HaeIII. The arrow indicates the specific env product at 875 bp. P indicates the position of the primers.
PCR detection of the SIV gag gene in macaque lymphocytes The initial results of an experiment to determine the MID, for the SIVmac251 (32H isolate) are shown in Table 2. All the animals receiving the 10m3 and 10m4 dilutions of virus became infected as judged by seroconversion and virus re-isolation. However, only one (1120) of the two animals receiving the 10m5 dilution became infected as judged by these criteria. PBLs were isolated from these ani&als and used as a source of DNA template for the SIV gag specific PCR assay (Fig. 6). None of the animals showed the presence of a SIV gag specific PCR product from PBLs taken before experimental infection (Fig. 6A). However, a PCR product of about 496 bp was detected for all animals (except 1121), after hybridisation with a gag specific radiolabelled probe, in DNA isolated from PBLs taken at 14 and 28 days p.i. (Fig. 6B and Table 2). Monkey number 1115 gave only a very weak PCR signal (not visible in Fig. 6B, lane 4) and this was due to a poor recovery of DNA template for this sample. All other samples contained roughly the same amount of template DNA. The co-processed negative controls (Fig. 6,
95
4
B
-
Ml234567
12345M
Ed
E.
G--*
G
F
Fig. 5. (A) MgCls titration in the presence of both SIV env and gag primers. (B) SIV env primer titration in the presence of a constant amount of SIV gag primers. The SIV env and gag primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final MgClr concentration in each reaction was varied. Lane 1, 0.50 n&f; lane 2, 0.75 mM; lane 3, 1.00 mM; lane 4, 1.25 mM; lane 5,1.50 mM; lane 6, 1.75 mM; lane 7, 2.00 mM. AU reactions contained SIV env primers at 1.0 pM final and SIV gag primers at 0.1 ~.LMtinal. (B) The final concentration of the SIV env primers was varied. Lane 1, 1.0 PM; lane 2,0.3 FM; lane 3,0.1 PM; lane 4, 0.03 PM; lane 5, 0.01 PM. All reactions contained MgCl, at 1.0 mM and SIV gag primers at a final concentration of 0.1 PM. M, +X174 DNA digested with HaeIII. The arrows indicate the specific env PCR product at 875 bp (E) and the specific gag PCR product at 496 bp (G). P indicates the position of the primers. TABLE 2 Comparison of PCR, virus re-isolation and ELISA techniques Animal No.
Virus dilution inoculated
1114 1115
10-r 10-r
1116 Ill7 1118 1119
1o-4 10-d 1o-4 1o-4
1120 1121
lo-’ 10-s
Prebleed c
14 Days p.i.
28 Days p.i.
P
E’
C
Cl.5 Cl.5
+ +
+ +
<1.5 Cl.5
+ +
+ +
3.4 2.7
Cl.5 <1.5 Cl.5 Cl.5
+ + + +
+ + + +
Cl.5 Cl.5 Cl.5 Cl.5
+ + + +
+ + + +
3.3 Cl.5 2.8 3.0
Cl.5 <1.5
+ -
+ -
<1.5 <1.5
+ -
+ -
2.5 Cl.5
-
-
-
-
-
-
-
-
-
-
-
-
P
E”
C
P
E”
Eight cynomolgus macaques were injected i.v. with the different dilutions of SIVmac251 (32 H isolate) indicated. At each bleed (day 0; day 14 p.i.; and day 28 p.i.) the animals were assessed for evidence of infection by virus culture (C), by the presence of antibodies to SIV by ELISA (E) and by an SIV gag specific PCR assay (P). “Loglo values.
96
M
M
1
1
2
3
234
4
5
6
5
7
6
6
7
9
6
10 11
9
10 11
Fig. 6. PCR amplification of SIV gag from DNA isolated directly from the lymphocytes of cynomolgus macaques numbers 1114 to 1121. The SIV gag primers (see Table 1) were used in the modified PCR, as described in Materials and Methods. Products of the PCR were separated by electrophoresis through agarose gels, transferred to a Hybond-N membrane and simultaneously hybridised with a gag specific radiolabelled oligonucleotide (Table 1) and radiolabelled ~X174IHueIII DNA. (A) PBLs isolated before experimental infection with SIV. (B) PBLs isolated 14 days post-infection. A and B. Lane 1, control template DNA isolated from C8166 cells infected with SIVmac251 (32H isolate). Lanes 2 and 8, co-processed negative controls (see Materials and Methods); lanes 3 to 7, monkey numbers 1114 to 1118; lanes 9 to 11; monkeys numbers 1119 to 1121. M, +X174 DNA digested with HueIII. The arrow indicates the specific gag PCR product at 4% bp.
lanes 2 and 8) did not show this band, confirming that these results did not arise from ‘carry-over’ contamination of DNA from one positive sample to another.
Discussion
The conditions required for the simultaneous amplification by PCR of two regions from tissueculture derived proviral SIV (env and gag) were determined. The initial goal of these experiments was to produce an assay that was simple, rapid, specific and that did not rely on Southern blotting and radioactive probes for the final detection step. The assay uses two pairs of primers (for increased specificity) and produces enough product for detection directly by fluorescence on an ethidium bromide stained agarose gel. This assay is useful for rapid detection of proviral SIV sequences during co-cultivation virus re-isolation procedures. Specific PCR products, can be obtained with 2 ng of chromosomal template DNA (about 103 cells) in the reaction (Fig. 1). The practical detection limits of the PCR as described here, when coupled to detection by hybridisation is about 10 cells, or 17 pg, of chromosomal DNA (data not shown). The requirement of the PCR for MgClz is complex and, interestingly, different for each primer pair (compare Figs. 2 and 4). Both primer pairs gave single, specific PCR bands at 1.0 mM MgCl, (Figs. 2 and 4, lane 3). However, the second optimum for the SIV gag PCR at 5 mM MgCl, (Fig. 2, lane 8) was not investigated further, since a similar optimum for the SIV env PCR did not exist (Fig. 4). It proved possible to decrease the primer concentrations significantIy, without compromising the PCR (Figs. 2B and 5B). This represents a considerable saving in oligonucleotides for a routine assay. The final modified PCR assay conditions give two well resolved DNA products (875 bp and 496 bp) and no other DNA (Fig. 5B). The identity of these two PCR products was easily established using gene specific radiolabelled oligonucleotides (Figs. 3C and 4B) and the absolute confirmation of the identity of the SIV gag PCR product was obtained by sequence analysis. The results obtained from the blind, negative-controlled PCR analysis of experimentally infected cynomolgus macaques were in complete agreement with all the other data relating to infection. The modified PCR assay, when coupled with hybridisation, was equally as sensitive as the virus culture technique in demonstrating the presence of SW in these animals (Table 2). The PCR assay was able to confirm that only one (1120) of the two animals receiving the lo-’ dilution of virus was indeed infected. The PCR assays described here will provide additional criteria for the assessment of the infection status of experimental animals. The assay does not demonstrate the presence of viraemia and it is thus not a replacement for the virus reisolation technique. However, it does provide a rapid and reliable assay for the detection of provirus in macaque lymphocyte DNA. This generates valuable information on the proviral status of experimentally infected animals during AIDS vaccine and chemotherapy trials. Finally, this technique will also facilitate a sequence analysis of SIV directly from
98
macaque lymphocytes. Such information on the sequences of SIV that exist in vivo will be of great value for the analysis and design of vaccines for the prevention of immunodeficiency disease.
Acknowledgements The authors wish to thank Dr R. Desrosiers for the generous gift of SIVmac251, Dr Frank Taffs for veterinary supervision and Miss Sandra Prime and Mr Andrew Davies for preparation of the manuscript. This work is supported in part by the UK MRC AIDS Directed Programme. References Chakrabarti, L., Guyader, M., Alizon, M., Daniel, M.D., Desrosiers, R.C., Tiollais, P. and Sonigo, P. (1987) Sequence of simian immunodeficiency virus from macaque and its relationship to other human and simian retroviruses. Nature (London) 328, 543-547. Desrosiers, R.C., Wyand, MS., Kodama, T., Ringler, D.J., Arthur, L.O., Sehgal, P.K., Letvin, N.L., King, N.W. and Daniel, M.D. (1989) Vaccine protection against simian immunodeficiency vies infection. Proc. Natl. Acad. Sci. USA 86, 6353-6357. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radio-labelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Franchini, G., Gurgo, C., Guo, H-G., GaIlo, R.C., Collati, E., Fargnoli, K.A., Hall, L.F., WongStaal, F. and Reitz, M.S. Jr. (1987) Sequence of simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature (London) 328,539-543. Fultz, P., McClure, H., Anderson, D., Swenson, R., Anand, R. and Srinivasan, A. (1986) Isolation of a T-lymphocyte retrovirus from naturally infected sooty mangabey monkeys (Cercocebus atys). Proc. Natl. Acad. Sci. USA 83, 52865290. Kannagi, M., Kiyotaki, M., Desrosiers, R.C., Reimann, K.A., King, N.W., Waldron, L.M. and Letvin, N.L. (1986) Humoral immune responses to T-cell tropic retrovirus simian T-lymphotropic virus type III in monkeys with experimentally induced acquired immune deficiency-like syndrome. J. Clin. Invest. 78, 1229-1236. Kestler, H. W., Li, Y., Naidu, Y .M., Butler, C.V., Ochs, M.F., Jaenel, G., King, N. W., Daniel, M.D., Desrosiers, R.C. (1988) Comparison of simian immunodeficiency virus isolates. Nature (London) 331, 619-622. Kitchin, P.A., Cranage, M.P., Baskerville, A., Greenaway, P., Taffs, F., Mills, K., Page, M., Almond, N., Grief, C., Corcoran, T., Fromholc, C., Jenkins, A., Ling, C., Mahon, B., McAlpine, L., Silvera, P., Szotyori, Z. and Stott, E. (1989) Titration of SIVmac251 (32H isolate) in Cynomolgus Macaques for Use as a Challenge in Vaccination Studies. Proceedings of the International TN0 Meeting of Animal Models in AIDS, Maastricht, The Netherlands. Elsevier/North-Holland Biomedical Press, Amsterdam. Kwok, S., Mack, D.H., Mullis, K.B., Poiesz, B., Ehrlich, G., Blair, D., Friedman-Kein, A. and Sninsky, J.J. (1987) Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature (London) 339, 237-238. Maniatis, T., Fritsch, E. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Murphy-Corb, M., Martin, L.N., Rangan, S.R.S., Baskin, G.B., Gormus, B.J., Wolf, R.H., Andes, W.A., West, M. and Moantelaro, R.C. (1986) Isolation of an HTLV-111,related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys. Nature (London) 321, 248-250.
99
Ou, C-Y., Kwok, S., Mitchell, SW., Mack, D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., War-field, D. and Schochetman, G. (1988) DNA amplification for direct detection of HIV-I in DNA of peripheral blood mononuclear cells. Science 239, 295-297. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-494. Salahuddin, S.Z., Markham, P.D., Wong-Staal, F., Franchini, G., Kalyanaramas, U.S. and Gallo, R.C. (1983) Restricted expression of human T-cell leukaemia-lymphoma virus (HTLV) in transformed human umbilical cord blood lymphocytes. Virology 129, 51-64. Sahrz, H. and Jost, J-P. (1989) A simple high resolution procedure to study DNA methylation and in vivo DNA-protein interactions on a single-copy gene level in higher eukaryotes. Proc. Natl. Acad. Sci. USA 86,2602-21X&. Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517.
85
VIRMET 1001
The use of the polymerase chain reaction for the detection of Simian immunodeficiency virus in experimentally infected macaques P.A. Kitchinl, N. Almond’, Z. Szotyoril, C.E. Fromholcl, L. McAlpinel9*, P. Silvera’, E.J. Stott’, M. Cranage2, A. Baskerville2 and G. Schikl’ ‘WHO AIDS CollaboratingCentre, NationalInstitutefor Biological Standards and Control, South Mimms, Potters Bar, U.K. and ‘Centre for Applied Microbiology and Research, Division of Pathology, Porton Down, Salisbury, U.K. (Accepted 8 December 1989)
Summary A rapid, non-radioactive assay for the detection of proviral Simian immunodeficiency virus (SIV) in tissue-culture cells is described. The assay is based on the co-amplification of the SIV env and gag genes by the polymerase chain reaction (PCR). When the gag PCR product is blotted onto a nylon membrane and hybridised to a radioactive oligonucleotide probe, the assay can also be used to detect the SIV gag gene in DNA isolated directly from experimentally infected cynomolgus macaque lymphocytes. This provides a valuable assay for the presence of proviral SIV during animal trials of AIDS vaccines and chemotherapeutics. Simian immunodeficiency virus; Polymerase AIDS; Simian AIDS; Macaca fascicularis
chain reaction;
Animal model for
Correspondence to: P.A. Kitchin, WHO AIDS Collaborating Centre, National Institute for Biological Standards and Control, South Mimms, Potters Bar, Herts EN6 3QG, U.K. ‘Present address: Virus Research Laboratory, Public Health Laboratory Service, Colindale, London, U.K. 0166-0934/90/$03.50 0 1990 Elsevier Science Publishers B.V. (Biomedical Division)
86
Introduction
Several experimental primate models of human AIDS have been described, based on the infection of macaques with various strains of simian immunodeficiency virus (SIV) (Fultz et al., 1986; Kannagi et al., 1986; Murphy-Corb et al., 1986). These models can be used for studying the interactions of immunodeficiency viruses with their hosts, as well as for challenge studies and potential vaccine trials (Desrosiers et al., 1989). The study of these animals typically involves an assessment of their viraemic, serological, haematological and pathological status. Although such analyses reveal much about the overall status of each animal, there is, at present, no assay which can easily assess the proviral burden of these animals. Such information would be of great value for pathological studies, as well as vaccination and therapeutic trials. In this context, the recently described nucleic acid amplification procedure, known as the polymerase chain reaction (PCR) has been used to assess the proviral status of human AIDS patients, infected with the human immunodeficiency virus (Ou et al., 1988). The polymerase chain reaction utilises two primers of known sequence, homologous to regions flanking the DNA segment to be amplified. The target DNA is denatured by heating, and the primers are allowed to anneal to their complementary regions. The primers are subsequently extended at high temperature by the enzymatic action of the DNA polymerase isolated from Thermus aquaticus (Tuq). Since these newly synthesised DNA strands will serve as templates themselves, repeated cycles of denaturation, primer annealing and extension, result in an exponential increase in copies of the DNA flanked by the primers (Kwok et al., 1987; Saiki et al., 1988). By using primers complementary to specific DNA regions of HIV, it is possible to amplify the viral genes to levels where they can be easily detected. We report here the conditions for a rapid and specific PCR assay facilitating the identification of SIV sequences in tissue culture material. A modified version of this assay is also capable of detecting proviral SIV sequences in DNA isolated directly from infected monkey lymphocytes.
Materials
and Methods
Animal infections and derivation of SIVmac251
(32H isolate)
As part of a much wider study (Kitchin et al., 1989), a rhesus macaque (number 32H) was injected intravenously with SIVmac251 (low passage), kindly supplied by Dr R. Desrosiers of the New England Regional Primate Research Center. Peripheral blood lymphocytes (PBL) were isolated from Rhesus 32H, 57 days post inoculation (p.i.) by centrifugation of blood diluted 1:l with RPM1 1640 on Ficollhypaque cushions. After culture of the PBLs for 3 days in the presence of phytohaemagglutinin (PHA), PHA stimulated human cord blood lymphocytes (CBL) and 400 IU of recombinant human Interleukin 2 were added. Cultures were fed
with freshly stimulated CBL on a further three occasions over a 17-day period and were monitored for cytopathic effect and the production of cell-free reverse transcriptase activity. Virus was subsequently adapted to C8166 cells (Salahuddin et al., 1983) by addition of C8166 cells to the adherent cell population remaining in the primary cell culture flask after draining. These cultures were fed every 3 to 4 days with freshly fed C8166 cells in a ratio of 1:3 v/v. Extensive cytopathic effect was seen within 5 days of culture. Three secondary cultures were used as a source of DNA for the subsequent PCR experiments. The virus is denoted as SIVmac251 (32H isolate). Virus re-isolation from infected animals
PBLs were isolated on Percoll gradients and co-cultivated with C8166 cells in the presence of PI-IA. The cultures were subsequently fed twice weekly with RPMI 1640 containing 10% foetal calf serum and 10 II-J/ml of IL2. The appearance of syncytia indicated the presence of SIV which was also confirmed by detection of p24 antigen (DuPont ELISA). DNA extractions
SIV infected 03166 cells from 1 ml of culture (about 5 x 10s cells) were resuspended in 100 ~1 of TidElo buffer (10 mM Tris-HCl, pH 7.4; 10 mM EDTA). SDS and proteinase K were added to final concentrations of 0.5% w/v and 100 @ml, respectively. After 1 h at 37°C the DNA was extracted with a phenol-chloroform mix, precipitated with ethanol and resuspended in 50 ~1 of T,,JE, buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA). DNA extractions made directly from isolated monkey PBLs were from the equivalent of 500 ~1 original blood volume (about 5 x 105 lymphocytes). Standard polymerclse chain reaction conditions
Each reaction was performed in a 1.5 ml Eppendorf tube in a total volume of 50 p,l containing the following: 10 mM Tris-HCl, pH 8.3 (at 25°C); 50 mM KCl; 1.5 mM MgCl,; 0.01% w/v gelatin; 200 PM each of dATP, dCIP, dGTP, dlTP; 1 p,M of each primer (see Table 1); 1.7 ng DNA template; 1.25 units of Taq polymerase (Cetus). Reactions were overlayed with 100 l.i.1of mineral oil and amplified for 25 cycles using an automated temperature cycler (Hybaid Intelligent Heating Block). The program was operated in mode 4 as follows: 94°C for 1 min 3 s (X 1); 36°C for 2 min, 72°C for 2 min 50 s, 94°C for 35 s (X 25); 37°C for 2 min, 72°C for 10 min (X 1). Modified PCR conditions
The reaction was as described above, but with the following modifications: mM MgClz and both pairs of primers at 0.1 p_Mfinal concentration.
1.0
88 Precautions taken when the PCR is applied to macaque PBLs
Misleading results can occur during PCR amplification from the ‘carry-over’ of DNA as contamination from one positive sample to another. In addition to ensuring close adherence to the meticulous practices outlined by Kwok and Higuchi, (1989), we observed the following additional precautions: at least one co-processed negative control was included for every four test samples; these took the form of clean, empty tubes that were processed in an identical manner alongside the test samples; the test samples were coded and their exact nature unknown to the experimenter until the end of the assay; the positive control was set up last of all and only after all other tubes had been sealed. Analysis of PCR products
Twenty microliters from the post-PCR reactions were analysed on a 1.5% agarose gel. After electrophoresis for 1 h at 200 V, 200 mA, the gel was stained with ethidium bromide and photographed under ultra-violet illumination. The DNA was transferred to a Hybond-N membrane (Amersham) by Southern blotting using standard techniques (Southern, 1975). Hybridisation was carried out with 2-4 x 10” cpm of radiolabelled probe at 42°C in 20% formamide, for 14 h, using standard techniques (Maniatis et al., 1982). Membranes were washed at 42°C in 0.1 x SSC and 0.1% SDS for 60 min. Autoradiography was carried out at -70°C for 15 h with an intensifying screen. Preparation of probes
The env and gag specific probes were prepared exactly as described previously (Saluz and Jost, 1989). In brief, equimolar concentrations of the primers (see Table 1) in 10 mM Tris (pH 7.5), 50 mM NaCl, 10 mM MgClz and 1 mM DTT were placed at 72°C for 2 minutes and then allowed to cool slowly to 4°C. dCTP, dGTP and dlTP were added to 300 pm final; 50 l&i of 32P dATP (3000 Wmmol), and 1 unit of Sequenase 2.0 (United States Biochemical Corporation) were added and the reaction allowed to proceed for 20 min at room temperature. The labelled product was separated from unlabelled primer and complementary template by elution from a sequencing gel. The specific activity was about 0.5-l x lo9 cpm/p,g. Radiolabelled $X174 DNA digested with ZfaeIII was prepared by the random priming method (Feinberg and Vogelstein, 1983). Oligonucleotide
primers
All sequences were based on the published sequence for SIVmacl42 or SIVmac251 (Chakrabarti et al., 1987; Franchini et al., 1987; Kestler et al., 1988). Actual sequences were taken from the Los Alamos 1989 AIDS database entries SIVMM 142 and SIVMM 251. Primers were made on an Applied Biosystems synthesizer at the NIBSC. The primers were precipitated from ammonia with ethanol, and used directly without further purification.
Sequencing of PCR products DNA from the PCR was centrifuged through a Sephadex G-50 spin column (Maniatis et al., 1982) precipitated with ethanol and redissolved in 50 ~1 of T&i. The sequencing primers (see Table 1) were 5’ end-labelled with 32P using polynucleotide kinase aud y q-ATP ztamdhgtostandard techniques (Maniatis et al., 1982). Sequence analysis was performed using a Sequenase Kit (U.S.B. Corp.) according to the manufacturer’s protocols, except that the initial labelling step was omitted as the radio-label was already present in the primer. Sequence infonnation was processed on an IBM personal computer using the DNASIS software package from LKB-Pharmacia Ltd. SN ELlSA C8166 cells infected with the 32H isolate of SIVmac251 were resuspended in 0.5% Nonidet P4O in distilled water at 10’ celWml. After centrifugation at 10000 x g for 1 min the supematant constituted viral antigen. Control antigen was derived in the same way from uninfected C8166 cells. The wells of micro-ELISA plates (Falcon Plastics) were coated with antigen diluted 1:lOO in distilled water and allowed to dry overnight at 37°C. Plates were blocked for 30 min in phosphate buffered saline containing 5% pig serum and 0.05% Tween 20. After washings, serial dilutions of monkey sera were added and plates incubated for 1 h. Bound antibody was detected using goat anti-human antibody coupled to horseradish peroxidase and tetramethyl benzidine as substrate. After stopping the reaction with 2 M sulphuric acid, optical density was measured at 450 nm using a Titertek plate reader. The readings with control antigen were subtracted from those with viral antigen to obtain specific anti-SIV values. These were plotted against serum dilutions and the end point calculated by regression analysis. Titres were taken as the reciprocal of the serum dilution giving an ODdW of 0.15.
RC!Sllhi
PCR detection of the SW gag gene in tissue-culture ceUs Genomic DNA was extracted from human C8166 cells infected with SIVmac251 (32H isolate) and analysed using SIV gag specific primers in a standard PCR(see Table 1 and Fig. 1). At the highest concentrations of DNA used (85 ng, lane l), a major band of the expected size, 4% bp, was observed (arrow) along with a considerable smear of additional amplified DNA. The distilled water negative control (lane 2) showed only the original primers and no other amplified bands. An additional negative control, using 1.7 ng of DNA extracted from uninfected C8166 cells displayed no observable PCR product even after Southern transfer and hybridisation to the gag specific probe (data not shown). As the amount of template DNA in the reaction was decreased, the specific product at 4% bp became the only
91
observable band under ultra-violet fluorescence. All further experiments were performed using 1.7 ng of template DNA (lane 4). This represents DNA extracted from 2 pl of the original culture, or about 10s cells. The effect of the final MgCl, concentration upon the efficiency and specificity of the SIV gag primed PCR is shown in Fig. 2A. At 0.5 mM MgC& or lower, the PCR did not work (lanes 1 and 2). At alI concentrations between 1.0-15 mM MgCl,, the specific product at 4% bp was observed (lanes 3-14). However, two optima existed at 1.0 mM and 5.0 mM MgQ, where the smear of additional amplified bands became insignificant (lanes 3 and 8). At concentrations in excess of 6.0 mM MgC12 (lanes lO-14), a second DNA band was observed of about 560 bp. The effect of the concentration of the primer on the PCR was examined (Fig. 2B). The PCR was supported by all tinal concentrations of the gag primers in excess of 0.05 p,M (lanes l-4). Above this value there was little increase in the amount of PCR product observed, and 0.1 fl (lane 3) was chosen for future studies. The effect of the deoxynucleotide and Tuq concentrations upon the gag PCR was examined (Fig, 3). The PCR was supported at all deoxynucleotide concentrations between 25 HAMand 200 FM (Fig. 3A, lanes l-5), and all Taq concentrations between 5 units and 1.25 units (Pig. 3B, lanes l-3). A concentration of 200 p,M for the deoxynucleotides and 1.25 units for the Tuq polymerase were chosen for further assays. Conjknation
of the SIV gag PCR product identity
The identity of the gag PCR product was demonstrated in two ways: first, the PCR product shown in Fig. 3B was transferred to a nitrocellulose membrane and hybrid&d with a radiolabelled oligonucleotide specific for the SIV gag gene (see Table 1). A single band of about 4% bp was observed (Fig. X). Second, the noncloned gag PCR product was examined by direct primer extension sequence analysis. The sequence of a contiguous region of 336 bases (of the 496 bp product) was identical to the corresponding region of the published sequence for SIVmac251 taken from the Los Alamos 1989 AIDS database entry SIVMM 251. Three separate PCR amplifications were performed, on different genomic DNA preparations, and each gave the identical sequence. In total, about 1000 bases were sequenced. PCR detection of the SIV env gene in tissue-culture celLF
The effect of the final MgClz concentration upon the specificity of the SIV env primed PCR is shown in Fig. 4A. Again, at 0.5 mM MgCl, or lower, the PCR did not work (lanes 1 and 2). A specific single product at the expected size of 875 bp was observed at 1.0 mM MgC12 (lane 3, arrow). At all other concentrations of MgCl* (1.5-15 mM) a large amount of additional, heterogeneous sized, amplified DNA was observed (lanes 4-14). This amplified DNA became shorter in length as the MgCl, concentration increased and the amount of env specific PCR product became greatly reduced above 2 mM MgCl, (lane 5). Southern transfer and hy-
92 A Ml2345678
3
456
Ml
23
4
56
P
Fig. 3. (A) Deoxynucleotide titration. (B) Tuq polymerase titration. C. Hybridisation to agag specific oligonucleotide. The SIV gag primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final deoxynucleotide concentration in each reaction was varied. Lane 1, 400 PM; lane 2, 200 FM; lane 3, 100 PM; lane 4,50 uM; lane $25 PM; lane 6, 10 uM; lane 7, 5 p.M; lane 8, 1 uM. (B) The amount of Z’aqpolymerase in each reaction was varied. Lane 1, 5 units; lane 2, 2.5 units; lane 3, 1.25 units; lane 4,0.625 units; lane 5, 0.31 units; lane 6, 0.15 units. (C) The DNA shown in Fig. 3B was transferred to a Hybond-N membrane and simultaneously hybrid&d with a gag specific, radiolabekd oligonucleotide (see Table 1) and radiolabelled $X174/HaeIII DNA. M, +X174 DNA digested with HueIII. The arrow indicates the specific gag PCR product at 496 bp (G). P indicates the position of the primers.
93 TABLE 1 Primers and
probes used for SIV PCR and sequence analysis size of
SfV gene region
Primer sequence
SGllZlNP’ SG1617CP’
gag gag
‘I-TAGACTACGACCCGGCGGAAAGA ATAGGGGAGGCAGCCI-KTGACAG
SG1146NSL3 SGl%?CS’*’
gag gag
AAAGTACATGTTGAAGCATGT GCCI’GAAATCCTGACACTAC
-
SG1457Ns5 SG1484CzJ
gag gag
AATAGGTGGTMCTATGTCCACCTGCCAlTAAG TGGCAGGTGG
-
SE6561NP’ SE7436CP’
env env
AAGMGGCTMGGCTMTACA ACCMGTAGMGTCTGTGTCT
SE7282w*6 SE7309CPs~6
env env
GTGCACCTCCAGGATGTA CTMGCAAAG
Primer code
zc* 4%bp
r375bp
-
‘Number in primer code refers to the nuckotide number of the most 5’ base of the primer in the sequence of SIVmac142. *umber in primer code refers to the nucleotide number of the most 5’ base of the primer in the sequence of SIVmac251. %-imer used for sense-strand direct sequencing of PCR gag product. ‘Primer used for complementary strand direct sequencing of PCR gag product. %imers used to prepare gag specihc oligonucleotide probe. %imers used to prepare env specific ofigonucleotide probe.
bridisation of the products of the env PCR to a radiolabelled env specific oligonucleotide, demonstrated the presence of a single band of about 875 bp (Fig. 4B). Simultaneous detection of the NV env and gag genes in tissue culture celLF
The effect of the MgCl, concentrations upon the specificity of the PCR products, when both sets of primers were simultaneously present in the reaction, is shown in Fig. SA. A finer range of MgClr concentrations were used and the most specific reaction was found to occur between 0.75-1.0 mM MgCl* (lanes 2 and 3). As before, the PCR did not work at 0.5 mM or lower MgCl, concentrations. The SIV env primer concentration was titrated in the presence of a constant amount of SIV gag primer (0.1 PM) at 1.0 mM MgCl, (Fig. 5B). The amount of the SIV gag PCR product was roughly constant at all concentrations of SIV env primer (lanes l-5). However, the SIV env PCR was only supported at env primer concentrations of 0.1 p.M or greater (lanes l-3). At these concentrations, the amount of SIV env PCR product was also roughly constant, irrespective of env primer concentration. The optimal concentration for both sets of primers was chosen to be 0.1 u.M (lane 3).
94
Fig. 4. (A) MgCI, titration using the SW env primers. (B) Specificity of the env PCR. The SIV env primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final MgCl, concentration in each reaction was varied. Lane 1, zero; lane 2,0.5 mM; lane 3, 1.0 mM; lane 4, 1.5 mM; lane 5, 2.0 mM; lane 6, 3.0 mM; lane 7, 4.0 mM; lane 8, 5.0 mM; lane 9,6.0 mM; lane 10,7.0 mM; lane 11,8.0 mM; lane 12,g.O mM; lane 13,lO mM; lane 14,15 mM. (B) Product from a standard env PCR was separated on an agarose gel, transferred to a Hybond-N membrane and simultaneously hybridised with a radiolabelled env specific oligonucleotide (Table 2) and radiolabelled +X174/HueIII DNA. Lane 1, 1.7 ng uninfected C8166 DNA; lane 2, 1.7 ng template DNA. M, +X174 DNA digested with HaeIII. The arrow indicates the specific env product at 875 bp. P indicates the position of the primers.
PCR detection of the SIV gag gene in macaque lymphocytes The initial results of an experiment to determine the MID, for the SIVmac251 (32H isolate) are shown in Table 2. All the animals receiving the 10m3 and 10m4 dilutions of virus became infected as judged by seroconversion and virus re-isolation. However, only one (1120) of the two animals receiving the 10m5 dilution became infected as judged by these criteria. PBLs were isolated from these ani&als and used as a source of DNA template for the SIV gag specific PCR assay (Fig. 6). None of the animals showed the presence of a SIV gag specific PCR product from PBLs taken before experimental infection (Fig. 6A). However, a PCR product of about 496 bp was detected for all animals (except 1121), after hybridisation with a gag specific radiolabelled probe, in DNA isolated from PBLs taken at 14 and 28 days p.i. (Fig. 6B and Table 2). Monkey number 1115 gave only a very weak PCR signal (not visible in Fig. 6B, lane 4) and this was due to a poor recovery of DNA template for this sample. All other samples contained roughly the same amount of template DNA. The co-processed negative controls (Fig. 6,
95
4
B
-
Ml234567
12345M
Ed
E.
G--*
G
F
Fig. 5. (A) MgCls titration in the presence of both SIV env and gag primers. (B) SIV env primer titration in the presence of a constant amount of SIV gag primers. The SIV env and gag primers (see Table 1) were used in a standard PCR as described in Materials and Methods, modified as below. (A) The final MgClr concentration in each reaction was varied. Lane 1, 0.50 n&f; lane 2, 0.75 mM; lane 3, 1.00 mM; lane 4, 1.25 mM; lane 5,1.50 mM; lane 6, 1.75 mM; lane 7, 2.00 mM. AU reactions contained SIV env primers at 1.0 pM final and SIV gag primers at 0.1 ~.LMtinal. (B) The final concentration of the SIV env primers was varied. Lane 1, 1.0 PM; lane 2,0.3 FM; lane 3,0.1 PM; lane 4, 0.03 PM; lane 5, 0.01 PM. All reactions contained MgCl, at 1.0 mM and SIV gag primers at a final concentration of 0.1 PM. M, +X174 DNA digested with HaeIII. The arrows indicate the specific env PCR product at 875 bp (E) and the specific gag PCR product at 496 bp (G). P indicates the position of the primers. TABLE 2 Comparison of PCR, virus re-isolation and ELISA techniques Animal No.
Virus dilution inoculated
1114 1115
10-r 10-r
1116 Ill7 1118 1119
1o-4 10-d 1o-4 1o-4
1120 1121
lo-’ 10-s
Prebleed c
14 Days p.i.
28 Days p.i.
P
E’
C
Cl.5 Cl.5
+ +
+ +
<1.5 Cl.5
+ +
+ +
3.4 2.7
Cl.5 <1.5 Cl.5 Cl.5
+ + + +
+ + + +
Cl.5 Cl.5 Cl.5 Cl.5
+ + + +
+ + + +
3.3 Cl.5 2.8 3.0
Cl.5 <1.5
+ -
+ -
<1.5 <1.5
+ -
+ -
2.5 Cl.5
-
-
-
-
-
-
-
-
-
-
-
-
P
E”
C
P
E”
Eight cynomolgus macaques were injected i.v. with the different dilutions of SIVmac251 (32 H isolate) indicated. At each bleed (day 0; day 14 p.i.; and day 28 p.i.) the animals were assessed for evidence of infection by virus culture (C), by the presence of antibodies to SIV by ELISA (E) and by an SIV gag specific PCR assay (P). “Loglo values.
96
M
M
1
1
2
3
234
4
5
6
5
7
6
6
7
9
6
10 11
9
10 11
Fig. 6. PCR amplification of SIV gag from DNA isolated directly from the lymphocytes of cynomolgus macaques numbers 1114 to 1121. The SIV gag primers (see Table 1) were used in the modified PCR, as described in Materials and Methods. Products of the PCR were separated by electrophoresis through agarose gels, transferred to a Hybond-N membrane and simultaneously hybridised with a gag specific radiolabelled oligonucleotide (Table 1) and radiolabelled ~X174IHueIII DNA. (A) PBLs isolated before experimental infection with SIV. (B) PBLs isolated 14 days post-infection. A and B. Lane 1, control template DNA isolated from C8166 cells infected with SIVmac251 (32H isolate). Lanes 2 and 8, co-processed negative controls (see Materials and Methods); lanes 3 to 7, monkey numbers 1114 to 1118; lanes 9 to 11; monkeys numbers 1119 to 1121. M, +X174 DNA digested with HueIII. The arrow indicates the specific gag PCR product at 4% bp.
lanes 2 and 8) did not show this band, confirming that these results did not arise from ‘carry-over’ contamination of DNA from one positive sample to another.
Discussion
The conditions required for the simultaneous amplification by PCR of two regions from tissueculture derived proviral SIV (env and gag) were determined. The initial goal of these experiments was to produce an assay that was simple, rapid, specific and that did not rely on Southern blotting and radioactive probes for the final detection step. The assay uses two pairs of primers (for increased specificity) and produces enough product for detection directly by fluorescence on an ethidium bromide stained agarose gel. This assay is useful for rapid detection of proviral SIV sequences during co-cultivation virus re-isolation procedures. Specific PCR products, can be obtained with 2 ng of chromosomal template DNA (about 103 cells) in the reaction (Fig. 1). The practical detection limits of the PCR as described here, when coupled to detection by hybridisation is about 10 cells, or 17 pg, of chromosomal DNA (data not shown). The requirement of the PCR for MgClz is complex and, interestingly, different for each primer pair (compare Figs. 2 and 4). Both primer pairs gave single, specific PCR bands at 1.0 mM MgCl, (Figs. 2 and 4, lane 3). However, the second optimum for the SIV gag PCR at 5 mM MgCl, (Fig. 2, lane 8) was not investigated further, since a similar optimum for the SIV env PCR did not exist (Fig. 4). It proved possible to decrease the primer concentrations significantIy, without compromising the PCR (Figs. 2B and 5B). This represents a considerable saving in oligonucleotides for a routine assay. The final modified PCR assay conditions give two well resolved DNA products (875 bp and 496 bp) and no other DNA (Fig. 5B). The identity of these two PCR products was easily established using gene specific radiolabelled oligonucleotides (Figs. 3C and 4B) and the absolute confirmation of the identity of the SIV gag PCR product was obtained by sequence analysis. The results obtained from the blind, negative-controlled PCR analysis of experimentally infected cynomolgus macaques were in complete agreement with all the other data relating to infection. The modified PCR assay, when coupled with hybridisation, was equally as sensitive as the virus culture technique in demonstrating the presence of SW in these animals (Table 2). The PCR assay was able to confirm that only one (1120) of the two animals receiving the lo-’ dilution of virus was indeed infected. The PCR assays described here will provide additional criteria for the assessment of the infection status of experimental animals. The assay does not demonstrate the presence of viraemia and it is thus not a replacement for the virus reisolation technique. However, it does provide a rapid and reliable assay for the detection of provirus in macaque lymphocyte DNA. This generates valuable information on the proviral status of experimentally infected animals during AIDS vaccine and chemotherapy trials. Finally, this technique will also facilitate a sequence analysis of SIV directly from
98
macaque lymphocytes. Such information on the sequences of SIV that exist in vivo will be of great value for the analysis and design of vaccines for the prevention of immunodeficiency disease.
Acknowledgements The authors wish to thank Dr R. Desrosiers for the generous gift of SIVmac251, Dr Frank Taffs for veterinary supervision and Miss Sandra Prime and Mr Andrew Davies for preparation of the manuscript. This work is supported in part by the UK MRC AIDS Directed Programme. References Chakrabarti, L., Guyader, M., Alizon, M., Daniel, M.D., Desrosiers, R.C., Tiollais, P. and Sonigo, P. (1987) Sequence of simian immunodeficiency virus from macaque and its relationship to other human and simian retroviruses. Nature (London) 328, 543-547. Desrosiers, R.C., Wyand, MS., Kodama, T., Ringler, D.J., Arthur, L.O., Sehgal, P.K., Letvin, N.L., King, N.W. and Daniel, M.D. (1989) Vaccine protection against simian immunodeficiency vies infection. Proc. Natl. Acad. Sci. USA 86, 6353-6357. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radio-labelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Franchini, G., Gurgo, C., Guo, H-G., GaIlo, R.C., Collati, E., Fargnoli, K.A., Hall, L.F., WongStaal, F. and Reitz, M.S. Jr. (1987) Sequence of simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature (London) 328,539-543. Fultz, P., McClure, H., Anderson, D., Swenson, R., Anand, R. and Srinivasan, A. (1986) Isolation of a T-lymphocyte retrovirus from naturally infected sooty mangabey monkeys (Cercocebus atys). Proc. Natl. Acad. Sci. USA 83, 52865290. Kannagi, M., Kiyotaki, M., Desrosiers, R.C., Reimann, K.A., King, N.W., Waldron, L.M. and Letvin, N.L. (1986) Humoral immune responses to T-cell tropic retrovirus simian T-lymphotropic virus type III in monkeys with experimentally induced acquired immune deficiency-like syndrome. J. Clin. Invest. 78, 1229-1236. Kestler, H. W., Li, Y., Naidu, Y .M., Butler, C.V., Ochs, M.F., Jaenel, G., King, N. W., Daniel, M.D., Desrosiers, R.C. (1988) Comparison of simian immunodeficiency virus isolates. Nature (London) 331, 619-622. Kitchin, P.A., Cranage, M.P., Baskerville, A., Greenaway, P., Taffs, F., Mills, K., Page, M., Almond, N., Grief, C., Corcoran, T., Fromholc, C., Jenkins, A., Ling, C., Mahon, B., McAlpine, L., Silvera, P., Szotyori, Z. and Stott, E. (1989) Titration of SIVmac251 (32H isolate) in Cynomolgus Macaques for Use as a Challenge in Vaccination Studies. Proceedings of the International TN0 Meeting of Animal Models in AIDS, Maastricht, The Netherlands. Elsevier/North-Holland Biomedical Press, Amsterdam. Kwok, S., Mack, D.H., Mullis, K.B., Poiesz, B., Ehrlich, G., Blair, D., Friedman-Kein, A. and Sninsky, J.J. (1987) Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature (London) 339, 237-238. Maniatis, T., Fritsch, E. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Murphy-Corb, M., Martin, L.N., Rangan, S.R.S., Baskin, G.B., Gormus, B.J., Wolf, R.H., Andes, W.A., West, M. and Moantelaro, R.C. (1986) Isolation of an HTLV-111,related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys. Nature (London) 321, 248-250.
99
Ou, C-Y., Kwok, S., Mitchell, SW., Mack, D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., War-field, D. and Schochetman, G. (1988) DNA amplification for direct detection of HIV-I in DNA of peripheral blood mononuclear cells. Science 239, 295-297. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-494. Salahuddin, S.Z., Markham, P.D., Wong-Staal, F., Franchini, G., Kalyanaramas, U.S. and Gallo, R.C. (1983) Restricted expression of human T-cell leukaemia-lymphoma virus (HTLV) in transformed human umbilical cord blood lymphocytes. Virology 129, 51-64. Sahrz, H. and Jost, J-P. (1989) A simple high resolution procedure to study DNA methylation and in vivo DNA-protein interactions on a single-copy gene level in higher eukaryotes. Proc. Natl. Acad. Sci. USA 86,2602-21X&. Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517.