The genetic fate of molecularly cloned simian immunodeficiency virus in experimentally infected macaques

UROLOGY

185,

217-228

(1991)

The Genetic Fate of Molecularly Cloned Simian Immunodefickncy Virus in Experimentally Infected Macaques PHILIP R. JOHNSON,*+’ TIFFANY E. HAMM,*‘t SIMOY GOLDSTEIN,t SVETLANA KITOV,*+ AND VANESSA M. HIRSCH*4 “Retroviral

Pathogenesis Section, Division of Molecular Virology and Immunology, Department of Microbiology, Georgetown University, Rockville, Maryland 20852; and tLaboratory of Infectious Diseases, National institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, Maryland 20852 Received

June

11, 199 1; accepted

July 24,

199 1

We have examined genetic variation of the simian immunodefkienq virus (SIV) in four macaques virions derived from molecular clones of proviral DNA. Our data demonstrated that the SW genoma is and extensive genetic variation. This variation was especially large in the ffnv gene, where nu&o frequencies were as high as lo-‘/site/year. In some env clones, a high G to A tr$nsition rate was Q accounted for up to 79% of the observed nucleotide substitutions. Moreover, in env cl rate, m&tip&e in-frame stop codons were generated exclusive& at tfyptophan codons. was the lack of variation in the region analogous to the V3 loop in the HW-1 Env prot data have important implications for studies of pathogenesis and vaccine development in the SIV model s)%tefn. @ 1991 Academic

Press, Inc.

INTRODUCTION

model systems. The most relevant model for AtDS currently available is simian irnrnufl~~~~cy virus (SW) infection of macaques. Experimetiai inocuiatjon of macaques with SIV induces an ~rnrnu~~~~~~~y syndrome which is strikingly similar to AIDS in humans (Letvin eta/., 1985). Importantly, SlV and HIV, a%ough genetically distinct, are closely related arid share a complex genome organization and rep&%tian scheme (Desrosiers, 1990; Johnson et al., 199 1). An important feature of the SIV model system is the,avaitability of molecular clones of proviral DNA that, after transfection into cells in culture, give rise to infectious virions SIV derived in this manner can then be used for experimental inoculation of macaques. Thereafter, the fate of a single SIV clone (although in the strictest sense, any replication in tissue culture produces variants;), as it replicates over time in the infected host, can be determined. In this paper, we describe the in viva evolution of SIV derived from proviral molecular clones. Our findings show that a singte clone of SIV, af@r inoculation into macaques, is capable of rapid and extensive variation. Specifically, the data presented herein demonstrate that: (i) the env gene displays a large degree of veaziation that may be as high as 10-l nucleotide substitutions/ site/year; (ii) the integrase gene sustains changes less frequently (by an order of magnitude) than the env gene, thus demonstrating that significant dif&rential intragenomic evolution occurs in viva; (iii) env genes in some animals display very high G to A transition rates,

One major obstacle to the development of effective antiviral strategies and vaccines for the human acquired immunodeficiency syndrome (AIDS) may be the extreme plasticity of the human immunodeficiency virus (HIV) genome (Coffin, 1986; Temin, 1989). Like other RNA viruses, retroviruses display a high evolutionary rate when compared to cellular DNA genes (Steinhauer and Holland, 1986). Rapid evolution of retroviruses can be largely attributed to the infidelity of the viral polymerase (reverse transcriptase) that, unlike other DNA polymerases, lacks proofreading capabilities. In addition, retroviruses, presumably in association with viral DNA synthesis (Coffin, 1990), frequently undergo recombination, another powerful mechanism for rapid and dramatic genetic change. For individuals infected with HIV-l, at least two potential consequences may be associated with these properties of retroviruses: (i) HIV may be able to dodge host immune defenses with relative ease; and, (ii) virus strains resistant to antiviral drugs are almost certain to appear. In fact, the latter situation has already been demonstrated (Larder et al., 1989). Many critical questions about lentiviral genetic variation can best be addressed in experimental animal ’ To whom correspondence dressed at: Wexner institute, Children’s Drive, Columbus,

and reprint Room W309. OH 43205.

requests Children’s

should be adHospital, 780

217

0042-6822191

$3.00

Copyright 0 1991 by Academic Press. inc. All rights of reproduction I” any form reserved

218

JOHNSON ET AL.

and as a consequence, multiple in-frame stop codons are generated; and, (iv) the domain in the SIV Env protein that is analogous to the V3 loop in the HIV-1 Env protein is not a target for variation in SIV. These data suggest that genetic variation (and its consequences) of SIV in macaques is similar to variation of HIV-1 in humans, but may not be entirely analogous in some important respects. MATERIALS Molecular

AND METHODS

clones and viral stocks

The origin and derivation of the SIV molecular clones used in this study have been described previously (Hirsch er al., 1989a). Briefly, the clones represent SIV originally isolated from a captive sooty mangabey (Cercocebus atys). The SlVsm isolate (designated E038) was inoculated into a rhesus macaque (Macaca mu/ana)that subsequently died of SIV-induced AIDS. SIV recovered from this macaque (designated SlVsm F236) was grown in H9 cells in culture and molecularly cloned as integrated proviruses. Two of the proviral DNA clones derived in this fashion (pSlVsmH-3 and pSIVsmH-4) yielded infectious SlVsm after transfection into H9 cells. Cell-free stocks representing progenyvirions of the two clones were prepared 7 to 14 days after transfection into H9 cells by filtering (0.22 k) culture supernatants. Because both molecular clones were derived from the same cell line, it was not surprising that they were closely related at the nucleic acid sequence level. In the envgene (2655 nucleotides), 10 nucleotide differences were noted (all in gpl20) that resulted in six amino acid substitutions, while in integrase, three nucleotide differences (one amino acid change) were present (unpublished data). Evaluation

of SIV-infected

macaques

The four macaques described in this study were inoculated by intravenous injection of undiluted SIV (1 ml, -lo4 TCID,,) representing pSIVsmH-4 (n = 3) or pSIVsmH-3 (n = 1) (Table 1). After inoculation, complete physical examinations were performed on each animal at 4- to 8-week intervals (or as clinically indicated). At the time of each examination, peripheral venous blood was taken for complete blood counts, isolation of PBMCs, and SIV-specific antibody determinations (by standard Western blot techniques). Also, circulating lymphocyte subsets were determined on heparinized whole blood by monoclonal antibody staining and fluorescence activated cell sorting. PBMCs isolated by standard density gradient centrifugation were washed and resuspended in RPMI 1640 supplemented with 10% heat-inactivated fetal calf

TABLE 1 DESCRPTION

OF THE EXPERIMENTALLY

INFECTED MACAQUES

Criteria for infectior+ Macaquea

Source of SW for inoculation

Viremia

W-specific antibodies

PCR

pt52 Pt55 Rh661 Rh655

pSIVsmH-4 pSIVsmH-4 pSIVsmH-4 pSIVsmH-3

Yes No Yes Yes

Yes Transient Yes Yes

Yes Yes Yes Yes

a Pt, pig-tail macaque (Macaca nemesrrina); Rh, rhesus macaque (M. mulatta) * See Materials and Methods for details and definitions.

serum, penicillin-streptomycin, glutamine, phytohemaglutinin (10 pg/mI), and 10% humah interleukin-2. After 2 to 4 days in culture, stimulated cells were cocultivated with an equal number of CEMX174 cells, a human CD4+ lymphocyte cell line susceptible to SIV infection (Hoxie et a/., 1988). Cultures were monitored for typical cytopathic effects (syncytium formation) and reverse transcriptase activity in supernatant fluids (Goldstein et al., 1990). Cultures were routinely maintained for 6 weeks (or until positive for SIV). Viremia was defined as the recovery of SIV from cocultures of PBMCs. All four macaques were infected as judged by the detection of viremia, SIV-specific antibodies, or SIV proviral DNA in peripheral blood mononuclear cells (PBMC) amplified by the polymerase chain reaction (PCR). Three of the four macaques met all three criteria for infection. One macaque (Pt55) was never viremic and developed only a transient SIV-specific antibody response; however, PBMC taken at different times after inoculation all contained SIV proviral DNA. Both pig-tailed macaques (Pt52 and Pt55) are healthy at 112 weeks postinoculation, whereas both rhesus macaques died of AIDS at 56 weeks (Rh655) and 112 weeks (Rh661) postinoculation, respectively. Time points for isolation of DNA are indicated in Tables 2 and 3. PCR amplification,

cloning, and sequencing

To amplify the regions of the SIV genome we had chosen to study, a set of synthetic oligonucleotides was synthesized based on the pSIVsmH-4 nucleotide sequence (Hirsch et a/., 198913) and tested on plasmid and genomic DNA samples. The pairs of primers yielding the most SIV-specific products were then tested on genomic DNA isolated from PMBCs taken from infected and uninfected macaques. Ultimately, a set of eight primers (four pair) was chosen (see below). For

GENETIC VARIATION OF SIV IN L’WU

each region of interest (integrase or env), the sets of primers were nested in the event that one round of amplification (30 cycles) did not yield enough DNA for molecular cloning. During the course of our experiments, we found that adequate amplification of integrase (regardless of the macaque or the time after infection) required two rounds of PCR with .nested primers. For env, only samples taken early after infection (20 weeks) required nested amplification. Specific primer sequences were as follows. Italicized nucleotides represent the SlVsm-specific sequences and actual genome coordinates from psmH-4 of the 5’ nucleotide are given in parentheses; the extra 5’ sequences were included to provide restriction enzyme sites for molecular cloning. In 1F: 5’TATTCTCGAMAAAGCAGGCTATGTGACGG3’(4194); I” 1 R: 5’ATACTCGAGATCTGCTATGCCACCTCTCTAGCCTCTCcX’ (5398); in 2F: 5’TTAGAAGClTAAAGCAAAACT7l7IAGAAC4GA3’(4228); cn 2R: VAACACTGCAGCTCCAAGTGGGAACCACTATCC3 (5367) env 1F: ~‘ATGCTAAGCTTAGCACCGAAGAAGAJ~CTCCGAA~’ (6522) env 1R: 5’AGATCCTCGAGTCTGTTGCTGGGTTCCTCCAGG3’ (9303); env2F: 5’TACTTCGA4GGATCCACCATGGGATGTCTTGGGAATCAG3’(8586); env 2R: 5’GTTGCATGCGGATCCTCACAAGAGAGTGAGCTCAAGB’ (9243).

Genomic DNA was isolated from mitogen-stimulated PBMCs as previously described (Hirsch et al., 1989a). The env or integrase genes were amplified from 0.5 to 1 pg of RNase A-treated (100 pg/ml) genomic DNA during 30 heating-cooling-extension cycles (94” for 1 min, 50” for 1.5 min, 72” for 3 min). Each 0.1 ml-reaction contained 50 mM KCI, 10 rnM Tris-HCI (pH 8.3), 0.001% gelatin, 200 rnM of each deoxynucleotide triphosphate, 2 mNI MgCI,, 2.5 U of Taq polymerase, and 10 pmol of each oligonucleotide primer. All PCR reagents and equipment were obtained from Perkin-Elmer-Cetus (Norwalk, CT). Oligonucleotides were synthesized on an Applied Biosystems Model 380B DNA Synthesizer (Foster City, CA) and used without further purification. One-tenth of the PCR reaction mixture was analyzed on a 0.9% agarose gel and the remainder of the reaction was prepared for cloning by digestion with restriction endonucleases (sites incorporated into the amplification primers). Restriction endonuclease sites were chosen from a list of “noncutters” generated after inspection of all known SlVsm sequences. Some sequences may not have been cloned due to the generation of new sites in the sequence during genetic variation in the infected host. However, it is unlikely that such sequences were abundant since we did not detect any truncated integrase or env clones in any of our sequencing. Individual plasmid clones, selected at random or by colony hybridization with a radiolabeled probe representing the entire env gene, were sequenced using T7 DNA polymerase (United States Biochemical Corp., Cleveland, OH).

219

PCR error rate At the outset of our experiments, we were concerned about the potential problem of base substitutions introduced during PCR amplification. Specifically, we wished to be able to interpret a low level of viral variation occurring in v&o in the context of the inherent error rate of PCR amplification in vitro. To measure the PCR error rate in our laboratory, we cloned and sequenced DNA amplified from two different SIV DNA templates (plasmid and X phage), and then compared the resulting sequences with the known sequence of the templates. All experiments, including those described below, were performed with the same reagent mix (1 OX buffer containing Mg’+). Our data revealed a PCR misincorporation rate of l/1383 bases (6 mistakes in 8300 bases examined), a figure remarkably consistent with a recently published report(Ennis et a/., 1990). As demonstrated below, the variation we observed in amplified DNA from infected animals usually exceeded this background error rate. Sequence

analyses

Nucleotide and protein sequences were analyzed with the programs from PCGene and IG Suite (Intelligenetics, Inc., Mountain View, CA). RESULTS Experimental

design

Our strategy to examine the genetic variation of SIV was based on four considerations. First, we concentrated on two regions of the genome: the entire env gene and the integrase domain of thepol gene. These regions were chosen because previous studies of SW variation among divergent isolates had shown that integrase was highly conserved, whereas the env gene was somewhat more variabfe (Hirsch et a/., 1989b; Johnson et al,, 1990; 1991). Second, in several animals, we analyzed sequences taken at sequential times after infection to investigate tha progression of genetic variation over time. Third, to allow for iikety biologic variability in virus-host interactions, we studied four different experimentally inoculated maeaquas. Finally, we chose to derive sequences direct& from circulating PBMCs rather than from viruses isolated in tissue culture. Previous studies with SIV and HIV (Hirsch eta/., 199 1; Meyerhans et& 1989) have demonstrated that only restricted subpopufations of viral genomes are recovered from infected indkiduals when virus is isolated and propagated in cell cuf?ure. Thus, sequences derived from tissue culture isoJates would represent only a small proportion of the genotypes actually present in the infected host.

JOHNSON ET AL.

220

TABLE 2 FREQUENCYOF NUCLEOTIDESUEISTITUTIONS IN THEINTEGRASE GENE in tegrase clone

Time after infection (wks)

No. of base substitutions’

% identity with original sequence

20.in3 44.inBZ0 44.inB3 44.inBlO” 52.in3

20 44 44

2 2 0

99.8 99.8 100

3.0 x 10-3 1.4 x 10-3 -

44 52

3 2

99.6 99.8

2.1 x 1o-3 1.2 x 10-3

pt55

44.inlll 44.inll3 44.inll6 52.in2

44 44 44 52

3 1 1 0

99.6 99.9 99.9 100

2.1 x 10-3 7.1 x lo+ 7.1 x 10-4 -

Rh661

20.inl 52.inll5* 52.inlllO 52.inlll2 52.inl

20 52 52

2 3 0

99.8 99.6 100

3.0

52 52

1 1

99.9 99.9

6.0 X lo+ 6.0 X 1O-4

44.inl 52.inB2 52.inB3 52.inB9

44 52 52 52

3 4 1 1

99.6 99.5 99.9 99.9

2.1 2.4 6.0 6.0

Macaque pt52

Rh655

Substitutions/site/y$

x 10-3

1.8 x IO-~ -

x X x x

1o-3 1O-3 1O-4 1O-4

a Number of nucleotides examined was 852 (except as indicated). b Calculated as described (Gojobori and Yokoyama, 1985), where R = d/2T and R = substitutions/site/yr, d = -3/4 In (1 - 4/3p), and T = time since divergence; d = no. of nucleotide substitutions per site, p = proportion of different nucleotides between clones. Corrections for bias in base substitutions were not performed. ’ Contained a single base deletion that prematurely ended the open reading frame. *Contained a single base deletion that caused a frameshift into the vifopen reading frame.

Nucleotide and amino acid sequence the integrase gene

variation

in

Eighteen integrase clones representing various time points from the four macaques were sequenced (Table 2). For each clone, the nucleotide identity with the original clone was >99% (0 to 4 changes over the 852 nucleotides analyzed). Among clones that differed from the original sequence, the calculated nucleotide substitution frequency ranged from 0.7 to 3.0 X 1 Oe3 substitutions/site/year. Analyses of clones derived from PBMCs taken at 20 weeks after inoculation revealed that the substitution frequency appeared to be constant with respect to sequences derived at 44 or 52 weeks; that is, substitutions appeared early, but did not accumulate with time. Three clones deserve special note. Two clones from Pt52 (44.inB2 and 44,inBlO) contained single-base deletions that rapidly brought stop-codons in-frame; one clone could potentially encode 235 of 284 integrase amino acids, while the other could encode only 103 amino acids. A third clone (from Rh661-52.inll5) contained a single-base deletion in the 3’ end of the gene that merged the reading frame into the vif gene. These three single base deletions were

the only frameshift mutations we found in this entire study (including all env sequences, see below). To examine the impact of nucleotide substitutions on the deduced amino acid sequences, integrase sequences were translated and analyzed for amino acid substitutions relative to the original clone sequence. Also, nucleotide substitutions were analyzed with respect to codon position and whether or not an amino TABLE 3 ANALYSISOF NUCLEOTIDESUSSTITUTIONS BY CODONPOSITION 96 Nucleotide substitutions per codon position (range)8 Gene

First

Second

Third

% nonsynonymous substitutions (range)’

lntegrase

48 (O-l 00) 37 (12-50)

19 (O-100) 31 (13-50)

33 (O-100) 32 (10-75)

59 (O-l 00) 71 (25-90)

env

“The nucleotide substitutions at each codon position were totalled for all integrase (n = 18) or envclones (n = 24) and an average derived. Range represents the low and high values for each set (integrase or env) of clones. Insertions and deletions were not considered for this analysis. A nonsynonomous nucleotide substitution causes an amino acid change.

GENETIC

VARIATION

OF

TABLE FREQUENCY

Macaque

env

OF NUCLEOTIDE

Time after infection (wks)

clone

221

SIV IN VW0

4

SUBSTITUTIONS

IN THE ENV GENE

No. of base substitutionse

% identity with original sequence

SubstitutionsisiteiyP

pt52

20.el8 20.e3 20.el5 20.e9 52.i34 52.i8 52.i20 52.i39

20 20 20 20 52 52 52 52

11 11 8 209 121 96 89 95

99.6 99.6 99.7 92.2 95.5 96.3 96.7 96.4

5.4 5.4 3.9 1.1 2.3 1.8 1.7 1.8

x x x x x X x X

10-3 lo+ lo-” 10-l lo-’ 1 O-’ 10-z IO-’

pt55

52.6 52.8 52.3a 52.2b23

52 52 52 52

113 108 108 106

95.8 95.9 95.9 96.0

2.2 2.1 2.1 2.0

x x x x

1o-2 lo-” lo-* lo-’

Rh661

20.e6 20.e2 20.e19 20.el3 52.f79 52.e76 52.k64 52.e91

20 20 20 20 52 52 52 52

10 8 29 20 6 5 7 42

99.6 99.7 98.8 99.2 99.8 99.8 99.7 98.4

4.9 3.9 1.4 9.8 1.1 9.4 1.3 8.0

x x x x x x x x

10-s lo+ lo-’ 1O-3 10-3 1o-4 1o-3 1o-3

Rh655

44.a55 44.3470 44.3d23 44.349

44 44 44 44

64 63 25 25

97.6 97.6 99.1 99.1

1.5 1.4 5.6 5.6

x x x X

lo-’ lo-* 1o-3 1O-3

a Does not Include insertions and deletions. b Calculated as described in Table 2.

Length

of the env gene

acid change resulted (Table 3). Of the 13 clones examined (the two clones with truncated open reading frames and the three clones without nucleotide substitutions were not included), three were identical in amino acid sequence to the original clone; the remaining 10 clones had one or two amino acid substitutions (>99% identity). Interestingly, the majority of nucleotide substitutions caused amino acid changes (59%); this was easily accounted for since 67% of the nucleotide changes were in the first or second codon position (Table 3). Nucteotide

sequence

variation

of the env gene

Twenty-four full-length env clones representing various time points from the the four macaques were sequenced in their entirety (Table 4). The nucleotide sequence for each clone was unique, and nucleotide identities with the original clone ranged from 92 to >99%. Accordingly, there was a wide range (9.0 X 1 Oe4 to 1.1 X 10-l) in the frequency of substitutions/ site/year among the env clones studied. When compared to integrase, env clones displayed on average a

ranged

from

2655

to 2679

nucleotides.

1 O-fold higher frequency of nucleotide substitutions (w-10-2 vs - 1 Om3). Interestingly, the most divergent sequence we encountered (Pt52, c\ane 20.e9) was recovered 20 weeks after inoculation. This clone was nearly 8% different in nucleotide seqmnce from the original clone (-10-l nucleotide substitutiori\slsiteJ year) and contained a 24 nudec@i& insertion and a 3 nucleotide deletion (with respect to t&s original clone) in separate regions of gp 12O.Overali, theF;e data are in excellent agreement with the substibution frequencies observed for gp120 clones isolated from two macaques infected with virus derived from the SIVmac239 molecular clone (Burns and Desrosiers, 1991). Characterization of the types of ftu&@&kle substitutions in the env gene

The large amount of sequence variation in env allowed us to examine in detail the wpe$ of nucleotide substitutions that occurred. Three i~~~~~~ng observations emerged from our analyses. First, the vast majority of variation was due to simple nucleotide substitu-

222

JOHNSON ET AL. TABLE 5 CHARACTERIZATION OF NUCLEOTIDESUBSTITUTIONSIN THEENVGENE Transitions (%)

Macaque pt52 Pt55 Rh661 Rh655

Time after infection (wks) 20 52 52 20 52 44

G+A

A-*G

26 61 66 63 50 28

26 18 16 21 25 30

T+C 13 10 7 9 18 12

C+T 10 5 5 3 3 14

Transversions (%Y

No. of clones with in-frame stop codonsb

25 6 6 4 4 16

l/4 (1) 414 (22) 414 (26) 214 (12) 2f4 (8) o/4

a For each macaque at each time indicated, the average value for four env clones (listed in Table 4) is shown. % calculations do not include insertions and deletions. b For each macaque at each time indicated, the number of env clones with in-frame stop-codons are shown as a fraction of the total number of clones sequenced. The sum total of all stop-codons in a given set of clones is shown in parentheses. All stop-codons were introduced at tryptophan.codons (TGG --, TGA, TAG, or Th). -

tions. Only one clone (see above) had an insertion or deletion larger than 3 nucleotides when compared to the original sequence. Second, as previously noted for the integrase gene, the majority (71%) of nucleotide substitutions caused amino acid changes (Table 3). Each codon position appeared to be equally likely to undergo substitutions, thereby accounting for the high rate of amino acid changes. Third, 13 of the 24 env clones contained in-frame stop-codons that were exclusively generated by G to A transitions at tryptophan (TGG to TAG or TAA) codons. When clones contained in-frame stop-codons, we noted a large number of G to A transitions throughout the entire sequence when compared to clones without in-frame stop-codons (Table 5). In some clones, G to A transitions accounted for the majority of the nucleotide changes; for example, clones 52.i34 and 20.el9 sustained 121 and 29 nucleotide substitutions, respectively, of which 83 (69%) and 23 (79%), respectively, were G to A transitions. Recently, other investigators have also noted this propensity for G to A transitions in clones of spleen necrosis virus (Pathak and Temin, 1990) and HIV-1 (Vartanian eta/., 1991) derived from cultured cells. The results reported for HIV-1 suggested that dislocation mutagenesis (-1 slippage) was responsible for most of the observed G to A transitions. This prompted us to examine our sequences for evidence of this mechanism in those sequences with high G to A transition rates. Env clones from the three macaques (52, 55, 661) that displayed high G to A transition rates were inspected for effects of the 5’ and 3’ nucleotides that bordered the target G nucleotide. No effect of the 5 nucleotide on G to A transitions was found (data not shown). However, significant effects of the 3’ nucleotide were found (Fig. 1). For macaques 52 and 55, we

observed that G to A transitions were much more likely to occur when the target G nucleotide was followed by an A (GpA). The other three possible dinucleotides were either not favored (GpG) or were significantly disfavored (GpT and GpC) in comparison. Interestingly, for macaque 661, the dinucleotide GpG was strongly pre-

FIG. 1. Effect of the 3’ nucleotide on G to A substitutions. Calculations were performed essentially as described previously (Vartanian et a/., 1991). Env clones exhibiting high G to A transition rates were examined for the effect of the nucleotide immediately downstream (3’) of the target G nucleotide. They-axis represents the % frequency of G to A transitions in clones from the indicated macaque (see legend insert). Along the x-axis are the four possible combinations of dinucleotides for analysis. The open bars for each dinucleotide represent the expected frequencies assuming the G to A transitions were independent of dinucleotide context. x2 analyses of observed and expected values yielded the significance figures shown. A similar analysis for the 5’ nucleotide did not show any significant effects.

GENETIC

VARIATION

OF

SIV IN

223

VW0

MacaqueClone -__

I%52 20.e18 20x3

Fth661

-

II

/ ii

20.e2 20.e19

.

20x13

.

.

.

I

I

. .

I I

. .

/ j

I/

I (

20x6

s I.

*i I/ I .,

I

/ I I I ', j i~ /I/ I I I

99 99 98 91

FIG. 2. Amino acid variation in the Env protein 20 weeks after infection. Env clones (n = 8) from two macaques (Pt52 and Rh661) representing sequences present 20 weeks after inoculation are shown. At the top of the figure, gpl60 is schematically depicted for comparative purposes. Black boxes above the gpl60 diagram represent hypervariable domains in HIV-1 ; shaded boxes marked Vl -V5 within gpl60 represent consensus variable domains for the SlVsmlmac Env protein (see the text). Other shaded areas represent the following regions: S, signal peptide; CD4, Env domain implicated in binding to CD4; F, hydrophobic fusion domain at the aminoterminus of gp40; TM, hydrophobic membrane spanning domain; and CYT, the predicted cytoplasmic domain of the protein. Each clone is represented by an open rectangle and individual clone names are given to the left of the rectangle. Within the rectangle, various symbols represent the following changes with respect to the original clone sequence: a vertical line (I) represents a single amino acid substitution; a solid dot b) indicates an in-frame stop codon; a down arrow (4) shows an amino acid insertion and delta (A) an amino acid deletion. In clone 20.e3, a cysteine to serine substitution is shown in single-letter code, and in clone 20.e9, a five residue insertion is indicated by the number 5. The overall amino acid identity (%) of each clone with the original clone sequence is shown to the right of each rectangle

ferred as a target; again, the remaining dinucleotides were either not favored (GpA) or were significantly disfavored (GpT and GpC).

one; clone 20.e3 had a serine to cysteine substitution at position 101 in gpl20 (Fig. 2). Variable domains in the SIV Env protein

Amino acid sequence

variation

in the Env protein

When compared to the original clone, deduced gpl60 amino acid sequence identities of the 24 clones ranged from 89 to >99% (Figs. 2 and 3). As noted above, the most divergent clone (Fig. 2, 20.e9, 89%) was recovered from Pt52 at 20 weeks after inoculation. Certain structural features of the Env protein appeared to be highly conserved, even among the most divergent clones. One highly conserved domain was the region previously implicated in Env-CD4 interactions (by analogy to HIV-l ; Laskey et al., 1987) located between cysteine residues 438 and 465 in the smH-4 sequence (Fig. 4). Another conserved domain was the hydrophobic sequence at the amino-terminus of gp40 that has been implicated in virus membrane fusion with the host cell (Bosch et al., 1989). The nucleotide sequence of this same area also contains part of the Revresponsive element (by analogy to HIV-1 and HIV-2), an RNA stem-loop structure that binds to the Rev protein in the infected cell nucleus (Maiim eta/., 1990). Finally, cysteine residues were conserved in all clones except

Alignments of the 24 deduced Env amino acid sequences revealed discrete regions of variation that appeared to correspond to some of the previously defined variable domains in the HIV-1 Env protein (Starcich et a/., 1986). For purposes of comparison with our clones, we sought to define consensus variabfe domains in the SIVsm/mac Env protein by aligning previously determined sequences of four distinct SIVsm/ mat clones (SIVsm/H-4, SIVmne/cJone 8, SIVmac/ 142, and SIVstm/37.16 [SIV from stump-taled macaques, unpublished data]) (data not shown}. A variable domain was arbitrarily defined as a region (window of 10 residues) containing at least five variant positions; a position was defined as variant if it differed in at least two of the four aligned sequences. Using this definition, five variable domains in gpl60 (four ingp120 and one in gp40) were located: Vl, 125G to 157N; V2, 192R to 203s; V3, 415R to 431Q; V4, 4791 to 488M; and, V5, 738V to 766R (where, for example, Vl is the first variable domain that spans residue 125 [G, glytine] to residue 157 [N, asparagine] in the smH-4 se-

JOHNSON ET AL.

224

Macaque

Z amino add identity with otigid clone

Clone

Tzi-52334

II

t

.

52.U

90

92

52.i20

93 I

52.i39

1

pt55

92 91

52.6 52.8

91 91

523a

92

522b23

Rh661 52.m 5Ze76 52.k64 52.e91 Rh655 44a55

95

443d70

9.5

44.3d23

1

98

44.339

1

98

FIG. 3. Amino acid variation in the Env protein 44 to 52 weeks after infection. Env clones (n = 16) from four macaques representing sequences present at 44 to 52 weeks after inoculation are shown. Symbols and labels are the same as Fig. 2.

quence). Four of the variable regions in the SIV Env protein (Vl , V2, V3, and V4) roughly aligned with analogous regions previously defined for the HIV-1 Env protein (Vl, V2, V4, and V5) (Figs. 2 and 3). However, two major differences were observed. First, the hypervariable V3 loop (or “principal neutralizing domain”) of HIV-1 was not a variable region in the analogous area of the SIV Env protein. Second, for SIV, a variable domain occurred in gp40 (V5) that was not present in HIV-l (Figs. 2 and 3). Interestingly, this region is notable for the occurrence of an in-frame stop codon in some SlVmac molecular clones (Desrosiers, 1990; Johnson et a/., 1991). For our 24 clones, clustered variation tended to occur in the domains defined above (Figs. 2 and 3). In addition, several other regions predicted to be part of the mature gpl60 protein appeared to contain variable domains. First, the amino terminus of gpl20 (upstream of Vl) contained clustered substitutions in some clones. Second, the region surrounding the hydrophobic transmembrane anchor appeared highly variable in some clones; however, many of these substitutions were conservative changes that preserved the hydro-

phobic character of the region. Third, the cytoplasmic tail (downstream of V5) was a target for variation, even in clones that had relatively little variation overall (for example, 20.e6 or 52.e91, Figs. 2 and 3, respectively). As stated above, the HIV-1 V3 loop was not predicted to be a variable domain in the SIV Env protein. Indeed, 17 of the 24 clones we examined had only one substitution in the linear sequence bounded by cysteine residues 312 and 345 (Fig. 5). Interestingly, there appeared to be strong selective pressure for glycine at position 316. Clones isolated from macaques 52, 661, and 55 all contained a glutamic acid to glycine substitution at this position; macaque 655 was inoculated with smH-3, which already had a glycine at position 316. Furthermore, all other SIV and HIV-2 clones examined had a glycine at position 316 (smH-4 was the only clone without a glycine at this position). Genetic variation

of the rev gene

Because the majority of the revgene (second coding exon) was within the boundaries of the primers used for env gene PCR amplification, we were afforded the

GENETIC SW Variable Macaque 52 52 52 52 52 52 52 52 661 661 661 661 661 661 661 661 55 55 55 55 655 655

Clone 20.e1a 20.e3 20.e15 20 .e9 52. i34 52.S 52.i20 52.i39 20 .eb 20.02 20 .e19 20.e13 52, f79 52 .e76 52.kb4 52 .e91 52.6 52.8 52.a3 52.2b23 44 .a55 44.3470

655 655

44.349

44.3@3

VARIATION Domain

OF SW

IN I/IV0

225

3

1474)

YVP

STyTSLIi

----------------------------------R--------------------------------------------------------------------K-----------------------------------------------------D-------------------------------------------------------.I~-S--TS--Q--RYG----------------------------------------------------NSS--R---T-K---R---------------------------------------------------------NSS-ZR---T-------------------------------------------------------------NSS-ZR---T-------------------------------------------------------------NSS-ZR---T--R--R------------------------------------------------_---_---_---_---_--------------------------------------------------_-----------_---_----------------------------------------------~------2------------------------------------------------------------------z-------------------------------------*-------------------------L------------------------------------------------------------------L------------------------------------------------------------------L---------------------------------------------------------------------Z-------SD-----------------------------------------------------------fCN---NSS--R---T--------------------------------------------------------KN---NSS--R---T--------------------------------------------------------ICN---NSS--R---T-------------------------------------------------------------NSS--R---T------------------------------------------------------------------E--KPN-R--R-------------------------------------------------------------E--KPN-R--R-----------------------------------------------e--------E-------K---------------------------------------------------------E--------K-------------------------------------------------

FIG, 4. Deduced amino acid sequences for the 24 env clones spanning V3 domain is analogous to the HIV-1 V4 domain. The letter Z represents

opportunity to examine genetic variation of a third gene. All 24 nucleotide sequences described above were translated in the open reading frame for the rev gene, and the deduced amino acid sequences compared (Fig. 6). Amino acid identities with the original clone ranged from 87 to 100%. In-frame stop-codons were present in 8 of the 24 Rev protein sequences. In the corresponding env gp40 reading frame, only one in-frame stop-codon in one clone (Pt52, clone 52.i34) was observed. The “hot-spot” in the rev translational frame was a tryptophan residue within the nuclear localization signal in the amino-terminal half of the second coding exon. All rev genes with stop-codons belonged to sequences notable for a high rate of G to A nucleotide substitutions (Fig. 6 and Table 5). Overall, however, the majority of amino acid substitutions occurred in the carboxy-terminal half of the predicted protein sequence. This observation was in agreement with the previously noted dichotomy of sequence conservation among amino- and carboxy-terminal domains of primate lentivirus Rev proteins (Cheng et a/., 1990). The consequences of these substitutions on Rev function are not known. DISCUSSION The SIV mv gene is a preferred

target for variation

The two areas of the genome analyzed in our study (integrase and env) appeared to incur substitutions at different frequencies. The average frequency of substitutions in the env gene was approximately an order of

the WV3 an in-frame

domain and the adjacent stop codon and a period

CD4 bindlng domain; represents an amino

here, the SIV acid deletion.

magnitude higher than the frequency of subsfltutions in the integrase domain of the pal gene. This finding is consistent with sequence comparisons among viruses (HIV or SIV) isolated from different individuals where the internal structural genes (gag and pal) are mare conserved among isolates than the envgene. Variation within specific regions of the env gene (variable domains) account for the major portion of this d It is tempting to speculate that the variable domains in env are generated in response to selective pressures imparted by host immune responses, especia#y in light of work from other lentiviral model systems (e.g., visna virus or caprine arthritis encephalitis virus; Hasse, 1986; Narayan and Clements, 1989). Although certainly host immune responses do influence WV variation, several observations from our studies suggest that this is not the whole story. First, one of our infected macaques (Pt55) developed only a transient SIV-specific antibody response, yet significantenvvariation occurred (of course, this does not rule out other effector arms of the immune response as selective forces). Second, regions of the Env protein presumably unexposed to host immune responses (e.g., the membrane-spanning and cytoplasmic domains) tended to show significant variation in some clones. These data suggest that the structure of the ERV protein is highly pliable and capable of incorporating many amino acid substitutions without significant perturbation of the protein structure. Some regions of Env, however, are highly conserved and appear to participate in essential functional domains (e.g., the CD4 binding domain).

226

JOHNSON ET AL.

A Macaque 52 52 52 52 52 52 52 52 661 661 661 661 661 661 661 661 55 55 55 55 655 655 655 655

Clone 20.elS 20.93 20.e15 20.09 52.i34 52.S 52.i20 52.i39 20.06 20.e2 20.e19 20.e13 52.f79 52.076 52.k64 52.e91 52.6 52.8 52.a3 52.2b23 44.a55 44.3470 44.3d23 44.349

----G--------------------------------G--------------------------------G--------------------------------G-----------------------------K--G-----------------------------T--G----S---------------------------G--------------------------------G--------------------------------G--------------------------------G--------------------------------G--A-----------------------------G--------------------------------G---------------------------Z----G--------------------------------G--------------------------------G-----------------------------K--G-------------------"---------K--G-------------------"---------K--G-------------------"------------G---------------------------------------------------L--------------------------------L----------------------TV-------------------------------TV-------------------

Macaque --

Pt5Z

8

1

clone ZO.CG 20.d

ml

I

20.e15

----G---------------------D-------

SIVmra251

SIVmadl42 SIVmne/clone SIVstm/ HIV-Z/uzos HIV-~/ST

ing clones from Rh661. The 3’ nucleotide effect in the 661 clones was exerted by G rather than A (Fig. l), suggesting a more complex mechanism than simple -1 dislocation mutagenesis (Vartanian et a/., 1991). Sequential or more extensive dislocation of the nascent strand might explain many of the GpG to ApG substitutions. In addition, some of the G to A transitions in this context may be due to simple polymerase error at preferred sites (Var-tanian et al., 1991). As a consequence of high G to A transitions, nearly half of our env (13 of 24) clones had multiple in-frame stop codons generated exclusively at tryptophan co-

----G-----------A-------V------------G---------------------D----------G-----------------------------K--G----V-IRTV---L-------K--R----K--G----V-I-L------------R--R----

99

20.e9

!a

%?.I34

a7

52.B

92

S2.i20

92

52.l39

S-2

52.6

a7

52.8

89

B HIV-1 SIV

CTRPNNN..TRKSIHI..GPGRAFY.TTGEIIGDIRQAIiC -R--G-K. . -vLPvT-..ns-LV-E.SQPINFxlPK.--W-

FIG. 5. (A) Deduced amino acid sequences for the 24 env clones spanning the region analogous to the HIV-1 V3 loop. The sequence shown at the top is the smH4 sequence (smH3 is identical except for a glycine at residue 316). Dashes represent identity at that position; Z, stop codon. (B) Alignment of the HIV-1 V3 loop with the analogous domain in the SIVsmH-3 Env protein. Periods indicate gaps introduced to optimize the alignment; dashes in the SIV sequence represent identity at that position.

Thus, it seems likely that multiple factors, including the host immune response, error-prone reverse transcription, and a permissive Env protein structure, contribute to the observed genetic variation in the env gene. G to A transitions and in-frame stop codons are common in env clones from some animals Our data showed that clones from some animals at a given point in time displayed an unusual propensity for G to A transitions. Similar observations have been made previously for HIV-1 (Goodenow et a/., 1989; Meyerhans et a/., 1989). The mechanisms proposed for generating G to A transitions in HIV-1 are also probably responsible for many of the G to A transitions we observed in SIV-infected macaques, the exception be-

Pt55

Rh661

52.3s

89

52.2bZ.J

96

-1

98

2O.d -1

98

20.6

20x19

99

20413

100

52.f79 I]

99

52.~76 11

98

52.k64 I[

99

52&l

m

98

~ih655 sass -1

95

443d70 -1

95

4-B 443d9 -1

98 98

FIG. 6. Amino acid variation in the second coding exon of Rev 20 to 52 weeks after infection. These sequences were all derived from the clones depicted in Figs. 2 and 3. The second coding exon of Rev is shown at the top of the figure. NLS, nuclear localization signal. Other symbols and labels are the same as Fig. 2.

GENETIC VARIATION OF SIV IN \/IV0

dons (TGG to TAG, TGA, or TAA). We observed this phenomenon in clones from 3 of the 4 macaques we studied, and in two macaques, all four clones examined at 52 weeks postinoculation contained in-frame stop codons (Figs. 2 and 3). Again, these data are similar to those previously reported in some studies with HIV-1 from human patients (Goodenow et a/., 1989; Meyerhans eta/., 1989). In contrast, a study of env and gag gene sequences from a cohort of HIV-l-infected hemophiliacs (Balfe et al., 1990) and a recent study of SIV genetic variation (Burns and Desrosiers, 1991) failed to observe this phenomenon. Several hypothetical explanations may account for these discrepancies. First, the env sequence data from the hemophiliac study was limited solely to the V3 and V4N5 domains and clearly could have missed missense substitutions. Second, the SIV study concentrated on two macaques and examined only the gpl20 sequence; by chance, our study could have missed missense substitutions if we had not sequenced entire env clones from four macaques at several time points after infection (e.g., macaque 52 at 20 weeks and macaque 655 at 44 weeks). A third intriguing, albeit tenuous, possibility arises from the observation that the two macaques in our study that displayed in-frame stop codons in all env clones at 52 weeks after infection have remained healthy, whereas the two macaques with some or all fully competent env clones have died of AIDS. The clinical status of the hemophiliacs was not reported, but interestingfy, one of the two macaques in the SIV study mentioned above died of AIDS. Obviously, more work will be required to fully elucidate the potential role in-frame stop-codons generated by G to A transitions in the pathogenesis of AIDS in macaques and man. The principal neutralizing domain for SIV may not be analogous to the V3 loop of HIV-1 Numerous studies have documented the importance of the V3 loop in gpl20 as the principal neutralizing domain (PND) of the HIV-1 Env protein (LaRosa et al., 1990 and references therein). However, a similar PND has not been identified for SW. A striking feature of the HIV-1 PND is extreme genetic variability among isolates, presumably generated by immune selection. If the analogous region of the SIV Env protein were a PND, then we might expect to observe a similar level of genetic variability as seen in HIV-l. Our data show that this is not the case (Fig. 5) and are in agreement with data from another recent study of SIV genetic variation (Burns and Desrosiers, 1991). Because of the intense interest in the SIV macaque model as a vaccine development tool for HIV-l, this observation clearly has important implications. If the envelope structures of SIV

227

and HIV-1 differ in a significant way regarding elicitation of protective immune responses after immunization (or infection), then conclusions regarding vaccine trials with SIV in macaques may not be d&&y applicable to HIV-l vaccine development. It wiH be important to resolve this question so that data from SW vaccine studies can be properly interpreted with respect to HIV-l. Because of the closer genetic relationship of SIV and HIV-2, HIV-2 vaccine development can probably be safely modeled after the SIV system. ACKNOWLEDGMENTS The authors thank Drs. Robert Purcell, John Gerin, and Robert Chanock for their criticisms and continued support; Drs. Howard Temin and Robert Olmsted for thoughtful review of the manuscript; Dr. Gerry Myers and Kersti Maclness of the Los Alamos HIV Sequence Database for many helpful discussions; Dr. Michael Murphey-Corb for the original gift of SIVsm F236; Dr. Frank Novembre for the SlVstm sequence; George Dapolito for technical assistance; Dr. William T. London and Russell Byrum for help with animal studies: and Dr. Philip M. Zack for pathology support and helpful discussions. This work was supported in part by Contrast NOl-AI-72623 from the National Institutes of Allergy and Infectious Diseases.

REFERENCES BALFE, P., SIMMONDS,P., LUDIAM, C. A., BISWOP,J. O., and BROWN, A. J. L. (1990). Concurrent evolution of human immunodeficiency virus type 1 in patients infected from the same source: Rete of change and low frequency of inactivating mutations. 1. Viral. 64, 6221-6233. BOSCH, M. L., EARL, P. L., FARGNOLI,K., PICCIAFUOCO,S., GIOMWNI,F.. WONG-STAAL, F.. and FRANCHINI,G. (1989). Identification of the fusion peptide of primate immunodeficiency viruses. Science 244, 694-697. BURNS,D. P. W., and DESROSIERS,R. C. (1991). Selection of genetic variants of simian immunodeficiency virus in persistentty infected rhesus monkeys. J. Viral. 65, 1843-l 854. CHENG,S-M., BLUME, M.. LEE, S-G., HUNG, P. P., HIRSCH,V. M., and JOHNSON,P. R. (1990). Coexpression of biologically-active SIV rev and env in an SV40 system: the rev gene regulates env expression. virology 177, 816-819. COFFIN,1. M. (1986). Genetic variation In AIDS viruses. Cell 46, 1-4. COFFIN, J. M. (1990). Retroviridae and their replication. In “Fields Virology” (B. N. Fields and D. M. Knipe, Ed%), pp. 1437-1500. Raven Press, New York. DESROSIERS,R. C. (1990). The simian immunodeficiency viruses. Annu.

Rev.

Immunol.

8, 557478.

ENNIS, P. D., ZEMMOUR,J., SALTER, R. D., and PARHAM, P. (1990). Rapid cloning of HLA-A,B cDNA by using the polymer&se chain reaction: Frequency and nature of errors produced in amplification. Proc. Natl. Acad Sci. USA 67, 2833-2837. GOLDSTEIN,S., ENGLE, R., OLMSTED, R. A., HIRSCH.V. M., and JOHNSON, P. R. (1990). Detection of SIV antigens by HIV-1 antigen capture immunoassays. /. Acquired lmmuno. Def Synd. 3, 103-108. GOJO~ORI,T.. and YOKOYAMA, S. (1985). Rates of the retroviral omogene of Moloney murine sarcoma virus and of its cellular homologues. Proc. Natl. Acad. Sci. USA 62, 4198-4201. GOODENOW, M., HUET, T., SAURIN,W., KWOK, S.. SNINSKY,J., and WAIN-HOBSON,S. (1989). HIV-1 isolates are a rapidly evolving qua-

228

JOHNSON ET AL.

sispecies: evidence for viral mixtures and preferred nucleotide substitutions. J. Acquired Immune. Def. Synd. 2, 344-352. HASSE, A. (1986). Pathogenesis of lentivirus infections. Nature 322, 130-136. HIRSCH,V. M., DAPOLITO,G., MCGANN, C., OLMSTED, R. A., PURCELL, R. H., and JOHNSON,P. R. (1989a). Molecular cloning of SIV from sooty mangabey monkeys. J. Med. Primatol. 18,279-285. HIRSCH,V. M., OLMSTED, R. A., MURPHEY-CORE,M., PURCELL,R. H., and JOHNSON,P. R. (1989b). An African primate lentivirus (SIVsm) closely related to HIV-2. Nature 339, 389-392. HIRSCH,V. M., ZACK, P. M., and JOHNSON,P. R. (1991). Simian immunodeficiency virus infection of macaques: Pathogenesis of endstage disease is characterized by high levels of proviral DNA in tissues. J. Infect. Dis. 183, 976-988. HOXIE,J. A., HAGGARTY,B. S., BONNER,S. E., RACKOWSKI,J. L., SHAN, H., and KANKI, P. J. (1988). Biological characterization of a simian immunodeficiency virus-like retrovirus (HTLV-IV): evidence for CD4-associated molecules required for infection. J. Viral. 82, 2557-2568.

JOHNSON,P. R., FOMSGAARD,A., ALLAN, J., GRAVELL, M., LONDON, W. T., OLMSTED, R. A., and HIRSCH,V. M. (1990). Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity. J. Viral. 84, 1086-l 092. JOHNSON,P. R., MYERS, G., and HIRSCH,V. M. (1991). Genetic diversity and phylogeny of non-human primate lentiviruses. In “Annual Review of AIDS Research” (W. C. Koff, F. Wong-Staal, and R. C. Kennedy, Eds.), Vol. 1, pp. 47-62. Dekker, New York. LARDER,B. A., DARBY, G., and RICHMAN, D. D. (1989). HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 243, 1731-l 734. LARosA, G. J., DAVIDE,J. P., WEINHOLD,K., WATERBURY,J. A., PROFY, A. T., LEWIS,J. A., LANGLOIS,A. J., DRESSMAN,G. R., BOSWELL,R. N., SHADDUCK, P., HOLLEY, L. H., KARPLUB, M., BOLOGNESI, D. P., MATTHEWS,T. J.. EMINI, E. A., and PUTNEY,S. D. (1990). Conserved sequence and structural elements in the HIV-1 principal neutralizing domain. Science 249, 932-935. LASKEY,L. A., NAKAMURA,G., SMITH, D. H., FENNIE,C., SHIMASKI,C.,

PATZER, E., BERMAN, P.. GREGORY,T., and CAPON, D. J. (198j). Delineation of a region of the human immunodeficiency virus type 1 gpl20 glycoprotein critical for interaction with the CD4 receptor. Cell50,975-985.

LETVIN,N. L., DANIEL, M. D., SEHGAL, P. K., DESROSIERS,R. C., HUNT, R. D., WALDRON, L. M., MACKEY, J. J., SCHMIDT, D. K., CHALIFOUX, L. V.. and KING, N. W. (1985). Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III. Science 230,71-73.

MALIM, M. H., TILEY, L. S., MCCARN, D. F., RUSCHE,J. F., HAUBER,J., and CULLEN, B. R. (1990). HIV-1 structural gene expression requires binding of the rev trans-activator to its RNA target sequence. Cell 60,675683. MEYERHANS,A., CHEYNIER,R., ALBERT,J., SETH, M., KWOK,S., SNINSKY, J., MORFELDT-MANSON,L., ASJO, B., and WAIN-HOBSON,S. (1989). Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58, 901-910. NARAYAN,O., and CLEMENT%J. E. (1989). Biology and pathogenesis of lentiviruses. J. Gen. Viral. 70, 1616-l 639. PATHAK, V. K., and TEMIN, H. M. (1990). Broad spectrum of in vivo forward mutations, hypermutations, and mutatipnal hotspots in a retroviral shuttle vector after a single replication cycle: substitutions, frameshifts, and hypermutations. Proc. Nat/. Acad. Sci. USA 87, 601 g-6023. STARCICH,B. R., HAHN, B. H., SHAW, G. M., MCNEELEY, P. D., MoDROW, S., WOLF, H., PARKS, E. S., PARKS, W. P., JOSEPH%S. F., GALLO, R. C., and WONG-STAAL, F. (1986). Identification and characterization of conserved and variable regions in the envelope gene of HTLV-III/LAV, the retrovirus of AIDS. Cell 45, 637-648. STEINHAUER,D. A., and HOLLAND,J. J. (1986). Rapid evolution of RNA viruses. Annu. Rev. Microbial. 41, 409-433. TEMIN, H. M. (1989). Is HIV unique or merely different? J. Acquired lmmuno. Def. Synd. 2, l-9. VARTANIAN. J-P., MEYERHANS, A., ASJO, B., and WAIN-HOBSON, S. (1991). Selection, recombination, and G --, A hypermutation of human immunodeficiency virus type 1 genomes. J. Viral. 85, 1779-l 788.