- Email: [email protected]
Comparison of DNA adduct levels associated with exogenous and endogenous exposures in human pancreas in relation to metabolic genotype
Mutation Research 424 Ž1999. 263–274
Comparison of DNA adduct levels associated with exogenous and endogenous exposures in human pancreas in relation to metabolic genotype P.A. Thompson a,) , F. Seyedi b, N.P. Lang c,d , S.L. MacLeod d , G.N. Wogan e, K.E. Anderson e, Y.-M. Tang a , B. Coles a , F.F. Kadlubar a a
DiÕision of Molecular Epidemiology, National Center for Toxicological Research (HFT-100), 3900 NCTR Rd., Jefferson, AR 72079, USA b Massachusetts Institute of Technology, Boston, MA 02139, USA c John L. McClellan Memorial Medical Center, Little Rock, AR 72205, USA d Arkansas Cancer Research Center, Little Rock, AR 72205, USA e UniÕersity of Minnesota, Minneapolis, MN 55454, USA Accepted 17 September 1998
Abstract Recently, we examined normal human pancreas tissue for DNA adducts derived from either exogenous chemical exposure andror endogenous agents. In an effort to explain the different types and levels of DNA adducts formed in the context of individual susceptibility to cancer, we have focused on gene–environment interactions. Here, we report on the levels of hydrophobic aromatic amines ŽAAs., specifically those derived from 4-aminobiphenyl ŽABP., and DNA adducts associated with oxidative stress in human pancreas. Although these adducts have been reported in several human tissues by different laboratories, a comparison of the levels of these adducts in the same tissue samples has not been performed. Using the same DNA, the genotypes were determined for N-acetyltransferase 1 ŽNAT1., the glutathione S-transferase ŽGST. M1, GSTP1, GSTT1, and NADŽP.H quinone reductase-1 ŽNQO1 . as possible modulators of adduct levels because their gene products are involved in the detoxification of AAs, lipid peroxidation products and in redox cycling. These results indicate that ABP–DNA adducts, malondialdehyde–DNA adducts, and 8-oxo-2X-deoxyguanosine Ž8-oxo-dG. adducts are present at similar levels. Of the metabolic genotypes examined, the presence of ABP–DNA adducts was strongly associated with the putative slow NAT1)4r)4 genotype, suggesting a role for this pathway in ABP detoxification. q 1999 Elsevier Science B.V. All rights reserved. Keywords: Aromatic amine; DNA adduct; Pancreas; Oxidative damage; Lipid peroxidation
X
X
Abbreviations: 8-oxo-dG, 8-oxo-2 -deoxyguanosine; m 1G, pyrimidow1,2-a xpurin-10Ž3 H .-one; edA, 1, N 6-etheno-Ž2 -deoxy.adenosine; X edC, 3, N 4-ethenoŽ2 -deoxy.cytidine; NAT1, N-acetyltransferase 1; GST, glutathione S-transferase; NQO1 , NADŽP.H quinone reductase-1; BMI, body mass index as kg my2 ; ABP, 4-aminobiphenyl; dG-C8-ABP, N-deoxyguanosin-8-yl-ABP; HPLC, high-pressure liquid chromatography; PCR, polymerase chain reaction; PL, postlabelling; TLC, thin-layer chromatography; AA, aromatic amine ) Corresponding author. Tel.: q1-870-543-7396; Fax: q1-870-543-7773; E-mail: [email protected] 0027-5107r99r$ - see front matter q 1999 Elsevier Science B.V. All rights reserved. PII: S 0 0 2 7 - 5 1 0 7 Ž 9 9 . 0 0 0 2 4 - X
264
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
1. Introduction Cancers of several human tissues have been associated with a number of common risk factors. Smoking has been associated with numerous cancers, particularly lung and the upper respiratory tract, and urinary bladder, as well as pancreas Žreviewed in Refs. w1–3x.. The role of diet is thought to be a major modifier of cancer risk in target tissues such as the colon, breast and prostate w4–7x. In each of these tissues, the presence of hydrophobic DNA adducts derived from aromatic amines ŽAAs., heterocyclic amines ŽHAAs. and polycyclic aromatic hydrocarbons ŽPAHs. has been demonstrated Žreviewed in Ref. w8x.. Numerous environmental sources can account for these exposures including cigarette smoke, fossil fuel products, and high temperature cooked meats. The tissue-specific expression of enzymes capable of metabolically activating or detoxifying these exogenous compounds has been correlated with specific DNA adduct levels. This evidence suggests a mechanism for these etiologic agents in DNA damage and cancer induction Žreviewed in Ref. w9x.. In addition to these exogenous sources of carcinogens, the consistent finding that diets low in vegetable and fruit intake increase the risk for a number of cancers is consistent with the view that low antioxidant levels with resultant endogenously-derived oxidative DNA damage has a role in carcinogenesis Žreviewed in Refs. w10,11x.. A number of DNA adducts that arise following oxidative damage or lipid peroxidation have been detected in human tissues including brain, placenta, prostate, oral and gastric mucosa, lung, breast, kidney, and colon mucosa Žreviewed in Refs. w10–20x.. The presence of these endogenous adducts suggest that mutagenic damage to DNA, with the potential to initiate or promote carcinogenesis, may be a direct result of the normal processes of cellular respiration, lipid peroxidation and aging. Cancer of the pancreas is the fifth leading cause of cancer mortality in the United States, with about 28,000 deaths expected per year w21x. Other than advanced age, cigarette smoking is the most consistently reported risk factor Žreviewed in Ref. w22x.. Relative risk estimates for smoking are around twofold with higher estimates reported for heavy smokers. Other risk factors include high consumption of
cooked fish and meat w23–29x, low vegetable and fruit consumption w10,22x, some occupational exposures and chronic pancreatitis w30–34x. These risk factors indicate a role for endogenous andror exogenous exposures in pancreatic cancer and prompted us to examine the levels and types of adducts formed in this tissue as a means of identifying carcinogens and metabolic enzymes that may contribute to the etiology of pancreatic cancer. Common links among the risk factors for pancreas cancer may be exposures to exogenous compounds such as AAs, heterocyclic amines and nitroaromatic hydrocarbons that form DNA adducts. Epidemiologic data indicate that some of these agents may be carcinogenic to the human pancreas Žreviewed in Refs. w22,31,35,36x.. About 30 AAs, including 2-naphthylamine and 4-aminobiphenyl ŽABP., have been detected in nanogram quantities in mainstream cigarette smoke and in even higher levels in sidestream smoke w37x. AAs are also found in coal- and shale-derived oils w38x and in agricultural chemicals w39x, and they are used in a variety of industrial processes w40x. The carcinogenicity of AAs, such as ABP, 2-naphthylamine, and benzidine, has long been established in both humans and experimental animals w41x. In addition to exogenous carcinogen exposures, such as those associated with cigarette smoking, it is plausible that certain endogenous compounds generated from oxidative stress and lipid peroxidation may be a source of DNA adduct formation in the human pancreas and initiators of carcinogenesis. Endogenous DNA adducts associated with oxidative stress include 8-oxo-dG, pyrimidow1,2-a xpurin-10Ž3 H .-one Žm 1G ., 1, N 6 -ethenoŽ2 X-deoxy.adenosine ŽedA ., 3, N 4-ethenoŽ2X-deoxy.cytidine ŽedC., and a variety of other products Žreviewed in Refs. w11–15x.. These adducts are generally thought to be derived from lipid peroxidation or normal cellular respiration and have recently been reported by our laboratory and by Wang et al. to be present in human pancreatic tissues w42,43x. The formation of these damaging free radicals is thought to be increased as the result of radiation exposure, cigarette smoking, occupational exposure, dietary antioxidant insufficiency, or diets high in v-6 polyunsaturated fatty acids Žreviewed in Refs. w11–20x.. Additionally, they may result from chronic disease states such as hepatitis, Wilson’s
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
disease, hemochromatosis, or Helicobacter pylori infection. We have recently reported the presence of hydrophobic AAs and a number of endogenously formed adducts in human pancreatic DNA w42,44x. In this report, we have extended these studies to measure the levels of N-Ždeoxyguanosin-8-yl.-ABP ŽdGC8-ABP., a major hydrophobic adduct, in relation to cigarette smoking and we have examined the role of genetic variability in enzymes that could bioactivate or detoxify nitroaromatic hydrocarbons or AAs Ži.e., N-acetyltransferases ŽNATs., glutathione S-transferases ŽGSTs., or nitroreductases, i.e., NADŽP.H quinone reductase or NQO1 .. Although these adducts have been reported in other human tissues by different laboratories, a comparison of the levels of endogenous and exogenous adducts in the same tissue samples has not been performed. The results from our current study on hydrophobic DNA adducts are compared with recently reported data on endogenous adduct levels in human pancreas w44x; the role of these adducts in relation to carcinogenesis in the pancreas is discussed.
2. Materials and methods 2.1. Subjects, tissues, and DNA isolation Samples of grossly normal pancreas tissue were obtained through an organ procurement program. The samples were selected from 15 current smokers and 15 non- or former smokers. Information on age, race, sex, and body mass index ŽBMI. was recorded; however, complete information was not available on all tissue donors and the number of samples used for each analysis is indicated in Section 3. At procurement, organs were placed in University of Wisconsin cold storage preservation solution w45x: these were trimmed of fat, rinsed in cold saline, snap-frozen in liquid nitrogen, and stored at y808C Ž- 1–4 years.. For DNA isolation, all the tissues were thawed at the same time and nuclear pellets were prepared as described previously w44x; DNA was isolated by the method of Gupta w46x, except that 0.01% 8-hydroxyquinoline was added to the phenol as an antioxidant.
265
This method prevented the artifactual formation of 8-oxo-dG, as judged by the lack of detectable 8-oxodG in DNA isolated from anaerobic bacteria Žunpublished studies.. DNA concentrations were determined by the diphenylamine reaction w47x.
2.2. DNA adduct measurements and instrumentation
2.2.1. Hydrophobic aromatic adducts 2.2.1.1. Method I. 32 P-Postlabelling and thin-layer chromatography (TLC) separation. The 32 P-Postlabelling assays were carried out essentially as described previously w48x. Adducted nucleotides were enriched by extraction into n-butanol and then w5X32 Pxphosphorylated using 3 units of polynucleotide kinase and 160 mCi of w g-32 PxATP Ž2.3 mM. at 378C for 40 min. TLC was performed using the solvent system previously reported w49x. Adducts were visualized as dark spots on X-ray film after subjecting the TLC plates to autoradiography. Corresponding regions on the TLC plates were excised and levels of radioactivity determined by scintillation counting. Adducts were distinguished by chromatographic comparison with an ABP-modified calf thymus DNA standard obtained through the NCTRrIARC repository. The level of dG-C8-ABP in this standard had recently been estimated at 18.8 adductsr10 8 nucleotides by HPLCrelectrospray ionization mass spectrometry w50x. 2.2.1.2. Method II. 32 P-Postlabelling and HPLC separation. The 32 P-Postlabelling reactions were performed as described in Method I, but without apyrase treatment. The 32 P-labelled nucleotides were diluted in water and stored, for no longer than 24 h at y208C, until injection on HPLC. 32 P-HPLC was performed as described w51x. Briefly, the 32 P-postlabelling reaction mixture was separated by HPLC, using a 3.5 = 150 mm2 DeltaPake 5 mm C18-100A column ŽWaters Chromatography, Millipore, Milford, MA. and a New Guard RP18 pre-column for diverting normal nucleotides. Adduct separation was performed by eluting at 0.5 ml miny1 with a 70 min linear gradient of 0–35% acetonitrile in 1.2 ammonium formate, 0.4 M formic acid ŽpH 4.5..
266
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
2.2.1.3. Method III. 35S-Postlabelling and HPLC detection. DNA samples Ž200 mg of DNA in 0.1 M sodium acetate buffer pH 4.5. were digested with nuclease P1 ŽAmersham Life-Science, Cleveland, OH. at 408C for 3 h. The reaction was then stopped with 20 ml of 1 M sodium carbonate buffer ŽpH s 9.0. and placed on ice. Further hydrolysis of the DNA with phosphodiesterase and alkaline phosphatase was carried out for 3 h at 508C, resulting in digestion to nucleosides. Completion of the digestion was verified by HPLC analysis. The mixture was then subjected to ABP-specific immunoaffinity chromatography or HPLC separation to enrich for ABP– DNA adducts. The acylation reaction was performed as previously described w52x. Briefly, 35 S-TBM-NHS Ž t-butoxycarbonyl-L-w35 Sxmethionine, N-hydroxysuccinimidyl ester. ) 800 Ci mmoly1 from Amersham was dissolved in 310 ml of anhydrous pyridine, mixed and transferred to an Eppendorf tube containing cold TBM Žca. 1000-fold molar excess. and then mixed again. N X , N X-Diisopropylcarbodiimide from Aldrich Ž1.5 mlrsample. was added and the solution was allowed to set for 5 min. To each of the DNA digests, 30 ml of the 35 S-TBM labelling mix was added and incubated in a 378C water bath for 3 h with occasional mixing. The samples were evaporated to dryness and redissolved in methanol for analysis by HPLC. HPLC analysis was performed using a methanol–water based gradient as described w52x. 2.2.2. Endogenous adducts These methods and data were described in detail previously w44x. Briefly, 8-oxo-dG was measured by HPLC with electrochemical detection as described w53x, m 1G was determined by gas chromatographyrelectron capture-negative chemical ionizationrmass spectrometry w54x, and the etheno adducts, edA and edC, were estimated by immunoaffinity purification and 32 P-postlabellingrTLC w55x. 2.3. Genotyping of human pancreas DNA Polymorphisms in the NAT1, GSTM1, GSTP1, GSTT1, and NQO1 genes were determined in the same DNA samples by polymerase chain reaction–
restriction fragment length analyses using primers and conditions as described w56–59x. Since homozygous GSTM1 and GSTT1 null genotypes give no amplified products, oligonucleotide primers that amplified part of the b-globin gene were employed as a positive control in a multiplex reaction Žforward primer, 5X CAACTTCATCCACGTTCACC 3X ; reverse primer, 5X GAAGAGCCAAGGACAGGTAC 3X ..
Table 1 Summary of metabolic activities by human pancreatic microsomes and cytosolsa Major enzyme
Activitiesb
Protein detected by immunoblotting
P450 1A1 P450 1A2 P450 1B1d P450 2A6 P450 2B6 P450 2C8r9r18r19 P450 2D6 P450 2E1 P450 3A4r4r5r7 P450 4A1 Prostaglandin H synthase 4-Nitrobiphenyl nitroreduction 4-Nitrobiphenyl nitroreduction P450 reductase N-Hydroxy-ABP O-acetyltransferase ŽNAT1qNAT2. NAT1 NAT2 N-hydroxy-ABP sulfotransferase Epoxide hydrolase
y y n.d. n.d. y n.d. n.d. y y y "
n.d.c y qd y n.d. y y y y n.d. n.d.
qq Žmicrosomal. qq Žcytosolic. qq
n.d.
q qq q y
n.d. n.d. n.d. n.d.
n.d.
q
a
n.d. n.d.
This table is a summary of data previously reported w44x. Activities were determined using a series of specific substrates for the enzymes noted, for methodologic details and enzymatic rates refer to Ref. w44x. c n.d.—not determined. d Data not previously reported; CYP1B1 was detected in microsomal fractions of human pancreas using anti-peptide anti-serum Žsubmitted., CYP1B1 is strongly expressed in acinar cells of normal pancreas by in situ hybridization, while islets of Langerhans Žthe endocrine cells. and columnar cells of interlobular ducts are negative Žunpublished studies.. b
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
3. Results 3.1. Carcinogen metabolism, adduct formation and the human pancreas As with most chemical carcinogens, AAs, HAAs and nitroaromatic hydrocarbons can be metabolized to reactive electrophiles that covalently modify or ‘adduct’ DNA Žreviewed in Ref. w60x.. Therefore, in our earlier studies, we examined pancreatic tissues for their metabolic capacity to activate AAs, HAAs and nitroaromatic hydrocarbons and for the presence of hydrophobic DNA adducts w42x. The results of these studies are summarized in Table 1. Microsomal preparations showed no activity for the cytochrome P4501A2-catalyzed N-oxidation of ABP or for each of the P450s: P450 1A1; P450 2A6; P450 2B6; P450 2D6; P450 2E1; P450 3A4; and P450 4A1. Immunoblots detected only epoxide hydrolase and P450 1B1 at low levels; P450 levels were - 1% of liver.
267
4-Nitrobiphenyl reductase activities were present in pancreatic cytosols and microsomes at levels comparable to human liver. The O-acetyltransferase activity Žpredominantly NAT1. of pancreatic cytosols was at high levels, comparable to about two-thirds the levels previously measured in human colon. Next, we examined the same set of pancreatic tissues for the presence of hydrophobic DNA adducts from AAs. Putative PAH Žnuclease P1 enriched.and AA Ž n-butanol enriched.-DNA adducts were detected in these pancreas tissues using standard 32 P-postlabelling techniques. The PAH-like adducts were observed only in current smokers, while the AA-like adducts were present in nearly all the samples. Total hydrophobic adduct levels ranged from about 1 to 100 adductsr10 8 nucleotides. In this initial study of the hydrophobic DNA adducts, it was noted that several of the samples appeared to have adducts that co-migrated with the major ABP–DNA adduct, dG-C8-ABP. These results supported our initial hypothesis that metabolic activation of
Fig. 1. ŽPanel A. 32 P-HPLC chromatograms showing co-migration of DNA adducts detected in human pancreas DNAa 42, ŽPanel B. human pancreas DNAa 42 spiked with an ; equal amount of 32 P-postlabelled ABP-modified calf thymus DNA ŽPanel B.. The TLC autoradiogram for human pancreas sample a 42 is shown in the upper right corner of Panel A. Note: increased radioactivity is seen in peaks detected at 56–57 minutes, 61.5–62.5 minutes, 63–64 minutes, and 68–69 minutes in sample 42 spiked with the ABP-modified DNA.
268
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
Fig. 2. 32 P-HPLC chromatograms ŽPanel A. and UV Spectral Detection ŽPanel B. of DNA adducts detected in the human pancreas DNAa X X 42 co-injected with the w3 Hx-dG-C8-ABP-3 ,5 bisŽphosphate. standard. UV spectra of the standard is shown in the inset of Panel B. 3 Radioactivity attributed to the H-ABP-DNA adduct standard is - 550 dpm and does not contribute significantly to the radioactivity in peak detected in Panel A.
carcinogenic AAs, PAHs, and nitroaromatic hydrocarbons, along with carcinogen–DNA adduct forma-
tion, may be involved in the etiology of human pancreatic cancer.
Table 2 Human pancreas samples positive for the dG-C8-ABP adduct by three methodologiesa
dG-C8-ABPqr total tested Žmedian; range. a
Method I 32 P-PLbrTLC
32
Method II P-PLrHPLC
Method III 35 S-PLrHPLC
Method II and III 32 P-PLrHPLC q35 S-PLrHPLC
17 cr29 Ž1.9; 0.66–5.7.
9 dr29 Ž0.9; 0.08–6.1.
6 er29 Ž1.1; 0.9–1.5.
5 fr29 Ž1.2; 0.9–6.1 vs. 1.1; 0.9–1.2.
Refer to Section 2 for detailed methodology. PL s postlabelling. c Seventeen pancreas DNA samples had adduct spots co-migrating on TLC plates with ABP modified calf thymus DNA; median and range are shown as adducts per 10 7 nucleotides. d Nine pancreas DNA samples had adduct peaks co-migrating with the unlabelled adduct standard in at least two postlabelling reactions. Five DNA samples appeared positive in a single labelling reaction. The median adduct level and range of these nine samples are indicated as adducts per 10 7 nucleotides. e Six pancreas DNAs had adduct peaks that co-migrated with the ABP–DNA adduct standard in a linear response study using 35 S-acylation labelling method. This included three separate labelling reactions at 50 mg, 100 mg and 150 mg of DNA with ABP-specific immunoaffinity enrichment and HPLC separation. Like the 32 P-postlabelling results, five DNA samples appeared positive in a single labelling. Median adduct levels and range are shown per 10 7 nucleotides. f Five pancreas DNA samples co-migrated with the dG-C8-ABP standard in both Method II and Method III wone sample was not available for 32 P-postlabelling analysisx in three separate experiments. The median adduct levels and range are shown per 10 7 nucleotides for each of the independent methodologies. Though deviation from the median was less using the 35 S-labelling method, relatively equivocal adduct levels were noted at ; 1 adductr10 7 nucleotides. b
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
3.2. Presence of the major ABP–AA adduct in human pancreas By combining the use of 32 P- and 35 S-postlabelling techniques, along with HPLC and TLC separation methodologies, we have sought to verify the presence of the major ABP–DNA adduct, dG-C8ABP, as suspected from our previous study in this tissue. Similar to our previous report w42x, in a separate set of 30 pancreas DNA samples, the presence of putative hydrophobic PAH– and AA–DNA adducts, were detected at levels comparable to those reported using the standard 32 P-postlabellingrTLC separation method I Ždescribed in Section 2.. By comparing data from the postlabelling methods II and III, 5 out of 29 pancreas samples were identified as positive in multiple repeat measurements for the presence of the major ABP–DNA adduct and an additional four samples showed positivity using one of the methods using duplicate measurements. Representative data are shown in Fig. 1, panels A–B, and co-migration studies with UV detectable 3 Hlabelled dG-C8-ABP standard are shown in Fig. 2. These results are summarized in Table 2. 3.3. Smoking, metabolic genotype and the presence of the dG-C8-ABP adducts in human pancreas On the same set of DNAs that were used to determine ABP–DNA adduct levels, NQO1 , GSTM1, GSTT1 and NAT1 genotypes were determined in order to assess the role of their gene products in detoxification or bioactivation for the major dG-C8ABP adduct. Though the sample set was small, all 10 of the ABP adduct-positive samples by either method had the slow NAT1)4r)4 slow acetylator genotype, as compared to only 3r19 adduct-negative samples, which was statistically significant Ž X 2 s 18.9, df s 2, p - 0.001.. There was no correlation between adducts and genotypes for GSTT1, GSTM1, GSTP1 or NQO1. The presence of the ABP adduct was not significantly correlated with smoking, age or BMI. It should be noted, however, that among individuals with adducts, the levels of adducts were one order of magnitude higher in smokers than in nonsmokers. These data are summarized in Table 3 and suggest that NAT1 may play an important role in the detoxification of AAs in human pancreas. Further,
269
these data support cigarette smoking as a potential source for AA exposure in the pancreas. A role for polymorphisms in NAT2 is predicted; however, due to sheering of DNA specimens from repeated freezing and thawing, approaches to genotype NAT2 late in the study were proven unsuccessful. A model, depicting a mechanism for AA metabolism and adduct formation in the pancreas, is shown in Fig. 3. 3.4. Endogenous DNA adduct formation, metabolic genotype and the human pancreas We have recently reported on the relative levels of the endogenous DNA adducts in these same tis-
Table 3 Characteristics of pancreas tissue donors with and without dG-C8ABP adductsa
Smoking b Adduct level Non-smokers Ž ns 5. Smokers Ž ns 5.
Adducts—yes Ž ns10.
Adducts—no Ž ns 20.
5r10 Ž50%.
10r20 Ž50%.
0.22 " 0.11r10 7 2.19q2.19r10 7 Adducts—yes Ž ns10.
Genotype c NAT1)4r)4 10 Ž100%. NAT1)4rNAT1)10 0 NAT1)10r)10 0 Ž X 2 s18.75, df s 2, p- 0.001.
NAT1 activity d Žnmol miny1 mgy1 protein. Non-smokers Ž ns 5. Smokers Ž ns 5. a
Adducts—no Ž ns19. 3 Ž10%. 11 5
Adducts—yes Žn s10.
Adducts—no Žn s 20.
0.55"0.26
0.40 " 0.22
0.59 " 0.27 0.51 " 0.28
Data is presented for samples positive for dG-C8-ABP adduct by either 32 P-postlabelling or 35 S-postlabelling methodologies Ž ns 10.. b Smoking status was unavailable for one sample that showed no adducts. c Genotype data could not be determined for 1 of the 30 samples decreasing available genotype data to 29 total samples. d NAT1 activity was determined using assay p-aminobenzoic acid under assay conditions shown to be selective for NAT1 w44x.
270
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
4.2. Metabolic genotype and exogenous DNA adduct formation
Fig. 3. Possible metabolic pathways for ABP–DNA adduct formation in the human pancreas.
sues used to measure hydrophobic DNA adduct levels w43x. The highest adduct levels observed were for m 1G, followed by 8-oxo-dG, edA, and edC, but there were no differences in adduct levels between smokers and non-smokers and no correlation was found when comparing age, sex or BMI between the subjects. Moreover, there was no correlation in adduct levels between edA and eC, or between edA or edC and m 1G or 8-oxo-dG. However, there was a significant correlation Ž r s 0.76; p - 0.01. between the levels of 8-oxo-dG and m 1G in the DNA. Neither GSTM1 nor NQO1 genotypes were associated with differences in any of the adduct levels.
4. Discussion 4.1. Chemical carcinogenesis, cigarette smoking and DNA adduct formation The presence of putative PAH adducts in smokers vs. non-smokers strongly suggest smoking as the exogenous source for these PAH adducts. The elevated levels of the ABP–DNA adducts in smokers vs. non-smokers is consistent with smoking as a potential source of AA in the human pancreas. Although cigarette smoking may be contributing to the levels of exogenous DNA adduct formation in this limited sampling of the human pancreas, the data suggest that endogenous DNA adduct formation is not strongly associated with smoking.
In this series of samples we noted that all five samples, confirmed positive for the dG-C8-ABP-like adduct using both methodologies, and all 10 samples positive for dG-C8-ABP by 32 P- or 35 S-postlabellingrHPLC were homozygous NAT1)4r)4 genotypes. These results indicate that the slow acetylation genotype may increase the presence of this adduct in the pancreas. This is in contrast to our original model w42x, where we predicted that tissue-specific NATcatalyzed O-acetylation of the N-hydroxy-AAs would be an important determinant of adduct formation w43x. However, in this set of pancreas specimens it should be noted that the genotype for NAT1 did not correlate with the phenotype. Furthermore, in the activity assays for PABA NAT1 activity, the mean activity is equal to or slightly higher for the 10 samples positive for dG-C8-ABP than the other samples. This same lack of correlation of activity with genotype has recently been discussed and suggests that our current understanding of the rapid and slow NAT1 acetylation polymorphism may be incomplete w61x. An alternative explanation for the role of NAT1 activity is shown in Fig. 3. With the overall low metabolic activity of the pancreas compared to the liver and colon ŽTable 1., we suspect that the important bioactivation andror detoxification steps for the parent compounds to reactive intermediates is taking place in these tissues. Thus, the exposure of the pancreas to these reactive species would be dependent upon extra-pancreatic metabolic pathways and subsequent exposure of the pancreas. 4.3. Other sources of chemical carcinogenesis in human pancreas As noted in Table 2, we have frequently detected ABP-like adducts in numerous samples by both methodologies. When we compare smoking status with samples determined positive for ABP-adduct in at least one assay, we see no correlation. We suspect that AA-adducts may result from the diet andror environmental exposures to AAs or nitroaromatic hydrocarbons. Although NQO1 genotype was not associated with ABP–DNA adduct levels, there are multiple enzymes that exhibit nitroreductase activity
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
w62x. However, we have no means to address the issue of dietary or environmental exposure to AAs or nitroaromatics in this study of pancreatic tissues where we were limited by sample size and lack of donor information. It is clear that, in the pancreas, there is a high degree of background hydrophobic adducts that may be the result of multiple sources of exposures andror slow cell turnover. These background adducts do not appear to correlate with smoking, age, sex, or BMI. Identifying the sources of these ‘background’ adducts may be extremely important in developing future questions regarding specific dietary and environmental exposures contributing to the etiology of pancreatic carcinogenesis.
271
hyde derived from lipid peroxidation may not be contributing significantly to m 1G adduct formation. On the other hand, the apparent correlation between m 1G and 8-oxo-dG and their comparable high levels are consistent with the hypothesis that m 1G is formed primarily by reaction of DNA with a base propenal, which, like 8-oxo-dG, is thought to be derived from hydroxyl radical attack on the DNA. Alternatively, these data may reflect small sample numbers andror simply be indicative of the mechanism of how adducts from endogenous reactive species are formed andror repaired. In addition, the correlation between m 1G and 8-oxo-dG adduct levels and their lack of correlation with the etheno adduct levels indicate that the direct reaction of reactive oxygen species, such as the hydroxyl radical, with DNA may be the primary cause of endogenous DNA adduct formation in the pancreas, rather than lipid peroxidation.
4.4. Source of endogenous adducts Neither cigarette smoking, sex, age nor BMI were associated with differences in endogenous adduct levels, suggesting that none of these factors significantly affect oxidative stress, redox cycling or lipid peroxidation in our set of human pancreas samples w44x. This was in contrast to the results recently reported by Wang et al. w43x who demonstrated a correlation between both BMI and smoking with the endogenous adducts detected in their pancreas samples. In our study, the lack of correlation between m 1G and edA or edC, indicate that the malondialde-
4.5. Metabolic genotype and endogenous DNA adduct leÕels Although the sample set was limited, the data suggest that endogenous DNA adduct formation in human pancreas is not clearly derived from NQO1mediated redox cycling. Further, it appears that neither GSTM1 nor GSTT1 appreciably protects against endogenous adduct formation. If m 1G had correlated
Table 4 Comparative summary of exogenous and endogenous adduct levels in human pancreasa Adduct type
Adduct qr total tested
Method of determinationb
Median wrangex levelr 10 7 nucleotides
Total hydrophobic adduct levels ABP-adduct ABP-adduct edA edC 8-oxo-dG m 1dG q edA levels in ABPq samplesb
29r29 9r29 6r29 28r28 27r27 28r28 13r27 8r8 6r6 8r8 b 6r6 7r8 b 5r5 b
32
3.0 w0.66–9.0x 0.9 w0.08–6.1x 1.1 w0.9–1.5x 0.11 w0.03–0.56x 0.09 w0.01–0.46x 1.8 w0.9–4.2x 1.9 w1.1–4.2x 0.10 w0.05–0.29x 0.09 w0.06–0.28x 0.09 w0.04–0.31x 0.11 w0.04–0.31x 1.8 w1.1–2.1x 1.5 w1.1–1.8x
edC level in ABPq samples 8-oxo-dG in ABPq samples a b
P-PLrTLC P-PLrHPLC 35 S-PLrHPLC Ref. w42x Ref. w42x Ref. w42x Ref. w42x 32 P-PLrHPLC 35 S-PLrHPLC 32 P-PLrHPLC 35 S-PLrHPLC 32 P-PLrHPLC 35 S-PLrHPLC 32
Refer to Ref. w42x for complete analysis of endogenous adduct levels in these tissues. Refer to Table 2 and Section 2. PL s postlabelling.
272
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
with etheno adduct levels, then the opposite conclusion might be inferred since etheno adducts are thought to be derived primarily from products of lipid peroxidation. The former assessment is consistent with the hypothesis that 8-oxo-dG and m 1G both arise from hydroxyl radical attack on DNA, with 8-oxo-dG being formed by reaction with guanine and m 1G by reaction with the 2X-deoxyribose, resulting in a reactive base propenal that subsequently reacts with guanine w63x. This hypothesis is also consistent with the lack of an effect of the GSTM1 genotype on m 1G and other endogenous adduct levels measured here. Both GSTM1 and GSTP1 are expressed in the pancreas w64x; however, GSTP1 but not GSTM1 catalyzes the detoxification of base propenals, while GSTM1 and GSTT1 is more active with hydroxyalkenals Žproducts of lipid peroxidation. w65x. 4.6. Endogenous Õs. exogenous adduct formation and pancreatic cancer Smoking and high meat intake increase pancreatic cancer risk and this could be due to aromatic carcinogens that form hydrophobic aromatic DNA adducts as discussed above Žreviewed in Ref. w22x.. BMI has not been consistently associated with increased pancreas cancer risk in epidemiological studies; however, high energy intake and chronic pancreatitis have been associated with increased risk, perhaps by increasing free radical generation and endogenous DNA adduct formation in the pancreas. Our data indicate that the human pancreas is subject to multiple exposures that may account for DNA adduct formation and subsequent carcinogenesis in the human pancreas. In this limited data set, there did not appear to be any correlation between the total hydrophobic adducts and total endogenous adducts nor was there any apparent relationship between the levels of the ABP adduct and any of the specific endogenous adducts measured ŽTable 4.. The mechanisms and individual susceptibilities giving rise to the adducts detected in the human pancreas are not yet clear. Nevertheless, our data support the hypothesis that both endogenous and exogenous exposures contribute to adduct formation in the human pancreas, perhaps explaining the impact of diet and smoking on the risk of cancer formation in this tissue. It is evident that molecular epidemiological
studies are needed to address these hypotheses of particular interest including dietary sources of AAs, heterocyclic amines, PAHS and nitroaromatic hydrocarbons Ži.e., pan frying or grilling of meats., and antioxidants Žthrough vegetable and fruit consumption.; the impact of oxidative stress Žthrough high caloric intake or chronic disease.; and the role of metabolic polymorphisms in the generation of these reactive species. References w1x L.A. Nordlund, J.M. Carstensen, P. Pershagen, Cancer incidence in female smokers—a 26 year follow up, Int. J. Cancer 73 Ž1997. 625–628. w2x D. Hoffman, I. Hoffman, The changing cigarette, 1950–1995, J. Toxicol. Environ. Health 50 Ž1997. 307–364. w3x R. Doll, Cancers weakly related to smoking, Br. Med. Bulletin. 52 Ž1996. 35–49. w4x W.C. Willet, Diet, nutrition and avoidable cancer, Environ. Health Perspect. 103 Ž1995. 165–170. w5x W.R. Fair, N.E. Fleshner, W. Heston, Cancer of the prostate: a nutritional disease?, Urology 50 Ž1997. 840–848. w6x A. Schatzkin, Dietary changes as a strategy for preventing cancer, Cancer and Metastasis 16 Ž1997. 377–392. w7x E. Giovannucci, B. Goldin, The role of fat, fatty acids and total energy intake in the etiology of human colon cancer, Am. J. Clin. Nutr. 66 Ž1997. 1564S–1571S. w8x M. Poirier, A. Weston, Human DNA adduct measurements: state of the art, Environ. Health Perspect. 10S45 Ž1996. 883–893. w9x K.R. Kaderlik, F.F. Kadlubar, Metabolic polymorphisms and carcinogen–DNA adduct formation in human populations, Pharmacogenetics 5 Ž1995. S108–S117. w10x J.D. Potter, K. Steinmetz, Vegetables, fruit and phytoestrogens as preventive agents, IARC Scientific Publications 139 Ž1996. 61–90. w11x S. Loft, H.E. Poulsen, Cancer risk and oxidative DNA damage in man, J. Mol. Med. 74 Ž1996. 297–312. w12x F.-L. Chung, H.-Y.C. Chen, R.G. Nath, Lipid peroxidation as a potential endogenous source for the formation of exocyclic DNA adducts, Carcinogenesis 17 Ž1996. 2105–2111. w13x J. Nair, C.E. Vaca, I. Velic, M. Mutanen, L.M. Valsta, H. Bartsch, High dietary v-6 polyunsaturated fatty acids drastically increase the formation of etheno adducts in white blood cells of female subjects, Cancer Epidemiol., Biomarkers Prev. 6 Ž1997. 597–601. w14x S.P. Fink, G.R. Reddy, L.J. Marnett, Mutagenicity in Escherichia coli of the major DNA adduct derived from the endogenous mutagen malondialdehyde, Proc. Natl. Acad. Sci. U.S.A. 94 Ž1997. 8652–8657. w15x J.A. Swenberg, D.K. La, N.A. Scheller, K.Y. Wu, Dose–response relationship for carcinogens, Toxicol. Lett. 82–83 Ž1995. 751–756. w16x M. Wang, K. Dhingra, W.N. Hittelman, J.G. Liehr, M. de
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
w17x
w18x
w19x
w20x
w21x w22x
w23x
w24x
w25x
w26x
w27x w28x
w29x w30x w31x
w32x
Andrade, D. Li, Lipid peroxidation-induced malondialdehyde adducts in human breast tissues, Cancer Epidemiol. Biomarkers Prev. 5 Ž1996. 705–710. S.-C. Baik, H.-S. Youn, M.-H. Chung, W.-K. Lee, M.-J. Cho, G.-H. Ko, C.-K. Park, H. Kasai, K.-H. Rhee, Increased oxidative DNA damage in Helicobacter pylori-infected human gastric mucosa, Cancer Res. 56 Ž1996. 1279–1282. S. Asami, H. Manabe, J. Miyake, Y. Tsurodome, T. Hirano, R. Yamaguchi, H. Itoh, H. Kasai, Cigarette smoking induces an increase in oxidative DNA damage, 8-hydroxydeoxyguanosine, in a central site of the human lung, Carcinogenesis 18 Ž1997. 1763–1766. B. Marczynski, P. Rozynek, H.-J. Elliehausen, M. Korn, X. Bauer, Detection of 8-hydroxydeoxyguanosine, a marker of oxidative DNA damage, in white blood cells of workers occupationally exposed to styrene, Arch. Toxicol. 71 Ž1997. 496–500. H. Daube, G. Scherer, K. Riedel, T. Ruppert, A.R. Tricker, P. Rosenbaum, F. Adlkofer, DNA adducts in human placenta in relation to tobacco smoke exposure and plasma antioxidant status, J. Cancer Res. Clin. Oncol. 123 Ž1997. 141–151. P.A. Wingo, T. Tong, S. Bolden, Cancer statistics, 1995, CA Cancer J. Clin. 45 Ž1995. 8–30. K.E. Anderson, J.D. Potter, T. Mack, Pancreas, in: D. Schottenfeld, J. Fraumeni ŽEds.., Cancer Epidemiology and Prevention, 2nd edn., Oxford Univ. Press, New York, 1996, pp. 725–771. J.P. Durbec, G. Chevillotte, J.M. Bidart, P. Berthezene, H. Sarles, Diet, alcohol, tobacco and risk of cancer of the pancreas: a case-control study, Br. J. Cancer 47 Ž1983. 467–470. T.M. Mack, M.C. Yu, R. Hanisch, B.E. Henderson, Pancreas cancer and smoking, beverage consumption and past medical history, JNCI 76 Ž1986. 49–60. R.T. Falk, L.W. Pickle, E.T. Fontham, P. Correa, J.F. Fraumeni, Life-style risk factors for pancreatic cancer in Louisiana: a case-control study, Am. J. Epidemiol. 128 Ž1988. 324–336. G.W. Olsen, J.S. Mandel, R.W. Gibson, L.W. Wattenberg, L.M. Schuman, A case-control study of pancreatic cancer and cigarettes, alcohol, coffee and diet, Am. J. Public Health 79 Ž1989. 1016–1019. T. Hirayama, Epidemiology of pancreatic cancer in Japan, Jpn. J. Clin. Oncol. 19 Ž1989. 208–215. H.B. Bueno de Mesquita, P. Maisonneuve, C.J. Moerman, S. Runia, P. Boyle, Life-time history of smoking and exocrine carcinoma of the pancreas: a population-based case-control study in The Netherlands, Int. J. Cancer 49 Ž1991. 816–822. D.C. Farrow, S. Davis, Diet and risk of pancreatic cancer in men, Am. J. Epidemiol. 132 Ž1990. 423–431. F. Pietri, F. Clavel, Occupational exposure and cancer of the pancreas: a review, Br. J. Ind. Med. 48 Ž1991. 583–587. T.F. Mancuso, A.A. El-Attar, Cohort study of workers exposed to betanaphathylamine and benzidine, J. Occup. Med. 9 Ž1967. 277–285. F.P. Li, J.F. Fraumeni Jr., N. Mantel, R. Miller, Cancer mortality among chemists, JNCI 43 Ž1969. 1159–1164.
273
w33x T.M. Mack, Pancreas, in: D. Schottenenfeld, J.F. Fraumeni, Jr. ŽEds.., Cancer Epidemiology and Prevention, Saunders, PA, 1982, pp. 638–667. w34x R.T. Falk, L.W. Pickle, E.T. Fontham, P. Correa, A. Morse, V. Chen, J.J. Fraumeni Jr., Occupation and pancreatic cancer risk in Louisiana, Am. J. Ind. Med. 18 Ž1990. 565–576. w35x R.K. Kaderlik, D.-X. Lin, M.D. Friesen, H. Bartsch, K.E. Anderson, J.D. Potter, N.P. Lang, F.F. Kadlubar, Human biomonitoring of arylamine–DNA adducts in human colon and pancreas tissues ŽAbstract a907.. Proc. Am. Assoc. Cancer Res. 34, 1993. w36x J.H. Weisburger, Heterocyclic amines in cooked foods: possible human carcinogens. ŽMeeting report., Cancer Res. 53 Ž1993. 2422–2424. w37x C. Patrianakos, D. Hoffman, Chemical studies on tobacco smoke LXIV. On the analysis of aromatic amines in cigarette smoke, J. Anal. Toxicol. 3 Ž1979. 150–159. w38x A.C. Austin, L.D. Claxton, J. Lewtas, Mutagenicity of the fractionated organic emission from diesel, cigarette smoke condensate, coke oven and roofing tar in the Ames assay, Environmental Mutagenesis 7 Ž1985. 471–487. w39x Council on Scientific Affairs, J. Am. Med. Assoc. 260 Ž1988. 959–966. w40x P.A. Schulte, K. Ringen, G.P. Hemstreet, E. Ward, Occup. Med. ŽState of the Art Rev.. 2 Ž1987. 85–107. w41x R.C. Garner, C.N. Martin, D.B. Clayson, in: C.E. Searle ŽEd.., Chemical Carcinogens, American Chemical Society Monograph No. 182, American Chemical Society, Washington, DC, 2nd edn., Vol. 1, 1984, pp. 175–27. w42x F.F. Kadlubar, K.E. Anderson, N.P. Lang, P.A. Thompson, S.L. MacLeod, M.W. Chou, M. Mikhailova, J. Plastara, L.J. Marnett, S. Haussermann, J. Nair, I. Velic, H. Bartsch, ¨ Comparison of DNA Adduct Levels Associated with Oxidative Stress in Human Pancreas, Mutation Research 405 Ž1998. 125–133. w43x M. Wang, J.L. Abbruzzese, H. Friess, W.N. Hittelman, D.B. Evans, M.C. Abbruzzese, P. Chiao, D. Li, DNA adducts in human pancreatic tissues and their potential role in carcinogenesis, Cancer Res. 58 Ž1998. 1–87. w44x K.E. Anderson, G.J. Hammons, F.F. Kadlubar, J.D. Potter, K.R. Kaderlik, K.F. Ilett, R.F. Minchin, C.H. Teitel, H.-C. Chou, M.V. Martin, F.P. Guengerich, G.W. Barone, N.P. Lang, L.A. Peterson, Metabolic activation of aromatic amines by human pancreas, Carcinogenesis 18 Ž1997. 1085–1092. w45x F.O. Belzer, J.H. Southard, Principles of solid-organ preservation by cold storage, Transplantation 45 Ž1988. 673–676. w46x R.C. Gupta, Nonrandom binding of the carcinogen N-hydroxy-2-acetylaminofluorene to repetitive sequences of rat liver DNA in vivo, Proc. Natl. Acad. Sci. U.S.A. 81 Ž1984. 6943–6947. w47x K. Burton, Determination of DNA concentration with diphenylamine, Meth. Enzymol. 12B Ž1968. 163–169. w48x R.C. Gupta, M.V. Reddy, K. Randerath, 32 P-postlabeling analysis of non-radioactive aromatic carcinogen–DNA adducts, Carcinogenesis 3 Ž1982. 1081–1092. w49x D.-X. Lin, J.O. Lay, M.S. Bryant, C. Malaveille, M. Friesen, H. Bartsch, N.P. Lang, F.F. Kadlubar, Analysis of 4-amino-
274
w50x
w51x
w52x
w53x
w54x
w55x
w56x
w57x
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274 biphenyl–DNA adducts in human urinary bladder and lung by alkaline hydrolysis and negative ion gas chromatographyrmass spectrometry, Environ. Health Perspect. 102S6 Ž1994. 11–16. F.B. Beland, D.R. Doerge, M.I. Churchwell, M.C. Poirier, B. Schoket, M.M. Marques, Synthesis, characterization, and quantitation of a 4-aminobiphenyl DNA adduct standard, Chem. Res. Toxicol. 12 Ž1. Ž1999. 68–77. M. Zeisig, L. Moller, 32P-HPLC suitable for characterization of DNA adducts formed in vitro by polycyclic aromatic hydrocarbons and derivatives, Carcinogenesis 16 Ž1995. 1–9. F.Z. Sheabar, M.L. Morningstar, G.N. Wogan, Adduct detection by acylation with w35 Sx methionine: analysis of DNA adducts of 4-aminobiphenyl, Proc. Natl. Acad. Sci. U.S.A. 91 Ž1994. 1696–1700. M.V. Mikhailova, N.A. Littlefield, B.S. Hass, L.A. Poirier, M.W. Chou, Cadmium-induced 8-hydroxyguanosine formation, DNA strand breaks and antioxidant enzyme activities in lymphoblastoid cells, Cancer Lett. 115 Ž1997. 141–148. C.A. Rouzer, A.K. Chaudhary, M. Nokubo, D.M. Ferguson, G.R. Reddy, I.A. Blair, L.J. Marnett, Analysis of the malonX dialdehyde-2 -deoxyguanosine adduct pyrimidopurine in human leucocyte DNA by gas chromatographyrelectron capturernegative chemical ionizationrmass spectrometry, Chem. Res. Toxicol. 10 Ž1997. 181–188. J. Nair, A. Barbin, Y. Guichard, H. Bartsch, 1, N 6-Ethenodeoxyguanosine and 3, N 4-ethenodeoxycytidine in liver DNA from humans and untreated rodents detected by immunoaffinityr32 P-postlabelling, Carcinogenesis 16 Ž1995. 613–617. D.A. Bell, A.F. Badawi, N.P. Lang, K.F. Ilett, F.F. Kadlubar, A. Hirvonen, Polymorphism in the N-acetyltransferase 1 ŽNAT1. polyadenylation signal: association of NAT1)10 allele with higher N-acetylation activity in bladder and colon tissue, Cancer Res. 55 Ž1995. 5226–5229. M. Arand, R. Muhlbauer, J. Hengstler, E. Jager, J. Fuchs, L. ¨ Winkler, F. Oesch, A multiplex polymerase chain reaction
w58x
w59x
w60x
w61x
w62x
w63x
w64x
w65x
protocol for the simultaneous analysis of the glutathione S-transferase GSTM1 and GSTT1 polymorphisms, Anal. Biochem. 236 Ž1996. 184–186. E.A. Rosvold, K.A. McGlynn, E.D. Lustbader, K.H. Buetow, Identification of an NADŽP.H:quinone oxidoreductase polymorphism and its association with lung cancer and smoking, Pharmacogenetics 5 Ž1995. 199–206. F. Ali-Osman, A. Olanike, G. Antoun, J.-X. Mao, J. Buolamwini, Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants, J. Biol. Chem. 272 Ž1997. 10004–10012. F.A. Beland, F.F. Kadlubar, Formation and persistence of arylamine DNA adducts in vivo, Environ. Health Perspect. 62 Ž1985. 19–30. D.M. Grant, N.C. Hughes, S.A. Janezic et al., Human acetyltransferase polymorphisms, Mutation Research 376 Ž1997. 61–70. K.F. Ilett, D.M. Ingram, D.S. Carpenter, C.H. Teitel, N.P. Lang, F.F. Kadlubar, R.F. Minchin, Expression of monomorphic and polymorphic N-acetyltransferases in human colon, Biochem. Pharmacol. 47 Ž1994. 914–917. P.C. Dedon, J.P. Plastaras, C.A. Rouzer, L.J. Marnett, Indirect mutagenesis by oxidative damage: formation of a pyrimidopurine adduct by base propenals. Chem. Res. Toxicol., in press. D.A. Bell, J.A. Taylor, D.F. Paulson, C.N. Robertson, J.L. Mohler, G.W. Lucier, Genetic risk and carcinogen exposure: a common inherited effect of the carcinogen metabolism gene glutathione S-transferase M1 ŽGSTM1. that increases susceptibility to bladder cancer, J. Natl. Cancer Inst. 85 Ž1993. 1159–1164. ˚ Engstrom, J.W. Kozarich, B. K. Berhane, M. Widersten, A. Mannervik, Detoxication of base propenals and other a ,bunsaturated aldehyde products of radical reactions and lipid peroxidation by human glutathione transferases, Proc. Natl. Acad. Sci. USA, 1994, pp. 1480–1484.
Comparison of DNA adduct levels associated with exogenous and endogenous exposures in human pancreas in relation to metabolic genotype P.A. Thompson a,) , F. Seyedi b, N.P. Lang c,d , S.L. MacLeod d , G.N. Wogan e, K.E. Anderson e, Y.-M. Tang a , B. Coles a , F.F. Kadlubar a a
DiÕision of Molecular Epidemiology, National Center for Toxicological Research (HFT-100), 3900 NCTR Rd., Jefferson, AR 72079, USA b Massachusetts Institute of Technology, Boston, MA 02139, USA c John L. McClellan Memorial Medical Center, Little Rock, AR 72205, USA d Arkansas Cancer Research Center, Little Rock, AR 72205, USA e UniÕersity of Minnesota, Minneapolis, MN 55454, USA Accepted 17 September 1998
Abstract Recently, we examined normal human pancreas tissue for DNA adducts derived from either exogenous chemical exposure andror endogenous agents. In an effort to explain the different types and levels of DNA adducts formed in the context of individual susceptibility to cancer, we have focused on gene–environment interactions. Here, we report on the levels of hydrophobic aromatic amines ŽAAs., specifically those derived from 4-aminobiphenyl ŽABP., and DNA adducts associated with oxidative stress in human pancreas. Although these adducts have been reported in several human tissues by different laboratories, a comparison of the levels of these adducts in the same tissue samples has not been performed. Using the same DNA, the genotypes were determined for N-acetyltransferase 1 ŽNAT1., the glutathione S-transferase ŽGST. M1, GSTP1, GSTT1, and NADŽP.H quinone reductase-1 ŽNQO1 . as possible modulators of adduct levels because their gene products are involved in the detoxification of AAs, lipid peroxidation products and in redox cycling. These results indicate that ABP–DNA adducts, malondialdehyde–DNA adducts, and 8-oxo-2X-deoxyguanosine Ž8-oxo-dG. adducts are present at similar levels. Of the metabolic genotypes examined, the presence of ABP–DNA adducts was strongly associated with the putative slow NAT1)4r)4 genotype, suggesting a role for this pathway in ABP detoxification. q 1999 Elsevier Science B.V. All rights reserved. Keywords: Aromatic amine; DNA adduct; Pancreas; Oxidative damage; Lipid peroxidation
X
X
Abbreviations: 8-oxo-dG, 8-oxo-2 -deoxyguanosine; m 1G, pyrimidow1,2-a xpurin-10Ž3 H .-one; edA, 1, N 6-etheno-Ž2 -deoxy.adenosine; X edC, 3, N 4-ethenoŽ2 -deoxy.cytidine; NAT1, N-acetyltransferase 1; GST, glutathione S-transferase; NQO1 , NADŽP.H quinone reductase-1; BMI, body mass index as kg my2 ; ABP, 4-aminobiphenyl; dG-C8-ABP, N-deoxyguanosin-8-yl-ABP; HPLC, high-pressure liquid chromatography; PCR, polymerase chain reaction; PL, postlabelling; TLC, thin-layer chromatography; AA, aromatic amine ) Corresponding author. Tel.: q1-870-543-7396; Fax: q1-870-543-7773; E-mail: [email protected] 0027-5107r99r$ - see front matter q 1999 Elsevier Science B.V. All rights reserved. PII: S 0 0 2 7 - 5 1 0 7 Ž 9 9 . 0 0 0 2 4 - X
264
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
1. Introduction Cancers of several human tissues have been associated with a number of common risk factors. Smoking has been associated with numerous cancers, particularly lung and the upper respiratory tract, and urinary bladder, as well as pancreas Žreviewed in Refs. w1–3x.. The role of diet is thought to be a major modifier of cancer risk in target tissues such as the colon, breast and prostate w4–7x. In each of these tissues, the presence of hydrophobic DNA adducts derived from aromatic amines ŽAAs., heterocyclic amines ŽHAAs. and polycyclic aromatic hydrocarbons ŽPAHs. has been demonstrated Žreviewed in Ref. w8x.. Numerous environmental sources can account for these exposures including cigarette smoke, fossil fuel products, and high temperature cooked meats. The tissue-specific expression of enzymes capable of metabolically activating or detoxifying these exogenous compounds has been correlated with specific DNA adduct levels. This evidence suggests a mechanism for these etiologic agents in DNA damage and cancer induction Žreviewed in Ref. w9x.. In addition to these exogenous sources of carcinogens, the consistent finding that diets low in vegetable and fruit intake increase the risk for a number of cancers is consistent with the view that low antioxidant levels with resultant endogenously-derived oxidative DNA damage has a role in carcinogenesis Žreviewed in Refs. w10,11x.. A number of DNA adducts that arise following oxidative damage or lipid peroxidation have been detected in human tissues including brain, placenta, prostate, oral and gastric mucosa, lung, breast, kidney, and colon mucosa Žreviewed in Refs. w10–20x.. The presence of these endogenous adducts suggest that mutagenic damage to DNA, with the potential to initiate or promote carcinogenesis, may be a direct result of the normal processes of cellular respiration, lipid peroxidation and aging. Cancer of the pancreas is the fifth leading cause of cancer mortality in the United States, with about 28,000 deaths expected per year w21x. Other than advanced age, cigarette smoking is the most consistently reported risk factor Žreviewed in Ref. w22x.. Relative risk estimates for smoking are around twofold with higher estimates reported for heavy smokers. Other risk factors include high consumption of
cooked fish and meat w23–29x, low vegetable and fruit consumption w10,22x, some occupational exposures and chronic pancreatitis w30–34x. These risk factors indicate a role for endogenous andror exogenous exposures in pancreatic cancer and prompted us to examine the levels and types of adducts formed in this tissue as a means of identifying carcinogens and metabolic enzymes that may contribute to the etiology of pancreatic cancer. Common links among the risk factors for pancreas cancer may be exposures to exogenous compounds such as AAs, heterocyclic amines and nitroaromatic hydrocarbons that form DNA adducts. Epidemiologic data indicate that some of these agents may be carcinogenic to the human pancreas Žreviewed in Refs. w22,31,35,36x.. About 30 AAs, including 2-naphthylamine and 4-aminobiphenyl ŽABP., have been detected in nanogram quantities in mainstream cigarette smoke and in even higher levels in sidestream smoke w37x. AAs are also found in coal- and shale-derived oils w38x and in agricultural chemicals w39x, and they are used in a variety of industrial processes w40x. The carcinogenicity of AAs, such as ABP, 2-naphthylamine, and benzidine, has long been established in both humans and experimental animals w41x. In addition to exogenous carcinogen exposures, such as those associated with cigarette smoking, it is plausible that certain endogenous compounds generated from oxidative stress and lipid peroxidation may be a source of DNA adduct formation in the human pancreas and initiators of carcinogenesis. Endogenous DNA adducts associated with oxidative stress include 8-oxo-dG, pyrimidow1,2-a xpurin-10Ž3 H .-one Žm 1G ., 1, N 6 -ethenoŽ2 X-deoxy.adenosine ŽedA ., 3, N 4-ethenoŽ2X-deoxy.cytidine ŽedC., and a variety of other products Žreviewed in Refs. w11–15x.. These adducts are generally thought to be derived from lipid peroxidation or normal cellular respiration and have recently been reported by our laboratory and by Wang et al. to be present in human pancreatic tissues w42,43x. The formation of these damaging free radicals is thought to be increased as the result of radiation exposure, cigarette smoking, occupational exposure, dietary antioxidant insufficiency, or diets high in v-6 polyunsaturated fatty acids Žreviewed in Refs. w11–20x.. Additionally, they may result from chronic disease states such as hepatitis, Wilson’s
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
disease, hemochromatosis, or Helicobacter pylori infection. We have recently reported the presence of hydrophobic AAs and a number of endogenously formed adducts in human pancreatic DNA w42,44x. In this report, we have extended these studies to measure the levels of N-Ždeoxyguanosin-8-yl.-ABP ŽdGC8-ABP., a major hydrophobic adduct, in relation to cigarette smoking and we have examined the role of genetic variability in enzymes that could bioactivate or detoxify nitroaromatic hydrocarbons or AAs Ži.e., N-acetyltransferases ŽNATs., glutathione S-transferases ŽGSTs., or nitroreductases, i.e., NADŽP.H quinone reductase or NQO1 .. Although these adducts have been reported in other human tissues by different laboratories, a comparison of the levels of endogenous and exogenous adducts in the same tissue samples has not been performed. The results from our current study on hydrophobic DNA adducts are compared with recently reported data on endogenous adduct levels in human pancreas w44x; the role of these adducts in relation to carcinogenesis in the pancreas is discussed.
2. Materials and methods 2.1. Subjects, tissues, and DNA isolation Samples of grossly normal pancreas tissue were obtained through an organ procurement program. The samples were selected from 15 current smokers and 15 non- or former smokers. Information on age, race, sex, and body mass index ŽBMI. was recorded; however, complete information was not available on all tissue donors and the number of samples used for each analysis is indicated in Section 3. At procurement, organs were placed in University of Wisconsin cold storage preservation solution w45x: these were trimmed of fat, rinsed in cold saline, snap-frozen in liquid nitrogen, and stored at y808C Ž- 1–4 years.. For DNA isolation, all the tissues were thawed at the same time and nuclear pellets were prepared as described previously w44x; DNA was isolated by the method of Gupta w46x, except that 0.01% 8-hydroxyquinoline was added to the phenol as an antioxidant.
265
This method prevented the artifactual formation of 8-oxo-dG, as judged by the lack of detectable 8-oxodG in DNA isolated from anaerobic bacteria Žunpublished studies.. DNA concentrations were determined by the diphenylamine reaction w47x.
2.2. DNA adduct measurements and instrumentation
2.2.1. Hydrophobic aromatic adducts 2.2.1.1. Method I. 32 P-Postlabelling and thin-layer chromatography (TLC) separation. The 32 P-Postlabelling assays were carried out essentially as described previously w48x. Adducted nucleotides were enriched by extraction into n-butanol and then w5X32 Pxphosphorylated using 3 units of polynucleotide kinase and 160 mCi of w g-32 PxATP Ž2.3 mM. at 378C for 40 min. TLC was performed using the solvent system previously reported w49x. Adducts were visualized as dark spots on X-ray film after subjecting the TLC plates to autoradiography. Corresponding regions on the TLC plates were excised and levels of radioactivity determined by scintillation counting. Adducts were distinguished by chromatographic comparison with an ABP-modified calf thymus DNA standard obtained through the NCTRrIARC repository. The level of dG-C8-ABP in this standard had recently been estimated at 18.8 adductsr10 8 nucleotides by HPLCrelectrospray ionization mass spectrometry w50x. 2.2.1.2. Method II. 32 P-Postlabelling and HPLC separation. The 32 P-Postlabelling reactions were performed as described in Method I, but without apyrase treatment. The 32 P-labelled nucleotides were diluted in water and stored, for no longer than 24 h at y208C, until injection on HPLC. 32 P-HPLC was performed as described w51x. Briefly, the 32 P-postlabelling reaction mixture was separated by HPLC, using a 3.5 = 150 mm2 DeltaPake 5 mm C18-100A column ŽWaters Chromatography, Millipore, Milford, MA. and a New Guard RP18 pre-column for diverting normal nucleotides. Adduct separation was performed by eluting at 0.5 ml miny1 with a 70 min linear gradient of 0–35% acetonitrile in 1.2 ammonium formate, 0.4 M formic acid ŽpH 4.5..
266
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
2.2.1.3. Method III. 35S-Postlabelling and HPLC detection. DNA samples Ž200 mg of DNA in 0.1 M sodium acetate buffer pH 4.5. were digested with nuclease P1 ŽAmersham Life-Science, Cleveland, OH. at 408C for 3 h. The reaction was then stopped with 20 ml of 1 M sodium carbonate buffer ŽpH s 9.0. and placed on ice. Further hydrolysis of the DNA with phosphodiesterase and alkaline phosphatase was carried out for 3 h at 508C, resulting in digestion to nucleosides. Completion of the digestion was verified by HPLC analysis. The mixture was then subjected to ABP-specific immunoaffinity chromatography or HPLC separation to enrich for ABP– DNA adducts. The acylation reaction was performed as previously described w52x. Briefly, 35 S-TBM-NHS Ž t-butoxycarbonyl-L-w35 Sxmethionine, N-hydroxysuccinimidyl ester. ) 800 Ci mmoly1 from Amersham was dissolved in 310 ml of anhydrous pyridine, mixed and transferred to an Eppendorf tube containing cold TBM Žca. 1000-fold molar excess. and then mixed again. N X , N X-Diisopropylcarbodiimide from Aldrich Ž1.5 mlrsample. was added and the solution was allowed to set for 5 min. To each of the DNA digests, 30 ml of the 35 S-TBM labelling mix was added and incubated in a 378C water bath for 3 h with occasional mixing. The samples were evaporated to dryness and redissolved in methanol for analysis by HPLC. HPLC analysis was performed using a methanol–water based gradient as described w52x. 2.2.2. Endogenous adducts These methods and data were described in detail previously w44x. Briefly, 8-oxo-dG was measured by HPLC with electrochemical detection as described w53x, m 1G was determined by gas chromatographyrelectron capture-negative chemical ionizationrmass spectrometry w54x, and the etheno adducts, edA and edC, were estimated by immunoaffinity purification and 32 P-postlabellingrTLC w55x. 2.3. Genotyping of human pancreas DNA Polymorphisms in the NAT1, GSTM1, GSTP1, GSTT1, and NQO1 genes were determined in the same DNA samples by polymerase chain reaction–
restriction fragment length analyses using primers and conditions as described w56–59x. Since homozygous GSTM1 and GSTT1 null genotypes give no amplified products, oligonucleotide primers that amplified part of the b-globin gene were employed as a positive control in a multiplex reaction Žforward primer, 5X CAACTTCATCCACGTTCACC 3X ; reverse primer, 5X GAAGAGCCAAGGACAGGTAC 3X ..
Table 1 Summary of metabolic activities by human pancreatic microsomes and cytosolsa Major enzyme
Activitiesb
Protein detected by immunoblotting
P450 1A1 P450 1A2 P450 1B1d P450 2A6 P450 2B6 P450 2C8r9r18r19 P450 2D6 P450 2E1 P450 3A4r4r5r7 P450 4A1 Prostaglandin H synthase 4-Nitrobiphenyl nitroreduction 4-Nitrobiphenyl nitroreduction P450 reductase N-Hydroxy-ABP O-acetyltransferase ŽNAT1qNAT2. NAT1 NAT2 N-hydroxy-ABP sulfotransferase Epoxide hydrolase
y y n.d. n.d. y n.d. n.d. y y y "
n.d.c y qd y n.d. y y y y n.d. n.d.
qq Žmicrosomal. qq Žcytosolic. qq
n.d.
q qq q y
n.d. n.d. n.d. n.d.
n.d.
q
a
n.d. n.d.
This table is a summary of data previously reported w44x. Activities were determined using a series of specific substrates for the enzymes noted, for methodologic details and enzymatic rates refer to Ref. w44x. c n.d.—not determined. d Data not previously reported; CYP1B1 was detected in microsomal fractions of human pancreas using anti-peptide anti-serum Žsubmitted., CYP1B1 is strongly expressed in acinar cells of normal pancreas by in situ hybridization, while islets of Langerhans Žthe endocrine cells. and columnar cells of interlobular ducts are negative Žunpublished studies.. b
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
3. Results 3.1. Carcinogen metabolism, adduct formation and the human pancreas As with most chemical carcinogens, AAs, HAAs and nitroaromatic hydrocarbons can be metabolized to reactive electrophiles that covalently modify or ‘adduct’ DNA Žreviewed in Ref. w60x.. Therefore, in our earlier studies, we examined pancreatic tissues for their metabolic capacity to activate AAs, HAAs and nitroaromatic hydrocarbons and for the presence of hydrophobic DNA adducts w42x. The results of these studies are summarized in Table 1. Microsomal preparations showed no activity for the cytochrome P4501A2-catalyzed N-oxidation of ABP or for each of the P450s: P450 1A1; P450 2A6; P450 2B6; P450 2D6; P450 2E1; P450 3A4; and P450 4A1. Immunoblots detected only epoxide hydrolase and P450 1B1 at low levels; P450 levels were - 1% of liver.
267
4-Nitrobiphenyl reductase activities were present in pancreatic cytosols and microsomes at levels comparable to human liver. The O-acetyltransferase activity Žpredominantly NAT1. of pancreatic cytosols was at high levels, comparable to about two-thirds the levels previously measured in human colon. Next, we examined the same set of pancreatic tissues for the presence of hydrophobic DNA adducts from AAs. Putative PAH Žnuclease P1 enriched.and AA Ž n-butanol enriched.-DNA adducts were detected in these pancreas tissues using standard 32 P-postlabelling techniques. The PAH-like adducts were observed only in current smokers, while the AA-like adducts were present in nearly all the samples. Total hydrophobic adduct levels ranged from about 1 to 100 adductsr10 8 nucleotides. In this initial study of the hydrophobic DNA adducts, it was noted that several of the samples appeared to have adducts that co-migrated with the major ABP–DNA adduct, dG-C8-ABP. These results supported our initial hypothesis that metabolic activation of
Fig. 1. ŽPanel A. 32 P-HPLC chromatograms showing co-migration of DNA adducts detected in human pancreas DNAa 42, ŽPanel B. human pancreas DNAa 42 spiked with an ; equal amount of 32 P-postlabelled ABP-modified calf thymus DNA ŽPanel B.. The TLC autoradiogram for human pancreas sample a 42 is shown in the upper right corner of Panel A. Note: increased radioactivity is seen in peaks detected at 56–57 minutes, 61.5–62.5 minutes, 63–64 minutes, and 68–69 minutes in sample 42 spiked with the ABP-modified DNA.
268
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
Fig. 2. 32 P-HPLC chromatograms ŽPanel A. and UV Spectral Detection ŽPanel B. of DNA adducts detected in the human pancreas DNAa X X 42 co-injected with the w3 Hx-dG-C8-ABP-3 ,5 bisŽphosphate. standard. UV spectra of the standard is shown in the inset of Panel B. 3 Radioactivity attributed to the H-ABP-DNA adduct standard is - 550 dpm and does not contribute significantly to the radioactivity in peak detected in Panel A.
carcinogenic AAs, PAHs, and nitroaromatic hydrocarbons, along with carcinogen–DNA adduct forma-
tion, may be involved in the etiology of human pancreatic cancer.
Table 2 Human pancreas samples positive for the dG-C8-ABP adduct by three methodologiesa
dG-C8-ABPqr total tested Žmedian; range. a
Method I 32 P-PLbrTLC
32
Method II P-PLrHPLC
Method III 35 S-PLrHPLC
Method II and III 32 P-PLrHPLC q35 S-PLrHPLC
17 cr29 Ž1.9; 0.66–5.7.
9 dr29 Ž0.9; 0.08–6.1.
6 er29 Ž1.1; 0.9–1.5.
5 fr29 Ž1.2; 0.9–6.1 vs. 1.1; 0.9–1.2.
Refer to Section 2 for detailed methodology. PL s postlabelling. c Seventeen pancreas DNA samples had adduct spots co-migrating on TLC plates with ABP modified calf thymus DNA; median and range are shown as adducts per 10 7 nucleotides. d Nine pancreas DNA samples had adduct peaks co-migrating with the unlabelled adduct standard in at least two postlabelling reactions. Five DNA samples appeared positive in a single labelling reaction. The median adduct level and range of these nine samples are indicated as adducts per 10 7 nucleotides. e Six pancreas DNAs had adduct peaks that co-migrated with the ABP–DNA adduct standard in a linear response study using 35 S-acylation labelling method. This included three separate labelling reactions at 50 mg, 100 mg and 150 mg of DNA with ABP-specific immunoaffinity enrichment and HPLC separation. Like the 32 P-postlabelling results, five DNA samples appeared positive in a single labelling. Median adduct levels and range are shown per 10 7 nucleotides. f Five pancreas DNA samples co-migrated with the dG-C8-ABP standard in both Method II and Method III wone sample was not available for 32 P-postlabelling analysisx in three separate experiments. The median adduct levels and range are shown per 10 7 nucleotides for each of the independent methodologies. Though deviation from the median was less using the 35 S-labelling method, relatively equivocal adduct levels were noted at ; 1 adductr10 7 nucleotides. b
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
3.2. Presence of the major ABP–AA adduct in human pancreas By combining the use of 32 P- and 35 S-postlabelling techniques, along with HPLC and TLC separation methodologies, we have sought to verify the presence of the major ABP–DNA adduct, dG-C8ABP, as suspected from our previous study in this tissue. Similar to our previous report w42x, in a separate set of 30 pancreas DNA samples, the presence of putative hydrophobic PAH– and AA–DNA adducts, were detected at levels comparable to those reported using the standard 32 P-postlabellingrTLC separation method I Ždescribed in Section 2.. By comparing data from the postlabelling methods II and III, 5 out of 29 pancreas samples were identified as positive in multiple repeat measurements for the presence of the major ABP–DNA adduct and an additional four samples showed positivity using one of the methods using duplicate measurements. Representative data are shown in Fig. 1, panels A–B, and co-migration studies with UV detectable 3 Hlabelled dG-C8-ABP standard are shown in Fig. 2. These results are summarized in Table 2. 3.3. Smoking, metabolic genotype and the presence of the dG-C8-ABP adducts in human pancreas On the same set of DNAs that were used to determine ABP–DNA adduct levels, NQO1 , GSTM1, GSTT1 and NAT1 genotypes were determined in order to assess the role of their gene products in detoxification or bioactivation for the major dG-C8ABP adduct. Though the sample set was small, all 10 of the ABP adduct-positive samples by either method had the slow NAT1)4r)4 slow acetylator genotype, as compared to only 3r19 adduct-negative samples, which was statistically significant Ž X 2 s 18.9, df s 2, p - 0.001.. There was no correlation between adducts and genotypes for GSTT1, GSTM1, GSTP1 or NQO1. The presence of the ABP adduct was not significantly correlated with smoking, age or BMI. It should be noted, however, that among individuals with adducts, the levels of adducts were one order of magnitude higher in smokers than in nonsmokers. These data are summarized in Table 3 and suggest that NAT1 may play an important role in the detoxification of AAs in human pancreas. Further,
269
these data support cigarette smoking as a potential source for AA exposure in the pancreas. A role for polymorphisms in NAT2 is predicted; however, due to sheering of DNA specimens from repeated freezing and thawing, approaches to genotype NAT2 late in the study were proven unsuccessful. A model, depicting a mechanism for AA metabolism and adduct formation in the pancreas, is shown in Fig. 3. 3.4. Endogenous DNA adduct formation, metabolic genotype and the human pancreas We have recently reported on the relative levels of the endogenous DNA adducts in these same tis-
Table 3 Characteristics of pancreas tissue donors with and without dG-C8ABP adductsa
Smoking b Adduct level Non-smokers Ž ns 5. Smokers Ž ns 5.
Adducts—yes Ž ns10.
Adducts—no Ž ns 20.
5r10 Ž50%.
10r20 Ž50%.
0.22 " 0.11r10 7 2.19q2.19r10 7 Adducts—yes Ž ns10.
Genotype c NAT1)4r)4 10 Ž100%. NAT1)4rNAT1)10 0 NAT1)10r)10 0 Ž X 2 s18.75, df s 2, p- 0.001.
NAT1 activity d Žnmol miny1 mgy1 protein. Non-smokers Ž ns 5. Smokers Ž ns 5. a
Adducts—no Ž ns19. 3 Ž10%. 11 5
Adducts—yes Žn s10.
Adducts—no Žn s 20.
0.55"0.26
0.40 " 0.22
0.59 " 0.27 0.51 " 0.28
Data is presented for samples positive for dG-C8-ABP adduct by either 32 P-postlabelling or 35 S-postlabelling methodologies Ž ns 10.. b Smoking status was unavailable for one sample that showed no adducts. c Genotype data could not be determined for 1 of the 30 samples decreasing available genotype data to 29 total samples. d NAT1 activity was determined using assay p-aminobenzoic acid under assay conditions shown to be selective for NAT1 w44x.
270
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
4.2. Metabolic genotype and exogenous DNA adduct formation
Fig. 3. Possible metabolic pathways for ABP–DNA adduct formation in the human pancreas.
sues used to measure hydrophobic DNA adduct levels w43x. The highest adduct levels observed were for m 1G, followed by 8-oxo-dG, edA, and edC, but there were no differences in adduct levels between smokers and non-smokers and no correlation was found when comparing age, sex or BMI between the subjects. Moreover, there was no correlation in adduct levels between edA and eC, or between edA or edC and m 1G or 8-oxo-dG. However, there was a significant correlation Ž r s 0.76; p - 0.01. between the levels of 8-oxo-dG and m 1G in the DNA. Neither GSTM1 nor NQO1 genotypes were associated with differences in any of the adduct levels.
4. Discussion 4.1. Chemical carcinogenesis, cigarette smoking and DNA adduct formation The presence of putative PAH adducts in smokers vs. non-smokers strongly suggest smoking as the exogenous source for these PAH adducts. The elevated levels of the ABP–DNA adducts in smokers vs. non-smokers is consistent with smoking as a potential source of AA in the human pancreas. Although cigarette smoking may be contributing to the levels of exogenous DNA adduct formation in this limited sampling of the human pancreas, the data suggest that endogenous DNA adduct formation is not strongly associated with smoking.
In this series of samples we noted that all five samples, confirmed positive for the dG-C8-ABP-like adduct using both methodologies, and all 10 samples positive for dG-C8-ABP by 32 P- or 35 S-postlabellingrHPLC were homozygous NAT1)4r)4 genotypes. These results indicate that the slow acetylation genotype may increase the presence of this adduct in the pancreas. This is in contrast to our original model w42x, where we predicted that tissue-specific NATcatalyzed O-acetylation of the N-hydroxy-AAs would be an important determinant of adduct formation w43x. However, in this set of pancreas specimens it should be noted that the genotype for NAT1 did not correlate with the phenotype. Furthermore, in the activity assays for PABA NAT1 activity, the mean activity is equal to or slightly higher for the 10 samples positive for dG-C8-ABP than the other samples. This same lack of correlation of activity with genotype has recently been discussed and suggests that our current understanding of the rapid and slow NAT1 acetylation polymorphism may be incomplete w61x. An alternative explanation for the role of NAT1 activity is shown in Fig. 3. With the overall low metabolic activity of the pancreas compared to the liver and colon ŽTable 1., we suspect that the important bioactivation andror detoxification steps for the parent compounds to reactive intermediates is taking place in these tissues. Thus, the exposure of the pancreas to these reactive species would be dependent upon extra-pancreatic metabolic pathways and subsequent exposure of the pancreas. 4.3. Other sources of chemical carcinogenesis in human pancreas As noted in Table 2, we have frequently detected ABP-like adducts in numerous samples by both methodologies. When we compare smoking status with samples determined positive for ABP-adduct in at least one assay, we see no correlation. We suspect that AA-adducts may result from the diet andror environmental exposures to AAs or nitroaromatic hydrocarbons. Although NQO1 genotype was not associated with ABP–DNA adduct levels, there are multiple enzymes that exhibit nitroreductase activity
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
w62x. However, we have no means to address the issue of dietary or environmental exposure to AAs or nitroaromatics in this study of pancreatic tissues where we were limited by sample size and lack of donor information. It is clear that, in the pancreas, there is a high degree of background hydrophobic adducts that may be the result of multiple sources of exposures andror slow cell turnover. These background adducts do not appear to correlate with smoking, age, sex, or BMI. Identifying the sources of these ‘background’ adducts may be extremely important in developing future questions regarding specific dietary and environmental exposures contributing to the etiology of pancreatic carcinogenesis.
271
hyde derived from lipid peroxidation may not be contributing significantly to m 1G adduct formation. On the other hand, the apparent correlation between m 1G and 8-oxo-dG and their comparable high levels are consistent with the hypothesis that m 1G is formed primarily by reaction of DNA with a base propenal, which, like 8-oxo-dG, is thought to be derived from hydroxyl radical attack on the DNA. Alternatively, these data may reflect small sample numbers andror simply be indicative of the mechanism of how adducts from endogenous reactive species are formed andror repaired. In addition, the correlation between m 1G and 8-oxo-dG adduct levels and their lack of correlation with the etheno adduct levels indicate that the direct reaction of reactive oxygen species, such as the hydroxyl radical, with DNA may be the primary cause of endogenous DNA adduct formation in the pancreas, rather than lipid peroxidation.
4.4. Source of endogenous adducts Neither cigarette smoking, sex, age nor BMI were associated with differences in endogenous adduct levels, suggesting that none of these factors significantly affect oxidative stress, redox cycling or lipid peroxidation in our set of human pancreas samples w44x. This was in contrast to the results recently reported by Wang et al. w43x who demonstrated a correlation between both BMI and smoking with the endogenous adducts detected in their pancreas samples. In our study, the lack of correlation between m 1G and edA or edC, indicate that the malondialde-
4.5. Metabolic genotype and endogenous DNA adduct leÕels Although the sample set was limited, the data suggest that endogenous DNA adduct formation in human pancreas is not clearly derived from NQO1mediated redox cycling. Further, it appears that neither GSTM1 nor GSTT1 appreciably protects against endogenous adduct formation. If m 1G had correlated
Table 4 Comparative summary of exogenous and endogenous adduct levels in human pancreasa Adduct type
Adduct qr total tested
Method of determinationb
Median wrangex levelr 10 7 nucleotides
Total hydrophobic adduct levels ABP-adduct ABP-adduct edA edC 8-oxo-dG m 1dG q edA levels in ABPq samplesb
29r29 9r29 6r29 28r28 27r27 28r28 13r27 8r8 6r6 8r8 b 6r6 7r8 b 5r5 b
32
3.0 w0.66–9.0x 0.9 w0.08–6.1x 1.1 w0.9–1.5x 0.11 w0.03–0.56x 0.09 w0.01–0.46x 1.8 w0.9–4.2x 1.9 w1.1–4.2x 0.10 w0.05–0.29x 0.09 w0.06–0.28x 0.09 w0.04–0.31x 0.11 w0.04–0.31x 1.8 w1.1–2.1x 1.5 w1.1–1.8x
edC level in ABPq samples 8-oxo-dG in ABPq samples a b
P-PLrTLC P-PLrHPLC 35 S-PLrHPLC Ref. w42x Ref. w42x Ref. w42x Ref. w42x 32 P-PLrHPLC 35 S-PLrHPLC 32 P-PLrHPLC 35 S-PLrHPLC 32 P-PLrHPLC 35 S-PLrHPLC 32
Refer to Ref. w42x for complete analysis of endogenous adduct levels in these tissues. Refer to Table 2 and Section 2. PL s postlabelling.
272
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
with etheno adduct levels, then the opposite conclusion might be inferred since etheno adducts are thought to be derived primarily from products of lipid peroxidation. The former assessment is consistent with the hypothesis that 8-oxo-dG and m 1G both arise from hydroxyl radical attack on DNA, with 8-oxo-dG being formed by reaction with guanine and m 1G by reaction with the 2X-deoxyribose, resulting in a reactive base propenal that subsequently reacts with guanine w63x. This hypothesis is also consistent with the lack of an effect of the GSTM1 genotype on m 1G and other endogenous adduct levels measured here. Both GSTM1 and GSTP1 are expressed in the pancreas w64x; however, GSTP1 but not GSTM1 catalyzes the detoxification of base propenals, while GSTM1 and GSTT1 is more active with hydroxyalkenals Žproducts of lipid peroxidation. w65x. 4.6. Endogenous Õs. exogenous adduct formation and pancreatic cancer Smoking and high meat intake increase pancreatic cancer risk and this could be due to aromatic carcinogens that form hydrophobic aromatic DNA adducts as discussed above Žreviewed in Ref. w22x.. BMI has not been consistently associated with increased pancreas cancer risk in epidemiological studies; however, high energy intake and chronic pancreatitis have been associated with increased risk, perhaps by increasing free radical generation and endogenous DNA adduct formation in the pancreas. Our data indicate that the human pancreas is subject to multiple exposures that may account for DNA adduct formation and subsequent carcinogenesis in the human pancreas. In this limited data set, there did not appear to be any correlation between the total hydrophobic adducts and total endogenous adducts nor was there any apparent relationship between the levels of the ABP adduct and any of the specific endogenous adducts measured ŽTable 4.. The mechanisms and individual susceptibilities giving rise to the adducts detected in the human pancreas are not yet clear. Nevertheless, our data support the hypothesis that both endogenous and exogenous exposures contribute to adduct formation in the human pancreas, perhaps explaining the impact of diet and smoking on the risk of cancer formation in this tissue. It is evident that molecular epidemiological
studies are needed to address these hypotheses of particular interest including dietary sources of AAs, heterocyclic amines, PAHS and nitroaromatic hydrocarbons Ži.e., pan frying or grilling of meats., and antioxidants Žthrough vegetable and fruit consumption.; the impact of oxidative stress Žthrough high caloric intake or chronic disease.; and the role of metabolic polymorphisms in the generation of these reactive species. References w1x L.A. Nordlund, J.M. Carstensen, P. Pershagen, Cancer incidence in female smokers—a 26 year follow up, Int. J. Cancer 73 Ž1997. 625–628. w2x D. Hoffman, I. Hoffman, The changing cigarette, 1950–1995, J. Toxicol. Environ. Health 50 Ž1997. 307–364. w3x R. Doll, Cancers weakly related to smoking, Br. Med. Bulletin. 52 Ž1996. 35–49. w4x W.C. Willet, Diet, nutrition and avoidable cancer, Environ. Health Perspect. 103 Ž1995. 165–170. w5x W.R. Fair, N.E. Fleshner, W. Heston, Cancer of the prostate: a nutritional disease?, Urology 50 Ž1997. 840–848. w6x A. Schatzkin, Dietary changes as a strategy for preventing cancer, Cancer and Metastasis 16 Ž1997. 377–392. w7x E. Giovannucci, B. Goldin, The role of fat, fatty acids and total energy intake in the etiology of human colon cancer, Am. J. Clin. Nutr. 66 Ž1997. 1564S–1571S. w8x M. Poirier, A. Weston, Human DNA adduct measurements: state of the art, Environ. Health Perspect. 10S45 Ž1996. 883–893. w9x K.R. Kaderlik, F.F. Kadlubar, Metabolic polymorphisms and carcinogen–DNA adduct formation in human populations, Pharmacogenetics 5 Ž1995. S108–S117. w10x J.D. Potter, K. Steinmetz, Vegetables, fruit and phytoestrogens as preventive agents, IARC Scientific Publications 139 Ž1996. 61–90. w11x S. Loft, H.E. Poulsen, Cancer risk and oxidative DNA damage in man, J. Mol. Med. 74 Ž1996. 297–312. w12x F.-L. Chung, H.-Y.C. Chen, R.G. Nath, Lipid peroxidation as a potential endogenous source for the formation of exocyclic DNA adducts, Carcinogenesis 17 Ž1996. 2105–2111. w13x J. Nair, C.E. Vaca, I. Velic, M. Mutanen, L.M. Valsta, H. Bartsch, High dietary v-6 polyunsaturated fatty acids drastically increase the formation of etheno adducts in white blood cells of female subjects, Cancer Epidemiol., Biomarkers Prev. 6 Ž1997. 597–601. w14x S.P. Fink, G.R. Reddy, L.J. Marnett, Mutagenicity in Escherichia coli of the major DNA adduct derived from the endogenous mutagen malondialdehyde, Proc. Natl. Acad. Sci. U.S.A. 94 Ž1997. 8652–8657. w15x J.A. Swenberg, D.K. La, N.A. Scheller, K.Y. Wu, Dose–response relationship for carcinogens, Toxicol. Lett. 82–83 Ž1995. 751–756. w16x M. Wang, K. Dhingra, W.N. Hittelman, J.G. Liehr, M. de
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274
w17x
w18x
w19x
w20x
w21x w22x
w23x
w24x
w25x
w26x
w27x w28x
w29x w30x w31x
w32x
Andrade, D. Li, Lipid peroxidation-induced malondialdehyde adducts in human breast tissues, Cancer Epidemiol. Biomarkers Prev. 5 Ž1996. 705–710. S.-C. Baik, H.-S. Youn, M.-H. Chung, W.-K. Lee, M.-J. Cho, G.-H. Ko, C.-K. Park, H. Kasai, K.-H. Rhee, Increased oxidative DNA damage in Helicobacter pylori-infected human gastric mucosa, Cancer Res. 56 Ž1996. 1279–1282. S. Asami, H. Manabe, J. Miyake, Y. Tsurodome, T. Hirano, R. Yamaguchi, H. Itoh, H. Kasai, Cigarette smoking induces an increase in oxidative DNA damage, 8-hydroxydeoxyguanosine, in a central site of the human lung, Carcinogenesis 18 Ž1997. 1763–1766. B. Marczynski, P. Rozynek, H.-J. Elliehausen, M. Korn, X. Bauer, Detection of 8-hydroxydeoxyguanosine, a marker of oxidative DNA damage, in white blood cells of workers occupationally exposed to styrene, Arch. Toxicol. 71 Ž1997. 496–500. H. Daube, G. Scherer, K. Riedel, T. Ruppert, A.R. Tricker, P. Rosenbaum, F. Adlkofer, DNA adducts in human placenta in relation to tobacco smoke exposure and plasma antioxidant status, J. Cancer Res. Clin. Oncol. 123 Ž1997. 141–151. P.A. Wingo, T. Tong, S. Bolden, Cancer statistics, 1995, CA Cancer J. Clin. 45 Ž1995. 8–30. K.E. Anderson, J.D. Potter, T. Mack, Pancreas, in: D. Schottenfeld, J. Fraumeni ŽEds.., Cancer Epidemiology and Prevention, 2nd edn., Oxford Univ. Press, New York, 1996, pp. 725–771. J.P. Durbec, G. Chevillotte, J.M. Bidart, P. Berthezene, H. Sarles, Diet, alcohol, tobacco and risk of cancer of the pancreas: a case-control study, Br. J. Cancer 47 Ž1983. 467–470. T.M. Mack, M.C. Yu, R. Hanisch, B.E. Henderson, Pancreas cancer and smoking, beverage consumption and past medical history, JNCI 76 Ž1986. 49–60. R.T. Falk, L.W. Pickle, E.T. Fontham, P. Correa, J.F. Fraumeni, Life-style risk factors for pancreatic cancer in Louisiana: a case-control study, Am. J. Epidemiol. 128 Ž1988. 324–336. G.W. Olsen, J.S. Mandel, R.W. Gibson, L.W. Wattenberg, L.M. Schuman, A case-control study of pancreatic cancer and cigarettes, alcohol, coffee and diet, Am. J. Public Health 79 Ž1989. 1016–1019. T. Hirayama, Epidemiology of pancreatic cancer in Japan, Jpn. J. Clin. Oncol. 19 Ž1989. 208–215. H.B. Bueno de Mesquita, P. Maisonneuve, C.J. Moerman, S. Runia, P. Boyle, Life-time history of smoking and exocrine carcinoma of the pancreas: a population-based case-control study in The Netherlands, Int. J. Cancer 49 Ž1991. 816–822. D.C. Farrow, S. Davis, Diet and risk of pancreatic cancer in men, Am. J. Epidemiol. 132 Ž1990. 423–431. F. Pietri, F. Clavel, Occupational exposure and cancer of the pancreas: a review, Br. J. Ind. Med. 48 Ž1991. 583–587. T.F. Mancuso, A.A. El-Attar, Cohort study of workers exposed to betanaphathylamine and benzidine, J. Occup. Med. 9 Ž1967. 277–285. F.P. Li, J.F. Fraumeni Jr., N. Mantel, R. Miller, Cancer mortality among chemists, JNCI 43 Ž1969. 1159–1164.
273
w33x T.M. Mack, Pancreas, in: D. Schottenenfeld, J.F. Fraumeni, Jr. ŽEds.., Cancer Epidemiology and Prevention, Saunders, PA, 1982, pp. 638–667. w34x R.T. Falk, L.W. Pickle, E.T. Fontham, P. Correa, A. Morse, V. Chen, J.J. Fraumeni Jr., Occupation and pancreatic cancer risk in Louisiana, Am. J. Ind. Med. 18 Ž1990. 565–576. w35x R.K. Kaderlik, D.-X. Lin, M.D. Friesen, H. Bartsch, K.E. Anderson, J.D. Potter, N.P. Lang, F.F. Kadlubar, Human biomonitoring of arylamine–DNA adducts in human colon and pancreas tissues ŽAbstract a907.. Proc. Am. Assoc. Cancer Res. 34, 1993. w36x J.H. Weisburger, Heterocyclic amines in cooked foods: possible human carcinogens. ŽMeeting report., Cancer Res. 53 Ž1993. 2422–2424. w37x C. Patrianakos, D. Hoffman, Chemical studies on tobacco smoke LXIV. On the analysis of aromatic amines in cigarette smoke, J. Anal. Toxicol. 3 Ž1979. 150–159. w38x A.C. Austin, L.D. Claxton, J. Lewtas, Mutagenicity of the fractionated organic emission from diesel, cigarette smoke condensate, coke oven and roofing tar in the Ames assay, Environmental Mutagenesis 7 Ž1985. 471–487. w39x Council on Scientific Affairs, J. Am. Med. Assoc. 260 Ž1988. 959–966. w40x P.A. Schulte, K. Ringen, G.P. Hemstreet, E. Ward, Occup. Med. ŽState of the Art Rev.. 2 Ž1987. 85–107. w41x R.C. Garner, C.N. Martin, D.B. Clayson, in: C.E. Searle ŽEd.., Chemical Carcinogens, American Chemical Society Monograph No. 182, American Chemical Society, Washington, DC, 2nd edn., Vol. 1, 1984, pp. 175–27. w42x F.F. Kadlubar, K.E. Anderson, N.P. Lang, P.A. Thompson, S.L. MacLeod, M.W. Chou, M. Mikhailova, J. Plastara, L.J. Marnett, S. Haussermann, J. Nair, I. Velic, H. Bartsch, ¨ Comparison of DNA Adduct Levels Associated with Oxidative Stress in Human Pancreas, Mutation Research 405 Ž1998. 125–133. w43x M. Wang, J.L. Abbruzzese, H. Friess, W.N. Hittelman, D.B. Evans, M.C. Abbruzzese, P. Chiao, D. Li, DNA adducts in human pancreatic tissues and their potential role in carcinogenesis, Cancer Res. 58 Ž1998. 1–87. w44x K.E. Anderson, G.J. Hammons, F.F. Kadlubar, J.D. Potter, K.R. Kaderlik, K.F. Ilett, R.F. Minchin, C.H. Teitel, H.-C. Chou, M.V. Martin, F.P. Guengerich, G.W. Barone, N.P. Lang, L.A. Peterson, Metabolic activation of aromatic amines by human pancreas, Carcinogenesis 18 Ž1997. 1085–1092. w45x F.O. Belzer, J.H. Southard, Principles of solid-organ preservation by cold storage, Transplantation 45 Ž1988. 673–676. w46x R.C. Gupta, Nonrandom binding of the carcinogen N-hydroxy-2-acetylaminofluorene to repetitive sequences of rat liver DNA in vivo, Proc. Natl. Acad. Sci. U.S.A. 81 Ž1984. 6943–6947. w47x K. Burton, Determination of DNA concentration with diphenylamine, Meth. Enzymol. 12B Ž1968. 163–169. w48x R.C. Gupta, M.V. Reddy, K. Randerath, 32 P-postlabeling analysis of non-radioactive aromatic carcinogen–DNA adducts, Carcinogenesis 3 Ž1982. 1081–1092. w49x D.-X. Lin, J.O. Lay, M.S. Bryant, C. Malaveille, M. Friesen, H. Bartsch, N.P. Lang, F.F. Kadlubar, Analysis of 4-amino-
274
w50x
w51x
w52x
w53x
w54x
w55x
w56x
w57x
P.A. Thompson et al.r Mutation Research 424 (1999) 263–274 biphenyl–DNA adducts in human urinary bladder and lung by alkaline hydrolysis and negative ion gas chromatographyrmass spectrometry, Environ. Health Perspect. 102S6 Ž1994. 11–16. F.B. Beland, D.R. Doerge, M.I. Churchwell, M.C. Poirier, B. Schoket, M.M. Marques, Synthesis, characterization, and quantitation of a 4-aminobiphenyl DNA adduct standard, Chem. Res. Toxicol. 12 Ž1. Ž1999. 68–77. M. Zeisig, L. Moller, 32P-HPLC suitable for characterization of DNA adducts formed in vitro by polycyclic aromatic hydrocarbons and derivatives, Carcinogenesis 16 Ž1995. 1–9. F.Z. Sheabar, M.L. Morningstar, G.N. Wogan, Adduct detection by acylation with w35 Sx methionine: analysis of DNA adducts of 4-aminobiphenyl, Proc. Natl. Acad. Sci. U.S.A. 91 Ž1994. 1696–1700. M.V. Mikhailova, N.A. Littlefield, B.S. Hass, L.A. Poirier, M.W. Chou, Cadmium-induced 8-hydroxyguanosine formation, DNA strand breaks and antioxidant enzyme activities in lymphoblastoid cells, Cancer Lett. 115 Ž1997. 141–148. C.A. Rouzer, A.K. Chaudhary, M. Nokubo, D.M. Ferguson, G.R. Reddy, I.A. Blair, L.J. Marnett, Analysis of the malonX dialdehyde-2 -deoxyguanosine adduct pyrimidopurine in human leucocyte DNA by gas chromatographyrelectron capturernegative chemical ionizationrmass spectrometry, Chem. Res. Toxicol. 10 Ž1997. 181–188. J. Nair, A. Barbin, Y. Guichard, H. Bartsch, 1, N 6-Ethenodeoxyguanosine and 3, N 4-ethenodeoxycytidine in liver DNA from humans and untreated rodents detected by immunoaffinityr32 P-postlabelling, Carcinogenesis 16 Ž1995. 613–617. D.A. Bell, A.F. Badawi, N.P. Lang, K.F. Ilett, F.F. Kadlubar, A. Hirvonen, Polymorphism in the N-acetyltransferase 1 ŽNAT1. polyadenylation signal: association of NAT1)10 allele with higher N-acetylation activity in bladder and colon tissue, Cancer Res. 55 Ž1995. 5226–5229. M. Arand, R. Muhlbauer, J. Hengstler, E. Jager, J. Fuchs, L. ¨ Winkler, F. Oesch, A multiplex polymerase chain reaction
w58x
w59x
w60x
w61x
w62x
w63x
w64x
w65x
protocol for the simultaneous analysis of the glutathione S-transferase GSTM1 and GSTT1 polymorphisms, Anal. Biochem. 236 Ž1996. 184–186. E.A. Rosvold, K.A. McGlynn, E.D. Lustbader, K.H. Buetow, Identification of an NADŽP.H:quinone oxidoreductase polymorphism and its association with lung cancer and smoking, Pharmacogenetics 5 Ž1995. 199–206. F. Ali-Osman, A. Olanike, G. Antoun, J.-X. Mao, J. Buolamwini, Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants, J. Biol. Chem. 272 Ž1997. 10004–10012. F.A. Beland, F.F. Kadlubar, Formation and persistence of arylamine DNA adducts in vivo, Environ. Health Perspect. 62 Ž1985. 19–30. D.M. Grant, N.C. Hughes, S.A. Janezic et al., Human acetyltransferase polymorphisms, Mutation Research 376 Ž1997. 61–70. K.F. Ilett, D.M. Ingram, D.S. Carpenter, C.H. Teitel, N.P. Lang, F.F. Kadlubar, R.F. Minchin, Expression of monomorphic and polymorphic N-acetyltransferases in human colon, Biochem. Pharmacol. 47 Ž1994. 914–917. P.C. Dedon, J.P. Plastaras, C.A. Rouzer, L.J. Marnett, Indirect mutagenesis by oxidative damage: formation of a pyrimidopurine adduct by base propenals. Chem. Res. Toxicol., in press. D.A. Bell, J.A. Taylor, D.F. Paulson, C.N. Robertson, J.L. Mohler, G.W. Lucier, Genetic risk and carcinogen exposure: a common inherited effect of the carcinogen metabolism gene glutathione S-transferase M1 ŽGSTM1. that increases susceptibility to bladder cancer, J. Natl. Cancer Inst. 85 Ž1993. 1159–1164. ˚ Engstrom, J.W. Kozarich, B. K. Berhane, M. Widersten, A. Mannervik, Detoxication of base propenals and other a ,bunsaturated aldehyde products of radical reactions and lipid peroxidation by human glutathione transferases, Proc. Natl. Acad. Sci. USA, 1994, pp. 1480–1484.