- Email: [email protected]
Comparison of primer sets and one-step reverse transcription polymerase chain reaction kits for the detection of bluetongue viral RNA
Journal of Virological Methods 200 (2014) 6–9
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Comparison of primer sets and one-step reverse transcription polymerase chain reaction kits for the detection of bluetongue viral RNA Fan Lee ∗ , Yeou-Liang Lin, Hsiang-Jung Tsai Animal Health Research Institute, 376 Chung-Cheng Road, Tamsui District, New Taipei City 25158, Taiwan
a b s t r a c t Article history: Received 8 September 2013 Received in revised form 8 January 2014 Accepted 9 January 2014 Available online 3 February 2014 Keywords: Bluetongue Primer Reverse transcription polymerase chain reaction
Bluetongue virus is the etiological agent of bluetongue, one of the most important insect-transmitted animal diseases in the world. To establish a feasible diagnostic procedure for detecting the viral RNA, seven commercially available one-step RT-PCR kits in combination with three primer sets were evaluated. Results of this study showed remarkable differences in analytical sensitivity between the examined RTPCR kits. In addition, it was found that a World Organization for Animal Health-recommended primer set may not be effective in detecting most BTV RNA. © 2014 Elsevier B.V. All rights reserved.
Bluetongue is one of the most important insect-transmitted diseases globally. Bluetongue virus (BTV), a member of the genus Orbivirus within the family Reoviridae, is the etiological agent of bluetongue, and 26 BTV serotypes have been identified (Maan et al., 2011). The virus is transmitted by Culicoides biting midges (Mellor and Boorman, 1995), and the disease affects primarily domestic and wild ruminants. In most ruminants, BTV infection is asymptomatic or mild, whereas the infection in some breeds of sheep may result in severe illness, characterized by facial edema, dermatitis, coronitis, abortion, and even death (Goltz, 1978; Luedke et al., 1977; MacLachlan et al., 2009). Infection of BTV can cause prolonged viremia in infected animals. After the infection, the virus can be sheltered by erythrocytes and continues to circulate in the blood for more than one month (Barratt-Boyes and MacLachlan, 1994; Bonneau et al., 2002; Koumbati et al., 1999; MacLachlan, 2004; Vögtlin et al., 2013). Therefore, for bluetongue diagnosis, detection of BTV or its genomic RNA within blood samples is meaningful; moreover, for quarantine and international trade, the detection is also helpful to identify livestock which carries BTV. Reverse transcription polymerase chain reaction (RT-PCR) has been employed widely in the rapid diagnosis of diseases caused
∗ Corresponding author. Tel.: +886 2 26212111x516; fax: +886 2 26225345. E-mail addresses: [email protected] (F. Lee), [email protected] (Y.-L. Lin), [email protected] (H.-J. Tsai). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.021
by RNA viruses, including bluetongue. One-step RT-PCR, which combines reverse transcription and thermo-cycling amplification in one test tube, has the advantages of not only decreasing the number of pipetting steps but also minimizing the risk of contamination between samples. For a diagnostic laboratory that receives a large number of samples frequently, one-step RT-PCR is extremely convenient for sample processing. Moreover, with respect to the detection ability of the assay, one-step RT-PCR can be comparable to real-time RT-PCRs (Batten et al., 2008, 2009). However, our experiences have implied that the efficacy of commercially available one-step RT-PCR kits can be varied and that the selection of the kits for a given reaction is crucial because the kit chosen influences the efficacy and also the diagnostic sensitivity heavily. The aim of the present study was to compare analytical sensitivity of several commercially available one-step RT-PCR kits in combination with different primer sets to detect BTV RNA. To measure the analytical sensitivity of one-step RT-PCR kits, at least three rounds of testing were carried out. In each testing round, seven RT-PCR kits were used to amplify a batch of serially diluted extracted RNA of each tested BTV strain with a given primer set. To avoid bias caused by possible RNA degradation following its dilution, the sequence of the seven RT-PCR kits in a given testing round was arranged with a random table. Two BTV strains, BTV2/KM/2003 (Ting et al., 2005) and BTV12/PT/2003 (Lee et al., 2010), were employed in this study. The
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
two BTV strains were propagated in a baby hamster kidney cell line, and the titer of the multiplied BTV in the virus suspension was 104.5 TCID50 /ml. Viral RNA was extracted from 140 l of the BTV suspension (equivalent to approximately 103.6 TCID50 of BTV), using QIAamp Viral RNA Mini Kit (QIAGEN Inc., Valencia, CA, USA). The extracted BTV RNA was dissolved in RNase-free double-distilled water and stored at −20 ◦ C until use. To prepare RNA samples for the comparison, the BTV RNA extracted from each strain was diluted serially 10-fold to a 107 dilution with RNase-free double-distilled water. The dilution was performed immediately before each round of testing and was used only for the round within two to three days. Three sets of RT-PCR primers were used in this study. The VP7F/VP7R primer pair was designed to amplify full-length BTV segment 7 that encodes structural protein VP7 (Lee et al., 2011). The BTVL3-1/BTVL3-2 primer pair was designed to amplify a 708-base pair region within segment 3 that encodes structural protein VP3 (Ohashi et al., 2004). The primer set of Primers A/B/C/D was used to amplify a 101-base pair region within nonstructural protein NS1 gene (Dangler et al., 1990). Seven commercially available one-step RT-PCR kits were evaluated in this study. The SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (SS-III kit; Invitrogen, Life Technologies, Carlsbad, CA, USA) is based on a version of M-MLV reverse transcriptase with reduced RNase H activity and a recombinant Taq DNA polymerase. The SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity (SS-III-HF kit; Invitrogen, Life Technologies, Carlsbad, CA, USA) is based on the M-MLV reverse transcriptase and a recombinant DNA polymerase, Pyrococcus species GB-D polymerase, with proofreading capability. The AccessQuick RT-PCR System (AccessQuick kit; Promega, Madison, WI, USA) is based on AMV reverse transcriptase and Tfl DNA polymerase. The QIAGEN OneStep RT-PCR Kit (QIAGEN kit; QIAGEN, Valencia, CA, USA) is based on two reverse transcriptases, Omniscript Reverse Transcriptase and Sensiscript Reverse Transcriptase, and HotStarTaq DNA polymerase. The One-Step RT-PCR Master Mix Kit (Novagen kit; Novagen, Merck Group, Madison, WI, USA) utilizes a recombinant Thermus thermophilus DNA polymerase which has both RNA-dependent and DNA-dependent DNA polymerase activities. The Fast-Run Hot Start RT-PCR (AMV) Kit (Fast-Run kit; Protech Technology Enterprise, Taipei City, Taiwan) is based on AMV reverse transcriptase and Taq DNA polymerase, and all the reactants are pre-mixed and lyophilized. The MasterAmp RT-PCR Kit for High Sensitivity (MasterAmp kit; EPICENTRE Biotechnologies, Madison, WI, USA) utilizes RetroAmp RT DNA Polymerase which is capable of catalyzing reverse transcription and DNA polymerization. All the RT-PCRs were performed with DNA Engine PTC-200 thermocycler (Bio-Rad Laboratories, Hercules, CA, USA). Manipulation of the seven RT-PCR kits followed the instruction manuals provided by their manufacturers, and the number of thermocycles was 40 for all kits. After RT-PCR was performed, 10 l of each reaction product was run out using 2% agarose gel electrophoresis with SYBR Safe DNA Gel Stain (Invitrogen). The reaction products were visualized by ultraviolet transillumination. The analytical sensitivity of the RT-PCR kit was determined as the lowest dilution at which amplified BTV RNA could be visualized following the agarose gel electrophoresis. To analyze the sequence variation of primer-annealed regions, available BTV nucleotide sequences from the GenBank Database were aligned by Molecular Evolutionary Genetic Analysis version 5.1, or MEGA 5.1 (Tamura et al., 2011). Before comparing the analytical sensitivity of the one-step RTPCR kits, the reaction conditions of each kit were optimized, and the
7
optimal conditions were determined as shown in Table 1. The optimal reaction concentrations of each primer were as follows: 0.2 M for the AccessQuick and Novagen kits; 0.25 M for the MasterAmp kit; 0.5 M for the SS-III, SS-III-HF, and Fast-Run kits; and 0.6 M for the QIAGEN kit. Using the MasterAmp kit, no product was generated. With Primers A/B/C/D, no product was generated by any of the RT-PCR kits employed in the present study. The analytical sensitivity of each one-step RT-PCR kit for detecting the two Taiwanese BTV strains with the two primer pairs, VP7F/VP7R and BTVL3-1/BTVL3-2, are shown in Table 2. The SSIII and QIAGEN kits demonstrated the best analytical sensitivities among the kits tested. Reverse transcription polymerase chain reaction is one of the most familiar tools supporting diagnoses of RNA viral infections. In addition to conventional RT-PCR, real-time RT-PCR has been also applied widely, including those to detect BTV RNA (Chatzinasiou et al., 2010; de Santis et al., 2004; Vanbinst et al., 2010). Meanwhile, although advanced, the machines and reagents for real-time RT-PCR are rather expensive and may not be affordable for every laboratory. Furthermore, conventional RT-PCRs have demonstrated a capacity comparable to that of real-time RT-PCRs (Batten et al., 2008, 2009). Conventional RT-PCR has therefore been accepted in many laboratories as a crucial part of diagnostic procedures. To this end, a quantitative comparison between the amplification abilities of commercially available conventional RT-PCR kits, in special reference to the one-step format, was conducted in this study to aid the selection of feasible kits. The abilities of the tested one-step RT-PCR kits to amplify BTV RNA varied. The differences in the analytical sensitivities of the kits were remarkable (Table 2). With the VP7F/VP7R primer pair for the detection of BTV12 RNA, for instance, a 104 -fold difference between the kits was observed. The SS-III, SS-III-HF, and QIAGEN kits offered superior performance, regardless of the primers that were used and the virus strains targeted. This variation in analytical sensitivities suggested that the selection of the RT-PCR system is critical and extensively influences the interpretation of diagnosis. The differences in analytical sensitivity might result from the enzymes used. In each RT-PCR kit, two enzyme activities are involved in the reaction: a reverse transcriptase activity and a thermostable DNA polymerase activity. For reverse transcriptase, there is no significant difference in the RNA-dependent DNA polymerase activities of the reverse transcriptases derived from Moloney murine leukemia virus (M-MLV) and avian myeloblastosis virus (AMV) (Verma, 1975). However, when reacting in the same tube with DNA polymerase, previous studies suggested that M-MLV and AMV can affect the activity of Taq polymerase (Lee et al., 1994; Sellner et al., 1992). Although information on the concentration and the extension rate of the enzymes used was not provided by the manufacturers, results of the present study echoed the study demonstrating that the SuperScript III reverse transcriptase is one of the recommended enzymes for detecting viral RNA (Okello et al., 2010) and the study reporting that the extension rate of Platinum Taq polymerase is higher than that of Pfu DNA polymerase (Markoulatos et al., 2003). Both SuperScript III reverse transcriptase and Platinum Taq polymerase are used in the SS-III kit. Additionally, the two kits with single-enzyme formulas (the Novagen kit and the MasterAmp kit), which employ T. thermophilus DNA polymerase, did not perform well in the present study. In contrast, a previous article reporting that the amplification ability of this enzyme surpassed that of Taq DNA polymerase (Shames et al., 1995) is inconsistent with the findings of this study. The primer set recommended by the World Organization for Animal Health, Primers A/B/C/D (Dangler et al., 1990), was unable to detect the Taiwanese BTV strains. With Primers A/B, no RTPCR product was observed in the present study regardless of the
8
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
Table 1 Reaction programs of the seven on-step reverse transcription polymerase chain reaction kits for detecting bluetongue viral RNA. Name of the kita
SS-III SS-III-HF AccessQuick QIAGEN Novagen Fast-Run MasterAmp
Initial heating
Reverse transcription
58 ◦ C, 5 min 58 ◦ C, 5 min – – 90 ◦ C, 0.5 min 58 ◦ C, 5 min –
42 ◦ C, 30 min 42 ◦ C, 30 min 45 ◦ C, 45 min 50 ◦ C, 30 min 60 ◦ C, 30 min 42 ◦ C, 30 min 60 ◦ C, 20 min
Denaturation
94 ◦ C, 2 min 94 ◦ C, 2 min 94 ◦ C, 2 min 95 ◦ C, 15 min 94 ◦ C, 1 min 94 ◦ C, 2 min –
Thermocycling
Final extension
Denaturation
Annealingb
Extension
94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 0.5 min
2 min 2 min 1 min 1 min 1 min 1 min 0.5 min
72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min
72 ◦ C, 5 min 72 ◦ C, 5 min 72 ◦ C, 5 min 72 ◦ C, 10 min 60 ◦ C, 7 min 72 ◦ C, 5 min 72 ◦ C, 7 min
a SS-III, SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase; SS-III-HF, SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity; AccessQuick, AccessQuick RT-PCR System; QIAGEN, QIAGEN OneStep RT-PCR Kit; Novagen, One-Step RT-PCR Master Mix Kit; Fast-Run, Fast-Run Hot Start RT-PCR (AMV) Kit; MasterAmp; MasterAmp RT-PCR Kit for High Sensitivity. b The annealing temperature was determined by the primers used. For VP7F/VP7R primers, the temperature was 58 ◦ C; for BTVL3-1/BTVL3-2 primers, the temperature was 55 ◦ C.
Table 2 Relative analytical sensitivity of six commercially available one-step RT-PCR kits for detecting bluetongue viral RNA. The numbers indicate log10 of the dilutions of the viral RNA. Kita
SS-III SS-III-HF AccessQuick QIAGEN Novagen Fast-Run
VP7F/VP7R primer pair
BTVL3-1/BTVL3-2 primer pair
BTV2
BTV12
3.67 ± 0.58 4.00 ± 1.00 2.67 ± 2.31 4.00 ± 0.00 NDb 2.33 ± 0.58
4.33 4.33 0.00 4.00 0.00 2.33
± ± ± ± ± ±
BTV2 0.58 0.58 0.00 0.00 0.00 0.58
4.00 3.17 2.83 3.67 1.17 2.00
BTV12 ± ± ± ± ± ±
0.89 1.47 0.98 0.82 0.41 0.71
3.67 2.00 1.33 2.67 0.33 0.00
± ± ± ± ± ±
1.53 1.00 0.58 0.53 0.58 0.00
a SS-III, SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase; SS-III-HF, SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity; AccessQuick, AccessQuick RT-PCR System; QIAGEN, QIAGEN OneStep RT-PCR Kit; Novagen, One-Step RT-PCR Master Mix Kit; Fast-Run, Fast-Run Hot Start RT-PCR (AMV) Kit. b Not detectable.
RT-PCR kit that was used. Each of the two Taiwanese BTV strains (AY462225 and GU390664) has four mismatched nucleotides in the Primer B annealing regions (Type V in Table 3), suggesting incomplete primer-template annealing during RT-PCR. Furthermore, to assess the annealing capabilities of the Primer A/B pair, the primer annealing regions of the available sequences of BTV NS1 gene were aligned. The alignment revealed that the annealing regions for Primer A were highly consistent (data not shown). Nevertheless, the annealing regions for Primer B were variable (Table 3). The numbers of mismatched nucleotides ranged from one (Types I and II) to
six (Type VIII), and 17 of the 47 strains (36%) had four or more mismatched nucleotides. These data suggested that when this primer pair, which derived from sequences of BTVs isolated in the United States more than three decades ago, is used to detect BTV RNA in clinical samples, a number of strains may not be detected. In summary, the one-step RT-PCR kit used is a crucial factor in the analytical sensitivity of viral RNA detection, as shown in the present study. In addition, the currently recommended RT-PCR primer pair for the detection of BTV RNA may not be useful for bluetongue diagnosis.
Table 3 Variation on the annealing regions of OIE-World Organization for Animal Health recommended Primer B AAGCCAGACTGTTTCCCGAT (Dangler et al., 1990) for detecting bluetongue viral RNA by reverse transcription polymerase chain reaction. The 20-nucleotide-long regions, nucleotides 264–283 of the genomic segment 5, of 47 bluetongue virus isolates were compared to present the nucleotide variation ranging from 1 to 6 nucleotides. Type of sequence
Sequence a
Frequency
Isolates (serotype [GenBank numbers])
Complementary sequence of Primer B
5 -ATCGGGAAACAGTCTGGCTT-3
8
Type I
5 -ATCGGGAAACAGTTTGGCTT-3
10
Type II Type III Type IV
5 -ATCGGGAAACAGTCTGGCTC-3 5 -ATCGGGAGACAGTCTGGCTC-3 5 -ATCGGGAAACAGTTTGGCTC-3
3 1 8
Type V Type VI
5 -ATCGAGAAACGGTTTGGCTC-3 5 -ATCGAGAGACGGTTTGGCTC-3
2 13
Type VII Type VIII
5 -ATCGAGAGACCGTTTGGCTG-3 5 -ACAGAGAAACAGTGTGGTTA-3
1 1
BTV2 [AM773689], BTV8 [AM498055], BTV10 [Y00422, NC006025], BTV11 [M97681], BTV13 [M97762], BTV17 [X15891, X17041] BTV2 [AM773686, AM773687, AM773688, AM773690, AM773706, DQ017956, M97680], BTV4 [AM778440, AM778441, DQ017958] BTV4 [AM778439], BTV9 [AM778442, DQ017962] BTV1 [AM778437] BTV2 [AM773683, AM773684, AM773685, AM773705, AY138895, JQ822252], BTV4 [DQ017957], BTV16 [DQ017960] BTV2 [AY462225], BTV12 [GU390664] BTV1 [AM778438], BTV9 [AM778443, AM778444, AM778445, DQ017959], BTV16 [AM772707, AM773691, AM773692, AM773694, AM773695, AM773696, DQ017961, DQ098100] BTV19 [X56735] BTV25 [EU839841]
a
The letter underlined indicates the nucleotide is mismatched to Primer.
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
Acknowledgements We appreciate Dr. Chia-Yi Chang for her critical suggestion on this manuscript. The study is supported by the Council of Agriculture Grant 99AS-9.2.2-H1-H1. References Barratt-Boyes, S.M., MacLachlan, N.J., 1994. Dynamics of viral spread in bluetongue virus infected calves. Vet. Microbiol. 40, 361–371. Batten, C.A., Bachanek-Bankowska, K., Bin-Tarif, A., Kgosana, L., Swain, A.J., Corteyn, M., Darpel, A., Mellor, P.S., Elliott, H.G., Oura, C.A.L., 2008. Bluetongue virus: European Community inter-laboratory comparison tests to evaluate ELISA and RT-PCR detection methods. Vet. Microbiol. 129, 80–88. Batten, C.A., Sanders, A.J., Bachanek-Bankowska, K., Bin-Tarif, A., Oura, C.A.L., 2009. Bluetongue virus: European Community proficiency test (2007) to evaluate ELISA and RT-PCR detection methods with special reference to pooling of samples. Vet. Microbiol. 135, 380–383. Bonneau, K.R., DeMaula, C.D., Mullens, B.A., MacLachlan, N.C., 2002. Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus- infected cattle and sheep. Vet. Microbiol. 88, 115–125. Chatzinasiou, E., Dovas, C.I., Papanastassopoulou, M., Georqiadis, M., Psychas, V., Bouzalas, I., Koumbati, M., Koptopoulos, G., 2010. Assessment of bluetongue viraemia in sheep by real-time PCR and correlation with viral infectivity. J. Virol. Methods 169, 305–315. Dangler, C.A., de Matto, C.A., de Matto, C.C., Osburn, B.I., 1990. Identifying bluetongue virus ribonucleic acid sequences by the polymerase chain reaction. J. Virol. Methods 28, 281–292. de Santis, P., Orrù, G., Solinas, F., Piras, V., Savini, G., Caporale, V., 2004. Molecular differentiation of field and vaccine strains of bluetongue virus serotype 2 using the real-time polymerase chain reaction and fluorescence resonance energy transfer hybridisation probes. Vet. Ital. 40, 572–576. Goltz, J., 1978. Bluetongue in cattle: a review. Can. Vet. J. 19, 95–98. Koumbati, M., Mangana, O., Nomikou, K., Mellor, P.S., Papadopoulos, O., 1999. Duration of bluetongue viraemia and serological responses in experimentally infected European breeds of sheep and goats. Vet. Microbiol. 64, 277– 285. Lee, F., Ting, L.J., Jong, M.H., Chang, W.M., Wang, F.I., 2010. Subclinical bluetongue virus infection in domestic ruminants in Taiwan. Vet. Microbiol. 142, 225– 231. Lee, F., Ting, L.J., Lee, M.S., Chang, W.M., Wang, F.I., 2011. Genetic analysis of two Taiwanese bluetongue viruses. Vet. Microbiol. 148, 140–149.
9
Lee, L.H., Ting, L.J., Shien, J.H., Shieh, H.K., 1994. Single-tube, noninterrupted reverse transcription-PCR for detection of infectious bursal disease virus. J. Clin. Microbiol. 32, 1268–1272. Luedke, A.J., Jochim, M.M., Jones, R.H., 1977. Bluetongue in cattle: effects of Culicoides variipennis-transmitted bluetongue virus on pregnant heifers and their calves. Am. J. Vet. Res. 38, 1687–1695. Maan, S., Maan, N.S., Nomikou, K., Veronesi, E., Bachanek-Bankowska, K., Belaganahalli, M.N., Attoui, H., Mertens, P.P.C., 2011. Complete genome characterisation of a novel 26th bluetongue virus serotype from Kuwait. PLoS ONE 6, e26147. MacLachlan, M.J., 2004. Bluetongue: pathogenesis and duration of viraemia. Vet. Ital. 40, 462–467. MacLachlan, N.J., Drew, C.P., Darpel, K.E., Worwa, G., 2009. The pathology and pathogenesis of bluetongue. J. Comp. Pathol. 141, 1–16. Markoulatos, P., Siafakas, N., Katsorchis, T., Moncany, M., 2003. Multiplex PCR: rapid DNA cycling in a conventional thermal cycler. J. Clin. Lab. Anal. 17, 108–112. Mellor, P.S., Boorman, 1995. The transmission and geographical spread of African horse sickness and bluetongue viruses. Ann. Trop. Med. Parasitol. 89, 1–15. Ohashi, S., Yoshida, K., Yanase, T., Kato, T., Tsuda, T., 2004. Simultaneous detection of bovine arboviruses using single-tube multiplex reverse transcriptionpolymerase chain reaction. J. Virol. Methods 120, 79–85. Okello, J.B., Rodriguez, J., Poinar, D., Bos, K., Okwi, A.L., Bimenya, G.S., Sewankambo, N.K., Henry, K.R., Kuch, M., Poinar, H.N., 2010. Quantitative assessment of the sensitivity of various commercial reverse transcriptases based on armored HIV RNA. PLoS ONE 10, e13931. Sellner, L.N., Coelen, R.J., Mackenzie, J.S., 1992. Reverse transcriptase inhibits Taq polymerase activity. Nucleic Acids Res. 11, 1487–1490. Shames, B., Fox, J.G., Dewhirst, F., Yan, L., Shen, Z., Taylor, N.S., 1995. Identification of a widespread Helicobacter hepaticus infection in feces in commercial mouse colonies by culture and PCR assay. J. Clin. Microbiol. 33, 2968–2972. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular Evolutionary Genetic Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Ting, L.J., Lee, M.S., Huang, T.S., Huang, C.C., Kuo, S.T., Lee, F., Jong, M.H., Shiau, J.R., Lin, S.Y., 2005. Identification of bluetongue virus in goats in Taiwan. Vet. Rec. 156, 52. Vanbinst, T., Vandenbussche, F., Dernelle, E., De Clercq, K., 2010. A duplex real-time RT-PCR for the detection of bluetongue virus in bovine semen. J. Virol. Methods 169, 162–168. Verma, I.M., 1975. Studies on reverse transcriptase of RNA tumor viruses III. Properties of Moloney murine leukemia virus DNA polymerase and associated RNase H. J. Virol. 15, 843–854. Vögtlin, A., Hofmann, M.A., Nenniger, C., Renzullo, S., Steinrigl, A., Loitsch, A., Schwermer, H., Kaufmann, C., Thür, B., 2013. Long-term infection of goats with bluetongue virus serotype 25. Vet. Microbiol. 166, 165–173.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Comparison of primer sets and one-step reverse transcription polymerase chain reaction kits for the detection of bluetongue viral RNA Fan Lee ∗ , Yeou-Liang Lin, Hsiang-Jung Tsai Animal Health Research Institute, 376 Chung-Cheng Road, Tamsui District, New Taipei City 25158, Taiwan
a b s t r a c t Article history: Received 8 September 2013 Received in revised form 8 January 2014 Accepted 9 January 2014 Available online 3 February 2014 Keywords: Bluetongue Primer Reverse transcription polymerase chain reaction
Bluetongue virus is the etiological agent of bluetongue, one of the most important insect-transmitted animal diseases in the world. To establish a feasible diagnostic procedure for detecting the viral RNA, seven commercially available one-step RT-PCR kits in combination with three primer sets were evaluated. Results of this study showed remarkable differences in analytical sensitivity between the examined RTPCR kits. In addition, it was found that a World Organization for Animal Health-recommended primer set may not be effective in detecting most BTV RNA. © 2014 Elsevier B.V. All rights reserved.
Bluetongue is one of the most important insect-transmitted diseases globally. Bluetongue virus (BTV), a member of the genus Orbivirus within the family Reoviridae, is the etiological agent of bluetongue, and 26 BTV serotypes have been identified (Maan et al., 2011). The virus is transmitted by Culicoides biting midges (Mellor and Boorman, 1995), and the disease affects primarily domestic and wild ruminants. In most ruminants, BTV infection is asymptomatic or mild, whereas the infection in some breeds of sheep may result in severe illness, characterized by facial edema, dermatitis, coronitis, abortion, and even death (Goltz, 1978; Luedke et al., 1977; MacLachlan et al., 2009). Infection of BTV can cause prolonged viremia in infected animals. After the infection, the virus can be sheltered by erythrocytes and continues to circulate in the blood for more than one month (Barratt-Boyes and MacLachlan, 1994; Bonneau et al., 2002; Koumbati et al., 1999; MacLachlan, 2004; Vögtlin et al., 2013). Therefore, for bluetongue diagnosis, detection of BTV or its genomic RNA within blood samples is meaningful; moreover, for quarantine and international trade, the detection is also helpful to identify livestock which carries BTV. Reverse transcription polymerase chain reaction (RT-PCR) has been employed widely in the rapid diagnosis of diseases caused
∗ Corresponding author. Tel.: +886 2 26212111x516; fax: +886 2 26225345. E-mail addresses: [email protected] (F. Lee), [email protected] (Y.-L. Lin), [email protected] (H.-J. Tsai). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.021
by RNA viruses, including bluetongue. One-step RT-PCR, which combines reverse transcription and thermo-cycling amplification in one test tube, has the advantages of not only decreasing the number of pipetting steps but also minimizing the risk of contamination between samples. For a diagnostic laboratory that receives a large number of samples frequently, one-step RT-PCR is extremely convenient for sample processing. Moreover, with respect to the detection ability of the assay, one-step RT-PCR can be comparable to real-time RT-PCRs (Batten et al., 2008, 2009). However, our experiences have implied that the efficacy of commercially available one-step RT-PCR kits can be varied and that the selection of the kits for a given reaction is crucial because the kit chosen influences the efficacy and also the diagnostic sensitivity heavily. The aim of the present study was to compare analytical sensitivity of several commercially available one-step RT-PCR kits in combination with different primer sets to detect BTV RNA. To measure the analytical sensitivity of one-step RT-PCR kits, at least three rounds of testing were carried out. In each testing round, seven RT-PCR kits were used to amplify a batch of serially diluted extracted RNA of each tested BTV strain with a given primer set. To avoid bias caused by possible RNA degradation following its dilution, the sequence of the seven RT-PCR kits in a given testing round was arranged with a random table. Two BTV strains, BTV2/KM/2003 (Ting et al., 2005) and BTV12/PT/2003 (Lee et al., 2010), were employed in this study. The
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
two BTV strains were propagated in a baby hamster kidney cell line, and the titer of the multiplied BTV in the virus suspension was 104.5 TCID50 /ml. Viral RNA was extracted from 140 l of the BTV suspension (equivalent to approximately 103.6 TCID50 of BTV), using QIAamp Viral RNA Mini Kit (QIAGEN Inc., Valencia, CA, USA). The extracted BTV RNA was dissolved in RNase-free double-distilled water and stored at −20 ◦ C until use. To prepare RNA samples for the comparison, the BTV RNA extracted from each strain was diluted serially 10-fold to a 107 dilution with RNase-free double-distilled water. The dilution was performed immediately before each round of testing and was used only for the round within two to three days. Three sets of RT-PCR primers were used in this study. The VP7F/VP7R primer pair was designed to amplify full-length BTV segment 7 that encodes structural protein VP7 (Lee et al., 2011). The BTVL3-1/BTVL3-2 primer pair was designed to amplify a 708-base pair region within segment 3 that encodes structural protein VP3 (Ohashi et al., 2004). The primer set of Primers A/B/C/D was used to amplify a 101-base pair region within nonstructural protein NS1 gene (Dangler et al., 1990). Seven commercially available one-step RT-PCR kits were evaluated in this study. The SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (SS-III kit; Invitrogen, Life Technologies, Carlsbad, CA, USA) is based on a version of M-MLV reverse transcriptase with reduced RNase H activity and a recombinant Taq DNA polymerase. The SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity (SS-III-HF kit; Invitrogen, Life Technologies, Carlsbad, CA, USA) is based on the M-MLV reverse transcriptase and a recombinant DNA polymerase, Pyrococcus species GB-D polymerase, with proofreading capability. The AccessQuick RT-PCR System (AccessQuick kit; Promega, Madison, WI, USA) is based on AMV reverse transcriptase and Tfl DNA polymerase. The QIAGEN OneStep RT-PCR Kit (QIAGEN kit; QIAGEN, Valencia, CA, USA) is based on two reverse transcriptases, Omniscript Reverse Transcriptase and Sensiscript Reverse Transcriptase, and HotStarTaq DNA polymerase. The One-Step RT-PCR Master Mix Kit (Novagen kit; Novagen, Merck Group, Madison, WI, USA) utilizes a recombinant Thermus thermophilus DNA polymerase which has both RNA-dependent and DNA-dependent DNA polymerase activities. The Fast-Run Hot Start RT-PCR (AMV) Kit (Fast-Run kit; Protech Technology Enterprise, Taipei City, Taiwan) is based on AMV reverse transcriptase and Taq DNA polymerase, and all the reactants are pre-mixed and lyophilized. The MasterAmp RT-PCR Kit for High Sensitivity (MasterAmp kit; EPICENTRE Biotechnologies, Madison, WI, USA) utilizes RetroAmp RT DNA Polymerase which is capable of catalyzing reverse transcription and DNA polymerization. All the RT-PCRs were performed with DNA Engine PTC-200 thermocycler (Bio-Rad Laboratories, Hercules, CA, USA). Manipulation of the seven RT-PCR kits followed the instruction manuals provided by their manufacturers, and the number of thermocycles was 40 for all kits. After RT-PCR was performed, 10 l of each reaction product was run out using 2% agarose gel electrophoresis with SYBR Safe DNA Gel Stain (Invitrogen). The reaction products were visualized by ultraviolet transillumination. The analytical sensitivity of the RT-PCR kit was determined as the lowest dilution at which amplified BTV RNA could be visualized following the agarose gel electrophoresis. To analyze the sequence variation of primer-annealed regions, available BTV nucleotide sequences from the GenBank Database were aligned by Molecular Evolutionary Genetic Analysis version 5.1, or MEGA 5.1 (Tamura et al., 2011). Before comparing the analytical sensitivity of the one-step RTPCR kits, the reaction conditions of each kit were optimized, and the
7
optimal conditions were determined as shown in Table 1. The optimal reaction concentrations of each primer were as follows: 0.2 M for the AccessQuick and Novagen kits; 0.25 M for the MasterAmp kit; 0.5 M for the SS-III, SS-III-HF, and Fast-Run kits; and 0.6 M for the QIAGEN kit. Using the MasterAmp kit, no product was generated. With Primers A/B/C/D, no product was generated by any of the RT-PCR kits employed in the present study. The analytical sensitivity of each one-step RT-PCR kit for detecting the two Taiwanese BTV strains with the two primer pairs, VP7F/VP7R and BTVL3-1/BTVL3-2, are shown in Table 2. The SSIII and QIAGEN kits demonstrated the best analytical sensitivities among the kits tested. Reverse transcription polymerase chain reaction is one of the most familiar tools supporting diagnoses of RNA viral infections. In addition to conventional RT-PCR, real-time RT-PCR has been also applied widely, including those to detect BTV RNA (Chatzinasiou et al., 2010; de Santis et al., 2004; Vanbinst et al., 2010). Meanwhile, although advanced, the machines and reagents for real-time RT-PCR are rather expensive and may not be affordable for every laboratory. Furthermore, conventional RT-PCRs have demonstrated a capacity comparable to that of real-time RT-PCRs (Batten et al., 2008, 2009). Conventional RT-PCR has therefore been accepted in many laboratories as a crucial part of diagnostic procedures. To this end, a quantitative comparison between the amplification abilities of commercially available conventional RT-PCR kits, in special reference to the one-step format, was conducted in this study to aid the selection of feasible kits. The abilities of the tested one-step RT-PCR kits to amplify BTV RNA varied. The differences in the analytical sensitivities of the kits were remarkable (Table 2). With the VP7F/VP7R primer pair for the detection of BTV12 RNA, for instance, a 104 -fold difference between the kits was observed. The SS-III, SS-III-HF, and QIAGEN kits offered superior performance, regardless of the primers that were used and the virus strains targeted. This variation in analytical sensitivities suggested that the selection of the RT-PCR system is critical and extensively influences the interpretation of diagnosis. The differences in analytical sensitivity might result from the enzymes used. In each RT-PCR kit, two enzyme activities are involved in the reaction: a reverse transcriptase activity and a thermostable DNA polymerase activity. For reverse transcriptase, there is no significant difference in the RNA-dependent DNA polymerase activities of the reverse transcriptases derived from Moloney murine leukemia virus (M-MLV) and avian myeloblastosis virus (AMV) (Verma, 1975). However, when reacting in the same tube with DNA polymerase, previous studies suggested that M-MLV and AMV can affect the activity of Taq polymerase (Lee et al., 1994; Sellner et al., 1992). Although information on the concentration and the extension rate of the enzymes used was not provided by the manufacturers, results of the present study echoed the study demonstrating that the SuperScript III reverse transcriptase is one of the recommended enzymes for detecting viral RNA (Okello et al., 2010) and the study reporting that the extension rate of Platinum Taq polymerase is higher than that of Pfu DNA polymerase (Markoulatos et al., 2003). Both SuperScript III reverse transcriptase and Platinum Taq polymerase are used in the SS-III kit. Additionally, the two kits with single-enzyme formulas (the Novagen kit and the MasterAmp kit), which employ T. thermophilus DNA polymerase, did not perform well in the present study. In contrast, a previous article reporting that the amplification ability of this enzyme surpassed that of Taq DNA polymerase (Shames et al., 1995) is inconsistent with the findings of this study. The primer set recommended by the World Organization for Animal Health, Primers A/B/C/D (Dangler et al., 1990), was unable to detect the Taiwanese BTV strains. With Primers A/B, no RTPCR product was observed in the present study regardless of the
8
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
Table 1 Reaction programs of the seven on-step reverse transcription polymerase chain reaction kits for detecting bluetongue viral RNA. Name of the kita
SS-III SS-III-HF AccessQuick QIAGEN Novagen Fast-Run MasterAmp
Initial heating
Reverse transcription
58 ◦ C, 5 min 58 ◦ C, 5 min – – 90 ◦ C, 0.5 min 58 ◦ C, 5 min –
42 ◦ C, 30 min 42 ◦ C, 30 min 45 ◦ C, 45 min 50 ◦ C, 30 min 60 ◦ C, 30 min 42 ◦ C, 30 min 60 ◦ C, 20 min
Denaturation
94 ◦ C, 2 min 94 ◦ C, 2 min 94 ◦ C, 2 min 95 ◦ C, 15 min 94 ◦ C, 1 min 94 ◦ C, 2 min –
Thermocycling
Final extension
Denaturation
Annealingb
Extension
94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 1 min 94 ◦ C, 0.5 min
2 min 2 min 1 min 1 min 1 min 1 min 0.5 min
72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min 72 ◦ C, 1 min
72 ◦ C, 5 min 72 ◦ C, 5 min 72 ◦ C, 5 min 72 ◦ C, 10 min 60 ◦ C, 7 min 72 ◦ C, 5 min 72 ◦ C, 7 min
a SS-III, SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase; SS-III-HF, SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity; AccessQuick, AccessQuick RT-PCR System; QIAGEN, QIAGEN OneStep RT-PCR Kit; Novagen, One-Step RT-PCR Master Mix Kit; Fast-Run, Fast-Run Hot Start RT-PCR (AMV) Kit; MasterAmp; MasterAmp RT-PCR Kit for High Sensitivity. b The annealing temperature was determined by the primers used. For VP7F/VP7R primers, the temperature was 58 ◦ C; for BTVL3-1/BTVL3-2 primers, the temperature was 55 ◦ C.
Table 2 Relative analytical sensitivity of six commercially available one-step RT-PCR kits for detecting bluetongue viral RNA. The numbers indicate log10 of the dilutions of the viral RNA. Kita
SS-III SS-III-HF AccessQuick QIAGEN Novagen Fast-Run
VP7F/VP7R primer pair
BTVL3-1/BTVL3-2 primer pair
BTV2
BTV12
3.67 ± 0.58 4.00 ± 1.00 2.67 ± 2.31 4.00 ± 0.00 NDb 2.33 ± 0.58
4.33 4.33 0.00 4.00 0.00 2.33
± ± ± ± ± ±
BTV2 0.58 0.58 0.00 0.00 0.00 0.58
4.00 3.17 2.83 3.67 1.17 2.00
BTV12 ± ± ± ± ± ±
0.89 1.47 0.98 0.82 0.41 0.71
3.67 2.00 1.33 2.67 0.33 0.00
± ± ± ± ± ±
1.53 1.00 0.58 0.53 0.58 0.00
a SS-III, SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase; SS-III-HF, SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity; AccessQuick, AccessQuick RT-PCR System; QIAGEN, QIAGEN OneStep RT-PCR Kit; Novagen, One-Step RT-PCR Master Mix Kit; Fast-Run, Fast-Run Hot Start RT-PCR (AMV) Kit. b Not detectable.
RT-PCR kit that was used. Each of the two Taiwanese BTV strains (AY462225 and GU390664) has four mismatched nucleotides in the Primer B annealing regions (Type V in Table 3), suggesting incomplete primer-template annealing during RT-PCR. Furthermore, to assess the annealing capabilities of the Primer A/B pair, the primer annealing regions of the available sequences of BTV NS1 gene were aligned. The alignment revealed that the annealing regions for Primer A were highly consistent (data not shown). Nevertheless, the annealing regions for Primer B were variable (Table 3). The numbers of mismatched nucleotides ranged from one (Types I and II) to
six (Type VIII), and 17 of the 47 strains (36%) had four or more mismatched nucleotides. These data suggested that when this primer pair, which derived from sequences of BTVs isolated in the United States more than three decades ago, is used to detect BTV RNA in clinical samples, a number of strains may not be detected. In summary, the one-step RT-PCR kit used is a crucial factor in the analytical sensitivity of viral RNA detection, as shown in the present study. In addition, the currently recommended RT-PCR primer pair for the detection of BTV RNA may not be useful for bluetongue diagnosis.
Table 3 Variation on the annealing regions of OIE-World Organization for Animal Health recommended Primer B AAGCCAGACTGTTTCCCGAT (Dangler et al., 1990) for detecting bluetongue viral RNA by reverse transcription polymerase chain reaction. The 20-nucleotide-long regions, nucleotides 264–283 of the genomic segment 5, of 47 bluetongue virus isolates were compared to present the nucleotide variation ranging from 1 to 6 nucleotides. Type of sequence
Sequence a
Frequency
Isolates (serotype [GenBank numbers])
Complementary sequence of Primer B
5 -ATCGGGAAACAGTCTGGCTT-3
8
Type I
5 -ATCGGGAAACAGTTTGGCTT-3
10
Type II Type III Type IV
5 -ATCGGGAAACAGTCTGGCTC-3 5 -ATCGGGAGACAGTCTGGCTC-3 5 -ATCGGGAAACAGTTTGGCTC-3
3 1 8
Type V Type VI
5 -ATCGAGAAACGGTTTGGCTC-3 5 -ATCGAGAGACGGTTTGGCTC-3
2 13
Type VII Type VIII
5 -ATCGAGAGACCGTTTGGCTG-3 5 -ACAGAGAAACAGTGTGGTTA-3
1 1
BTV2 [AM773689], BTV8 [AM498055], BTV10 [Y00422, NC006025], BTV11 [M97681], BTV13 [M97762], BTV17 [X15891, X17041] BTV2 [AM773686, AM773687, AM773688, AM773690, AM773706, DQ017956, M97680], BTV4 [AM778440, AM778441, DQ017958] BTV4 [AM778439], BTV9 [AM778442, DQ017962] BTV1 [AM778437] BTV2 [AM773683, AM773684, AM773685, AM773705, AY138895, JQ822252], BTV4 [DQ017957], BTV16 [DQ017960] BTV2 [AY462225], BTV12 [GU390664] BTV1 [AM778438], BTV9 [AM778443, AM778444, AM778445, DQ017959], BTV16 [AM772707, AM773691, AM773692, AM773694, AM773695, AM773696, DQ017961, DQ098100] BTV19 [X56735] BTV25 [EU839841]
a
The letter underlined indicates the nucleotide is mismatched to Primer.
F. Lee et al. / Journal of Virological Methods 200 (2014) 6–9
Acknowledgements We appreciate Dr. Chia-Yi Chang for her critical suggestion on this manuscript. The study is supported by the Council of Agriculture Grant 99AS-9.2.2-H1-H1. References Barratt-Boyes, S.M., MacLachlan, N.J., 1994. Dynamics of viral spread in bluetongue virus infected calves. Vet. Microbiol. 40, 361–371. Batten, C.A., Bachanek-Bankowska, K., Bin-Tarif, A., Kgosana, L., Swain, A.J., Corteyn, M., Darpel, A., Mellor, P.S., Elliott, H.G., Oura, C.A.L., 2008. Bluetongue virus: European Community inter-laboratory comparison tests to evaluate ELISA and RT-PCR detection methods. Vet. Microbiol. 129, 80–88. Batten, C.A., Sanders, A.J., Bachanek-Bankowska, K., Bin-Tarif, A., Oura, C.A.L., 2009. Bluetongue virus: European Community proficiency test (2007) to evaluate ELISA and RT-PCR detection methods with special reference to pooling of samples. Vet. Microbiol. 135, 380–383. Bonneau, K.R., DeMaula, C.D., Mullens, B.A., MacLachlan, N.C., 2002. Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus- infected cattle and sheep. Vet. Microbiol. 88, 115–125. Chatzinasiou, E., Dovas, C.I., Papanastassopoulou, M., Georqiadis, M., Psychas, V., Bouzalas, I., Koumbati, M., Koptopoulos, G., 2010. Assessment of bluetongue viraemia in sheep by real-time PCR and correlation with viral infectivity. J. Virol. Methods 169, 305–315. Dangler, C.A., de Matto, C.A., de Matto, C.C., Osburn, B.I., 1990. Identifying bluetongue virus ribonucleic acid sequences by the polymerase chain reaction. J. Virol. Methods 28, 281–292. de Santis, P., Orrù, G., Solinas, F., Piras, V., Savini, G., Caporale, V., 2004. Molecular differentiation of field and vaccine strains of bluetongue virus serotype 2 using the real-time polymerase chain reaction and fluorescence resonance energy transfer hybridisation probes. Vet. Ital. 40, 572–576. Goltz, J., 1978. Bluetongue in cattle: a review. Can. Vet. J. 19, 95–98. Koumbati, M., Mangana, O., Nomikou, K., Mellor, P.S., Papadopoulos, O., 1999. Duration of bluetongue viraemia and serological responses in experimentally infected European breeds of sheep and goats. Vet. Microbiol. 64, 277– 285. Lee, F., Ting, L.J., Jong, M.H., Chang, W.M., Wang, F.I., 2010. Subclinical bluetongue virus infection in domestic ruminants in Taiwan. Vet. Microbiol. 142, 225– 231. Lee, F., Ting, L.J., Lee, M.S., Chang, W.M., Wang, F.I., 2011. Genetic analysis of two Taiwanese bluetongue viruses. Vet. Microbiol. 148, 140–149.
9
Lee, L.H., Ting, L.J., Shien, J.H., Shieh, H.K., 1994. Single-tube, noninterrupted reverse transcription-PCR for detection of infectious bursal disease virus. J. Clin. Microbiol. 32, 1268–1272. Luedke, A.J., Jochim, M.M., Jones, R.H., 1977. Bluetongue in cattle: effects of Culicoides variipennis-transmitted bluetongue virus on pregnant heifers and their calves. Am. J. Vet. Res. 38, 1687–1695. Maan, S., Maan, N.S., Nomikou, K., Veronesi, E., Bachanek-Bankowska, K., Belaganahalli, M.N., Attoui, H., Mertens, P.P.C., 2011. Complete genome characterisation of a novel 26th bluetongue virus serotype from Kuwait. PLoS ONE 6, e26147. MacLachlan, M.J., 2004. Bluetongue: pathogenesis and duration of viraemia. Vet. Ital. 40, 462–467. MacLachlan, N.J., Drew, C.P., Darpel, K.E., Worwa, G., 2009. The pathology and pathogenesis of bluetongue. J. Comp. Pathol. 141, 1–16. Markoulatos, P., Siafakas, N., Katsorchis, T., Moncany, M., 2003. Multiplex PCR: rapid DNA cycling in a conventional thermal cycler. J. Clin. Lab. Anal. 17, 108–112. Mellor, P.S., Boorman, 1995. The transmission and geographical spread of African horse sickness and bluetongue viruses. Ann. Trop. Med. Parasitol. 89, 1–15. Ohashi, S., Yoshida, K., Yanase, T., Kato, T., Tsuda, T., 2004. Simultaneous detection of bovine arboviruses using single-tube multiplex reverse transcriptionpolymerase chain reaction. J. Virol. Methods 120, 79–85. Okello, J.B., Rodriguez, J., Poinar, D., Bos, K., Okwi, A.L., Bimenya, G.S., Sewankambo, N.K., Henry, K.R., Kuch, M., Poinar, H.N., 2010. Quantitative assessment of the sensitivity of various commercial reverse transcriptases based on armored HIV RNA. PLoS ONE 10, e13931. Sellner, L.N., Coelen, R.J., Mackenzie, J.S., 1992. Reverse transcriptase inhibits Taq polymerase activity. Nucleic Acids Res. 11, 1487–1490. Shames, B., Fox, J.G., Dewhirst, F., Yan, L., Shen, Z., Taylor, N.S., 1995. Identification of a widespread Helicobacter hepaticus infection in feces in commercial mouse colonies by culture and PCR assay. J. Clin. Microbiol. 33, 2968–2972. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular Evolutionary Genetic Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Ting, L.J., Lee, M.S., Huang, T.S., Huang, C.C., Kuo, S.T., Lee, F., Jong, M.H., Shiau, J.R., Lin, S.Y., 2005. Identification of bluetongue virus in goats in Taiwan. Vet. Rec. 156, 52. Vanbinst, T., Vandenbussche, F., Dernelle, E., De Clercq, K., 2010. A duplex real-time RT-PCR for the detection of bluetongue virus in bovine semen. J. Virol. Methods 169, 162–168. Verma, I.M., 1975. Studies on reverse transcriptase of RNA tumor viruses III. Properties of Moloney murine leukemia virus DNA polymerase and associated RNase H. J. Virol. 15, 843–854. Vögtlin, A., Hofmann, M.A., Nenniger, C., Renzullo, S., Steinrigl, A., Loitsch, A., Schwermer, H., Kaufmann, C., Thür, B., 2013. Long-term infection of goats with bluetongue virus serotype 25. Vet. Microbiol. 166, 165–173.