- Email: [email protected]
Diagnosis of Legionella infection by reverse transcription of 5S-ribosomal RNA and polymerase chain reaction
Diagnosis of
Legionella Infection by Reverse Transcription of 5S-Ribosomal RNA and Polymerase Chain Reaction M i c h i o K o i d e * a n d Atsushi Saito
First Department of Internal Medicine, Faculty of Medicine, University of the Ryukyus, Okinawa, Japan
We investigated a diagnostic method for legionellosis that uses detection of Legionella 5S ribosomal RNA by reverse transcription-polymerase chain reaction (RT-PCR). Primer L5SR105, located between base pairs 105 and 119 of the Legionella 5S ribosomal RNA, was used for reverse transcription. Primer L5SL2, located between 2 and 21 bp of the Legionella 5S ribosomal RNA, and primer L5SR84, located between 84 and t 03 bp, were used for the polymerase chain reaction (PCR). We found that 8-methoxypsoralen at a concentration of 25 pg/mL followed by 20 minutes of ultraviolet irradiation (366 nm) was adequate for elimination of DNA contamination when using Sorenson-transparent microtubes. The specificity of the RT-PCR system was determined by using 27 Legionella species (42 strains) and 9 non-Legionella strains. Of these, 23 species (38 strains) showed positive results. Subsequently, the elimination step for PCR mixtures was followed by RT-PCRof clinical samples. We examined 6 samples from 2 patients with positive cultures with this RT-PCR method, and showed results 102 to 10~times more sensitive than the mip-primer-PCR method. Furthermore, 2 of the patient samples negative by culture and mip-primer-PCR assay showed a positive reaction with this RTPCR method. Our results suggest that this RT-PCRtechnique may be a useful diagnostic tool for legionellosis. J Infect Chemother 1998;4:6 11 Key words : Legionella detection, 5S-RT-PCR, 8-methoxypsoralen, DNA contamination
INTRODUCTION
technique using reference cultures of Legionella and nonLegionella bacteria. Subsequently, we evaluated this
Legionella detection by using a polymerase chain reaction
m e t h o d by using clinical specimens.
(PCR) method using 5S-ribosomal D N A primers that detect 5S-rRNA complementary chromosomal regions was first reported by Mahbubani and colleagues. 1 But this primer produced 104-bp P C R products not only from Legionella D N A , b u t also f r o m Pseudomonas a n d Acinetobacter DNA. Therefore, Southern blot hybridization was necessary to differentiate the P C R products of Legionella from those ofnon-Legionella bacteria, a In addition, there were reports regarding contamination of Taq-polymerase by eubac~erial DNA. ~6 Ultraviolet (UV) irradiation after the addition of psoralene to the P C R mixture was p e r f o r m e d to avoid amplification of contaminated eubacterial ribosomal D N A sequences. Psoralens are known to intercalate into double-stranded nucleic acids and form a covalent interstrand cross-link after photoactivation with light at 320 to 400 nm. In this study, we investigated the reverse transcription-polymerase chain reaction (RT-PCR) m e t h o d for detecting Legionella ribosomal RNA. Sequences of RTP C R - p r i m e r s were in conformity with the r R N A sequences of different legionellae strains, but were very different f r o m non-Legionella bacteria. First, we investigated the specificity and sensitivity of the R T - P C R
Received May 16, 1997; revised Jul. 23, 1997; accepted for publication in revised form Oct. 14, 1997. *Correspondence and requests for reprints to: First Department of Internal Medicine, Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan.
6
MATERIALS A N D METHODS
Bacterial strains To determine the specificity of legionellae detection by the RT-PCR method, 27 Legionella species (42 strains) and 9 non-Legionella strains were used (Table 1). T h e Legionella strains were grown on BCYE a medium (Oxoid, Hampshire, U K ) at 37~ for 4 days, non-Legionella bacteria were grown on trypticase soy agar medium (Difco, Detroit, MI, USA) at 37~ for 24 hours and suspended in distilled water to prepare 10 s C F U / m L solutions and their serial tenfold dilutions. One-milliliter aliquots of these solutions were used to prepare P C R samples.
Clinical
samples
A total of 28 samples were selected from samples that were sent f r o m all over Japan between 1992 and 1996. These respiratory samples from 24 patients were available within 14 days from the onset of illness, and it was possible to collect paired sera. Six respiratory tract specim e n s were c o l l e c t e d f r o m 2 p a t i e n t s f r o m w h o m Legionella had b e e n isolated. One s p u t u m and 1 pleural fluid specimen that were positive by mip (macrophage infectivity potentiator gene; specific for L. pneumophila)p r i m e r P C R , 7 but negative by culture findings, were sampled from 2 separate patients. Twenty respiratory tract specimens were collected from 20 patients who were clinically suspected of having legionellosis, but
1341-321)(/98/0401-0006/US$3.009 JSC/CLJ 1998
Diagnosis of Legionella infection by RToPCR
were negative by mip-primer P C R and by culture findings (10 cases were positive by indirect fluorescent antibody staining and 10 cases were negative by indirect fluorescent antibody staining). Table 1. The 27 Legionella species (42 strains) and 9 non-Legionella strains that were used to determine the specificity of legionellae detection by reverse transcription-polymerase chain reaction.
Legionella strains L. 9neumophila serogroup 1 ATCC 33152 L. pneumophila serogroup 2 ATCC 33154 L. 9neumophila serogroup 3 ATCC 33155 L. ~neumophila serogroup 4 ATCC 33156 L. 9neumophila serogroup 5 ATCC 33216 L. 9neumophila serogroup 6 ATCC 33215 L. 9neumophila serogroup 7 ATCC 33823 L. 9neumophila serogroup 8 ATCC 35096 L. 9neumophila serogroup 9 ATCC 35289 L. 9neumophila serogroup 10 ATCC 43283 L. pneumophila serogroupl 1 ATCC 43130 L. pneumophila serogroup 12 ATCC 43290 L. pneumophila serogroup 13 ATCC 43736 L. pneumophila serogroupl 4 ATCC 43703 L. bozemanii serogroup 1 ATCC 3321 7 L. bozemanii serogroup 2 ATCC 35545 L. dumoffii ATCC 33279 L, gormanii ATCC 33297 L. micdadei ATCC 33218 L. Iongbeachae serogroup 1 ATCC 33462 L. Iongbeachae serogroup 2 ATCC 33484 L. jordanis ATCC 33623 L. oakridgensis ATCC 33761 L. wadsworthii ATCC 33877 L. feeleii serogroup 1 ATCC 35072 L. sainthelensi serogroup 1 ATCC 35248 L. anisa ATCC 35292 L. santicrusis ATCC 35301 L. steigerwaltii ATCC 35302 L. parisiensis ATCC 35299 L. spiritensis serogroup 1 ATCC 35249 L. hackeliae serogroup 1 ATCC 35250 L. maceachernii ATCC 35300 L. jamestowniensis ATCC 35298 L. cherrii ATCC35252 L. rubrilucens ATCC 35304 L. erythra serogroup 1 ATCC 35303 L. israelensis ATCC 43119 L. birminghamensis ATCC 43702 L. cincinnatiensis ATCC 43753 L. moravica ATCC 43877 L. brunensis ATCC 43878 Non-Legionelfa bacteria Pseudomonas aeruginosa ATCC 27853 Pseudomonas fluorescens ATCC 13525 Acinetobacter calcoaceticus ATCC 23055 Staphylococcus aureus ATCC 25923 Enterococcus faecalis ATCC 29212 Clinical isolates of non-Legionella bacteria Stenotrophomonas maltophilia Alcaligenes faecalis Staphylococcus epidermidis Candidia albicans
Primers A 15mer primer L5SR105 (5'-ATCCTGGCGATGACC-3') located between base pair 105 and 119 of the Legionella 5S-ribosomal RNA was used for reverse transcription. Primers L5SL2 (5'-TCq~GGCGACTATAGCGATF-3') located between base pair 2 and 21 of the Legionella 5S-ribosomal RNA, and LSSR84 (5'-ACqqq'CGCATGAGGAAGCCT-3') located between base pair 84 and 103 were used for P C R reaction (Fig. 1).s,9
Extraction of RNA from samples Bacterial suspensions (1.0 m L ) or clinical samples (1.0 m L ) in a polypropylene tube were heat treated for 15 minutes at 100~ with 1.0-g glass beads (1.5 m m in diameter) . T h e n 100 p L of T r i s - E D T A buffer (10 m m o l / LTris-HC1, 1 m m o l / L E D T A [pH 8.0]) and 100 ~/L of proteinase K (0.1 mg) were added to the s a m p l e s . T h e y were incubated at 55~ for 2 hours in a water bath and then boiled at 100~ for 5 minutes. Five h u n d r e d / I L of solution D (4 mol/L guanidiumthiocyanate, 25 m m o l / L sodium citrate [pH 7.0], 0.5% sodium laurel sarcosin, 0.1mol/L 2-mercaptoethanol) and 50 //L of 2 m o l / L sodium acetate ( p H 4.0) and 0.5 m L o f p h e n o l - c h l o r o form-isoamylalcohol solution (25:24:1) were a d d e d to the heat-treated samples.They were vortexed and centrifuged at 10,000y for 15 minutes. T h e upper aqueous layer was moved to a new tube and equal volume of the same solutions added (solution D:sodium acetate:phenol-chloroform-isoamylalcohol solution). T h e mixture was centrifuged at 10,000c/for 30 minutes, and the aqueous layer was moved to a new tube and an equal volume of isopropanol was added. T h e resulting mixture was centrifuged at 25,000y for 30 minutes at 4~ T h e aqueous layer was discarded, and the remaining sediment was washed with 1 m L of 70% ethanol and recentrifuged at 25,000y for 30 m i n utes at 4~ T h e resultant sediment was dried at r o o m t e m p e r a t u r e for 30 minutes. One h u n d r e d btL volumes of serial tenfold dilution of clinical samples were treated by the same m e t h o d with one-tenth volume of each reagent. Dried R N A was dissolved with 8/,/L of distilled water and 2/,tL ofribonuclease inhibitor (280 U ; T a k a r a Shuzo, Shiga, Japan).
Reverse transcription using 5S-ribosomal RNA One microliter of the extracted RNA, 1 /IL of primer L5SR103 (10 mmol/L) and 4 # L of x 5 first-strand buffer (250 mmol/LTris-HC1 [pH 8.3], 375 m m o l / L potassium chloride [KC1], and 15 m m o l / L m a g n e s i u m chloride [MgC12] were transferred to a microtube and heat-treated at 94~ for 5 minutes and then at 50~ for 15 minutes. T w o / I L of deoxyribonucleoside triphosphate ( d N T P ) solution (dATP, d G T P , dCTP, d T T P , each 5 retool/L), 2 ~ L of 0.1 mol/L dithiothreitol and 1//L ofMoloney murine leukemia virus reverse transcriptase (200 U; Gibco B R L Life Technologies, Rockville, M D , USA) were added to the tube and reacted at 37~ for 1 hour and then at 92~
J Infect Chemother 1998;4:6-11 2
21 42 45 84
103
L. pneumophila
-UCUUGGCGACUAUAGCGAUU UCGA AGGCUUCCUCAUGCGAAAGU
A. calcoaceticus
GoC . . . . . . .
P. fluorescens
.....
A .... C .... A'CA"
C''"
G''U .... C .... U~176176
P. aeruginosa
G .... A,,,UC .... A.CG,
C,,-
G-.UC-..C .... U~
(cDNA)
TCTFGGCGACTATAGCGATF
C . . . . . A.GA
C "~176 G ' - U ~
.... U-,G,,.
TCCGAAGGAGTACGCTITCA
primer L5SL2
Taq 1
primer L5SR84
Fig. 1. Comparison of the alignment of the primer positions and Taq-1 restriction site in the 5S-ribosomal RNA between Legionella and systematically resembling bacteria. The common nucleotides are indicated by dots. The deleted nucleotides are indicated by dashes.
for 5 minutes. T h e excess primer was digested by adding 2 BL of exonuclease I (20 U, A m e r s h a m Life Science, Cleveland, O H , USA) followed by treating at 37~ for 15 minutes and at 80~ for 15 minutes. T h e resultant ribosomal-RNA complementary D N A sequence (2 to 119) was used for the following P C R reaction.
Elimination of contaminated DNA in polymerase chain reaction mixtures Eighty microliters of P C R reaction mixture that contained 10 mmol/LTris-HCl [pH 8.3], 50 mmol/L KC1, 3.0 retool/ L MgCl 2 , and 10 mg/L gelatin, 200 ~tmol/L each of the deoxynucleoside triphosphates, and 2.5 U of AmpliTaq D N A polymerase (Perkin-Elmer, Branchburg, NJ, USA) were used. A stock solutign of 2.5 m g / m L was prepared by dissolving 8-methoxypsoralen (Sigma Chemical, St. Louis, M O , USA) in dimethyl sulfoxide (Sigma Chemical). Appropriate dilutions of 8-methoxypsoralen in dimethyl s u l f o x i d e w e r e p r e p a r e d to r e s u l t in a final concentration of 1% dimethyl sulfoxide in the P C R mixture ( 1 / / L each of 12.5 Ftg/mL, 25 pg/mL, 50 #g/mL, 100 p g / m L solutions). T h e t r a n s p a r e n t 0 . 6 5 - m L plastic microcentrifuge tubes (Sorenson Bioscience, Salt Lake City, UT, USA) that contained 80/2L P C R mixture were irradiated from the side at a distance of 1 cm with longwave (366 nm) U V radiation by using a conventional U V hand monitor (UVP, San Gabriel, CA, USA) for 10, 15, 20, 25, 30, 35, and 40 minutes each. After U V treatment, we added 1 0 / t L of RT-products that contained c D N A from 102 C F U of L. pneumophila serogroup 1, 5 p L of primer L5SR84 and 5 p L of primer LSSL2 to the mixture and determined the P C R conditions. T h e samples (100/.tL) were initially denatured at 94~ for 5 minutes, and then a total of 35 P C R cycles
were performed by using a 3-temperature cycle with denaturation at 94~ for 1 minute, primer annealing at 55~ for 1 minute, and extension at 72~ for 1 minute. P C R amplified D N A s were separated by 4% Nuceive 3:1 (Takara Shuzo, Otsu, Japan) horizontal agarose gels. T h e gels were stained in 2 p g / m L ethidium bromide and observed with a U V transilluminator. After determining the necessary 8-methoxypsoralen concentration and U V irradiation time, we investigated the sensitivity of this P C R mixture-primer complex by adding RT-products that contained c D N A from the following: 102, 10, 1, 0.1, 0.01, and 0.001 C F U of L. pneumophila serogroup 1. As the second-stage P C R , 1 p L of these P C R - p r o d ucts was added to respective new mixtures and amplified with the same temperature cycle (94-55-72~ 35 cycles). T h e n we added RT-products from 106 and 102 C F U of various Legionella species and various non-Legionella bacteria to this mixture and investigated the specificity of these primers.
Polymerase chain reaction conditions for clinical samples O n e / / L of 2 5 g / m L 8-methoxypsoralen was added to 80 # L of the P C R mixtures and irradiated with U V for 20 minutes. T h e n 5 p L of p r i m e r L5SR84, 5 p L of p r i m e r LSSL2 and 10 BL of RT-products from clinical samples or their serial tenfold dilutions were added to this P C R mixture. T h e P C R p r o c e d u r e was p e r f o r m e d as described above.
Restriction enzyme analysis of polymerase chain reaction products One hundred/~L of the P C R products were treated with the phenol-chloroform-isoamylalcohol extraction method
Diagnosis of Legionella infection by RT-PCR
and then the 70% ethanol precipitation method as described above.The resultant pellet was dissolved in 10 p L of distilled water containing 280 U of ribonuclease inhibitor (Takara Shuzo). T h e n 1 p L of Taq 1 restriction endonuclease (10 U, Gibco BRL) and 1 p L o f x l 0 reaction buffer (500 m m o F L T r i s - H C l [pH 8.0], 100 m m o F L MgC12, 500 mmol/L sodium chloride [NaC1]) were added and reacted at 65~ for 1 hour. Reacted products were run on 4% Nuceive 3:1 agarose gel electrophoresis and stained in ethidium bromide solution. 1~ RESU LTS
Decontamination by 8-methoxypsoralen After 20 minutes of U V irradiation, 8-methoxypsoralene at a concentration of 0 #g/mL~ 12.5 ~g/mL,:and 25 pg/ m L did not interfere with the amplification of target D N A (cDNA extracted from 102 C F U ofL. pneumophila serogroup 1), whereas 50/~g/mL and 100 p g / m L conc e n t r a t i o n s inhibited the a m p l i f i c a t i o n (figure n o t shown). T h e reagent control produced a positive b a n d at a concentration of 0 p g / m L and 12.5 p g / m L (caused by contaminated D N A ) . Therefore, we chose 25 p g / m L (the same concentration as used by M e i e r and colleagues) for further experiments, s
more, of the remaining 20 specimens that were negative by both culture findings and mip-PCR, 2 specimens showed positive reactions with the 5 S - R T - P C R m e t h o d (Table 2, patient nos. 5 and 6). T h e s e 2 samples were pleural fluids collected from patients whose s e r u m antib o d y titer rose from 1:32 to 1 : 128 in both cases against L. pneumophila serogroup 1. T h e remaining 18 (both culture and mip-PCR negative) samples showed negative results with this R T - P C R method.
Effect of restriction enzyme analysis on polymerase chain reaction products Restriction enzyme analysis was performed to confirm the 102-bp positive band of P C R products.The digested product p r o d u c e d 37-bp and 65-bp bands on agarose gel after 1-hour reaction with Taq 1 restriction endonuclease (Fig. 4).
Elimination of contaminated DNA by ultraviolet irradiation C o n t a m i n a t e d D N A was eliminated by 20 minutes or m o r e of irradiation (at a concentration of 25 p g / m L of 8-methoxypsoralene), whereas after U V treatment of up to 35 minutes, added target D N A was amplified (Fig. 2). Therefore, we used 20 minutes of irradiation time for further experiments.
Sensitivity of the polymerase chain reaction method
Fig. 2. Effect of ultraviolet (UV) treatment on the amplification reaction. We added 8-methoxypsoralen at a final concentration of 25 pg/mL. Legionella cDNA (100 CFU) was added to reaction mixtures 1 to 8 after UV treatment. Legionella c D N A was not added to mixtures 1' to 8'. Lanes: 1 and 1', no UV treatment; 2 and 2', UV treatment for 10 minutes; 3 and 3', 15 minutes UV; 4 and 4', 20 minutes UV; 5 and 5', 25 minutes UV; 6 and 6', 30 minutes UV; 7 and 7', 35 minutes UV; 8 and 8', 40 minutes UV; M, 50-bp DNA ladder as molecular weight marker.
P C R mixtures with the addition of c D N A at concentrations from 102 to 0.1 C F U ofL. pneumophila serogroup 1 produced a positive band (figure not shown). In the second stage PCR, after the addition of c D N A at 0.01 and 0.001 CFU, L. pneumophila did not produce any bands. We concluded that the second-stage P C R was unnecessary.
Specificity of the polymerase chain reaction method Twenty-three Leg~bne//a species (38 strains) produced 102bp P C R products, but 4 Legionella strains (L. feeleii, L., spiritensis, L. israelensis, and L. birminghamensis) and all 9 non-Legionella strains did not produce any band (Fig. 3). Analysis of clinical samples of the R T - P C R m e t h o d in cases of consecutive specimens collected from 2 patients with positive cultures was 102 to 103 times as sensitive when c o m p a r e d to the mip-PCR m e t h o d (Table 2, patient nos. 1 and 2). In the case of specimens from 2 patients that were negative by culture findings, but mipP C R positive, R T - P C R was 102 times more sensitive than mip-PCR (Table 2, patient nos. 3 and 4). Further-
Fig. 3. Effect of 8-methoxypsoralen-ultraviolet (UV) treatment on the specificity of the amplification reaction. 8-methoxypsoralen was added at a final concentration of 25 pg/mL and treated with UV for 20 minutes, cDNA at 100 CFU of various Legionella and non-Legionella bacteria was added after UV treatment. Lanes:l, L. pneumophila serogroup 1; 2, L. bozemanii serogroup 1 ; 3, L. micdadei; 4, L. dumoffii; 5, L. feeleiiserogroup 1 ; 6, Acinetobacter calcoaceticus; 7, Pseudomonas fluorescens; 8, Pseudomonas aeruginosa; C, without cDNA; M, Hindlll-digested pHY300PLK and Haelll-digested pHY300.2PLK as molecular weight markers.
] Infect Chemother 1998;4:6-11 Table 2. Patients with Legionella pneumonia whose respiratory specimens showed positive results by 5Sreverse transcription-polymerase chain reaction (RT-PCR). Patient no. 1
2
3 4 5~ 6~:
Days after onset
Materials
3 29 59 8 20 28 7 8 3 5
BALF Sputum Sputum BALF Sputum Sputum Sputum Pleural fluid Pleural fluid Pleural fluid
Result of culture +a +b -
Sample dilution that showed PCR positive reaction by: Nested-mip-PCR 5S-RT-PCR 10~ 6 10~ 4 10~ 5 10~ 0-3 Negative Negative 10~ 100_10 1 Negative Negative
10~
-9
10~
-7
10~ -7 10~ -6 Negative Negative 10~ -1 100 10-3 10~ 10~
aL. pneumophila serogroup 1,1.1 x 106 CFU/mL; bL. pneumophila serogroup 1,1.0 x 103 CFU/mL; cindirect fluorescent antibody titer rose from 1:32 to 1:128 against L. pneumophila serogroup 1. mip, macrophage infectivity potentiator gene; BALI:, bronchoalveolar tavage fluid.
Fig. 4. Clinical application of 8-methoxypsoralen-UV treatment. 8-methoxypsoralen was added at a final concentration of 25 pg/mL and treated with UV for 20 minutes, cDNA made from sputum or pleural fluid was added after UV treatment. Lanes: 1, patient no. 3; 2, Taq-I digested PCR products of patient no. 3; 3, patient no. 4; 4, Taq-1 digested PCR products of patient no. 4; 5, patient no. 5; 6, Taq-1 digested PCR products of patient no. 5; 7, patient no. 6; 8, Taq-1 digested PCR products of patient no. 6, M, 50-bp DNA ladder as molecular weight marker.
DISCUSSION We and Mahbubani have previously reported that 5Sprimers amplified 5S-ribosomal-RNA complementary D N A sequence of Legionella, also produced positive bands for extracted D N A of Pseudomonas aeruginosa, Pseudomonas fluorescens, and A cinetobacter calcoaceticus. 1,2 Consequently, the Southern hybridization procedure was necessary to differentiate between them. We therefore avoided using D N A and selected an RNA-based method instead. Furthermore, as we know, 1 eubacterial cell contains at least 104 ribosomes, therefore the sensitivity while using R N A should be significantly higher than that using chromosomal D N A sequences. 11,12 If we amplify a eubacterial r R N A complementary D N A sequence, the exogenous bacterial D N A in AmpliTaq-polymerase (Perkin-Elmer) must be inactivated. Meier reported that 25 p g / m L concentration of 8-methoxypsoralene and 4
10
minutes of UV-irradiation was enough to inactivate them using Sarstedt transparent microtubes, 5 but we found that 20 minutes was necessary in the case of the Sorenson transparent microtube. The sequence between base pair 84 and 93 of 5Sribosomal R N A o f 4 Legionella species (L. feeleii, L. spiritensis, L. israelensis, and L. birmingharnensis) is significantly different from that of L. pneurnophila ( N C B I GenBank database). So these 4 species showed negative results by P C R using these primers.These 4 species of Legionella are not isolated, or are rarely isolated, from clinical specimens. But the other 23 Legionella species have similar sequences to L. pneurnophila. As this R T - P C R method has been shown to be very specific and sensitive for bacterial cultures, we applied this m e t h o d to clinical specimens. The results showed that this R T - P C R method was 102 to 103 times as sensitive compared to the nested-mip P C R method. 7,13,14 In addition, 2 samples showed positive reaction by RT-PCR, even though the nested-mip P C R results were negative. These 2 patients' serum had an indirect fluorescent antibody titer of 1 : 128 against the L.pneumophila serogroup 1 that indicated infection due to legionellae. In 1 culture-positive case, we even succeeded in detecting Legionella D N A from a sample taken 59 days after the onset of illness, by that time the patient had markedly improved. Confirmation of the specificity of P C R products by Taq-1 restriction enzyme analysis is not necessary, because other bacteria did not produce any D N A band in this R T - P C R system.We can avoid exogenous contamination (ofArnpliTaq-polymerase [Perkin-Elmer] origin) by the addition of 8-methoxypsoralene and U V irradiation. However, we must take care to avoid cross-contamination, as short length 5 S - r R N A may easily be carried on aerosols and contaminate neighboring sampies. In 1 series o f samples, this was suspected to have
Diagnosis of Legionella infection by RT-PCR c a u s e d o t h e r w i s e n e g a t i v e s a m p l e s to s h o w f a l s e - p o s i tive results, p r e s u m a b l y c o n t a m i n a t e d in this w a y b y 1 s a m p l e that c o n t a i n e d Legionella R N A . T h i s n e c e s s i t a t e d r e - e x t r a c t i o n o f R N A for e a c h s a m p l e a n d c o r r e s p o n d ing r e a g e n t control. Legionella i n f e c t i o n is u s u a l l y d i a g n o s e d b y t h e culture m e t h o d a n d d i r e c t o r i n d i r e c t i m m u n o f l u o r e s c e n t a n t i b o d y techniques.15 B o t h o f these m e t h o d s have their d r a w b a c k s . C u l t u r e o f Legionella is t i m e c o n s u m i n g a n d t h e s e r o l o g i c m e t h o d s have p o s s i b l e i n t r a l e g i o n e l l a e o r i n t e r g e n e r a cross reactions. 16-19 M o r e o v e r , t h e R T - P C R m e t h o d m a y e q u a l l y b e a p p l i e d to d e t e c t i n g Legionella R N A f r o m s e r u m a n d u r i n e , if n e c e s s a r y . l ~ RT-PCR t e c h n i q u e d e s c r i b e d h e r e will b e a v a l u a b l e tool for assisting d i a g n o s i s o f legionellosis.
6. 7.
8. 9. 10.
11. ACKNOWLEDGMENT
This work was supported by a research grant from the Ministry of Health and Welfare of Japan.
12. 13.
REFERENCES
1. Mahbubani M H , Bej AK, Miller R, Haft L, DiCesare J, Atlas RM. Detection of Legionella with polymerase chain reaction and gene probe methods. Mol Cell Probes 1990; 4:175-187. 2. Koide M, Saito A, Kusano N, Higa F. Detection of Legionella spp. in cooling tower water by the polymerase chain reaction method. Appl Environ Microbiol 1993; 59:1943-1946. 3. Hughes MS, Beck l_Jk, Skuce RA. Identification and elimination of D N A sequences in Taq D N A polymerase. J Clin Microbiol 1994;32:2007-2008. 4. Maiwald M, Ditton HJ, Sonntag HG, Doeberitz MK. Characterization of contaminating D N A in Taq polymer~ ase which occurs during amplification with a primer set for Legionella 5S ribosomal RNA. Mol Cell Probes 1994; 8:11 14. 5. Meier A, Persing D H , Finken M, Bottger EC. Elimination of contaminating D N A within polymerase chain reaction reagents: implications for a general approach to
14.
15. 16. 17. 18. 19.
detection of uncultured pathogens. J Clin Microbiol 1993; 31:646-652. Bottger E. C. Frequent contamination of Taq polymerase with DNA. Clin Chem 1990;36:1258-1259. Koide M, Saito A, Higa F, Yamashiro Y, Ishimine T, Futenma M, et al. Study of Legionella pneumophila detection by two step polymerase chain reaction (in Japanese). J Jpn Assoc Infect Dis 1993;67:1062-1067. MacDonell MT, Colwell RR.The nucleotide sequence of 5S rRNA from Legionella pneumophila. Nucl Acids Res 1987;15:1335. Wolters J, ErdmannVA. Compilation of 5S r R N A and 5S rRNA gene sequences. Nucl Acids Res 1988; 16:rl-r70. M u r d o c h D R , Walford EJ, Jennings L C , L i g h t GJ, Schousboe MI, Chereshsky AY, et al. Use of the polymerase chain reaction to detect Legionella D N A in urine and serum samples from patients with pneumonia. Clin Infect Dis 1996;23:475-480. Murry PR, Baron EJO, Pfaller MA, Tenover FC, Yolken RH. P C R amplification of RNA. In: Manual of clinical microbiology. 6th ed. Washington D C: American Society for Microbiology, 1995. Nomura M,Tissieres A, Lengyel R. Ribosomes. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1974. Koide M, Saito A. Diagnosis of Legionella pneumophila infection by polymerase chain reaction. Clin Infect Dis 1995;21:199-201. Koide M, Saito A, Kusano N, Tateyama M, Inadome J, KyanY, et al. Relation between the polymerase chain reaction and the indirect fluorescent antibody method in the diagnosis of Legionella infection. Clin Infect Dis 1996; 23:656-657. M e m o r a n d u m from a W H O meeting. Epidemiology, prevention and control of legionellosis. Bull W H O 1990;68: 155-164. Boswell TGJ, Marshall LE, Kudesia G. Crossreaction between Legionella and Campylobacter spp. Lancet 1992; 340:551. Edelstein PH. Legionnaires' disease. Clin Infect Dis 1993; 16:741-747. Finkelstein R, Palutke WA, Wentworth BB, Geiger JG, Bostic GD. Colonization of the respiratory tract with Legionella species. Isr J Med Sci 1993;29:277-279. Flournoy DJ, Belobraydic KA, Silberg SL, Lawrence G H , Guthrie PJ. False positive Legionella pneumophila direct immunofluorescent monoclonal antibody test caused by Bacillus cereus spores. Diagn Microbiol Infect Dis 1988; 9:123-125.
11
Legionella Infection by Reverse Transcription of 5S-Ribosomal RNA and Polymerase Chain Reaction M i c h i o K o i d e * a n d Atsushi Saito
First Department of Internal Medicine, Faculty of Medicine, University of the Ryukyus, Okinawa, Japan
We investigated a diagnostic method for legionellosis that uses detection of Legionella 5S ribosomal RNA by reverse transcription-polymerase chain reaction (RT-PCR). Primer L5SR105, located between base pairs 105 and 119 of the Legionella 5S ribosomal RNA, was used for reverse transcription. Primer L5SL2, located between 2 and 21 bp of the Legionella 5S ribosomal RNA, and primer L5SR84, located between 84 and t 03 bp, were used for the polymerase chain reaction (PCR). We found that 8-methoxypsoralen at a concentration of 25 pg/mL followed by 20 minutes of ultraviolet irradiation (366 nm) was adequate for elimination of DNA contamination when using Sorenson-transparent microtubes. The specificity of the RT-PCR system was determined by using 27 Legionella species (42 strains) and 9 non-Legionella strains. Of these, 23 species (38 strains) showed positive results. Subsequently, the elimination step for PCR mixtures was followed by RT-PCRof clinical samples. We examined 6 samples from 2 patients with positive cultures with this RT-PCR method, and showed results 102 to 10~times more sensitive than the mip-primer-PCR method. Furthermore, 2 of the patient samples negative by culture and mip-primer-PCR assay showed a positive reaction with this RTPCR method. Our results suggest that this RT-PCRtechnique may be a useful diagnostic tool for legionellosis. J Infect Chemother 1998;4:6 11 Key words : Legionella detection, 5S-RT-PCR, 8-methoxypsoralen, DNA contamination
INTRODUCTION
technique using reference cultures of Legionella and nonLegionella bacteria. Subsequently, we evaluated this
Legionella detection by using a polymerase chain reaction
m e t h o d by using clinical specimens.
(PCR) method using 5S-ribosomal D N A primers that detect 5S-rRNA complementary chromosomal regions was first reported by Mahbubani and colleagues. 1 But this primer produced 104-bp P C R products not only from Legionella D N A , b u t also f r o m Pseudomonas a n d Acinetobacter DNA. Therefore, Southern blot hybridization was necessary to differentiate the P C R products of Legionella from those ofnon-Legionella bacteria, a In addition, there were reports regarding contamination of Taq-polymerase by eubac~erial DNA. ~6 Ultraviolet (UV) irradiation after the addition of psoralene to the P C R mixture was p e r f o r m e d to avoid amplification of contaminated eubacterial ribosomal D N A sequences. Psoralens are known to intercalate into double-stranded nucleic acids and form a covalent interstrand cross-link after photoactivation with light at 320 to 400 nm. In this study, we investigated the reverse transcription-polymerase chain reaction (RT-PCR) m e t h o d for detecting Legionella ribosomal RNA. Sequences of RTP C R - p r i m e r s were in conformity with the r R N A sequences of different legionellae strains, but were very different f r o m non-Legionella bacteria. First, we investigated the specificity and sensitivity of the R T - P C R
Received May 16, 1997; revised Jul. 23, 1997; accepted for publication in revised form Oct. 14, 1997. *Correspondence and requests for reprints to: First Department of Internal Medicine, Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan.
6
MATERIALS A N D METHODS
Bacterial strains To determine the specificity of legionellae detection by the RT-PCR method, 27 Legionella species (42 strains) and 9 non-Legionella strains were used (Table 1). T h e Legionella strains were grown on BCYE a medium (Oxoid, Hampshire, U K ) at 37~ for 4 days, non-Legionella bacteria were grown on trypticase soy agar medium (Difco, Detroit, MI, USA) at 37~ for 24 hours and suspended in distilled water to prepare 10 s C F U / m L solutions and their serial tenfold dilutions. One-milliliter aliquots of these solutions were used to prepare P C R samples.
Clinical
samples
A total of 28 samples were selected from samples that were sent f r o m all over Japan between 1992 and 1996. These respiratory samples from 24 patients were available within 14 days from the onset of illness, and it was possible to collect paired sera. Six respiratory tract specim e n s were c o l l e c t e d f r o m 2 p a t i e n t s f r o m w h o m Legionella had b e e n isolated. One s p u t u m and 1 pleural fluid specimen that were positive by mip (macrophage infectivity potentiator gene; specific for L. pneumophila)p r i m e r P C R , 7 but negative by culture findings, were sampled from 2 separate patients. Twenty respiratory tract specimens were collected from 20 patients who were clinically suspected of having legionellosis, but
1341-321)(/98/0401-0006/US$3.009 JSC/CLJ 1998
Diagnosis of Legionella infection by RToPCR
were negative by mip-primer P C R and by culture findings (10 cases were positive by indirect fluorescent antibody staining and 10 cases were negative by indirect fluorescent antibody staining). Table 1. The 27 Legionella species (42 strains) and 9 non-Legionella strains that were used to determine the specificity of legionellae detection by reverse transcription-polymerase chain reaction.
Legionella strains L. 9neumophila serogroup 1 ATCC 33152 L. pneumophila serogroup 2 ATCC 33154 L. 9neumophila serogroup 3 ATCC 33155 L. ~neumophila serogroup 4 ATCC 33156 L. 9neumophila serogroup 5 ATCC 33216 L. 9neumophila serogroup 6 ATCC 33215 L. 9neumophila serogroup 7 ATCC 33823 L. 9neumophila serogroup 8 ATCC 35096 L. 9neumophila serogroup 9 ATCC 35289 L. 9neumophila serogroup 10 ATCC 43283 L. pneumophila serogroupl 1 ATCC 43130 L. pneumophila serogroup 12 ATCC 43290 L. pneumophila serogroup 13 ATCC 43736 L. pneumophila serogroupl 4 ATCC 43703 L. bozemanii serogroup 1 ATCC 3321 7 L. bozemanii serogroup 2 ATCC 35545 L. dumoffii ATCC 33279 L, gormanii ATCC 33297 L. micdadei ATCC 33218 L. Iongbeachae serogroup 1 ATCC 33462 L. Iongbeachae serogroup 2 ATCC 33484 L. jordanis ATCC 33623 L. oakridgensis ATCC 33761 L. wadsworthii ATCC 33877 L. feeleii serogroup 1 ATCC 35072 L. sainthelensi serogroup 1 ATCC 35248 L. anisa ATCC 35292 L. santicrusis ATCC 35301 L. steigerwaltii ATCC 35302 L. parisiensis ATCC 35299 L. spiritensis serogroup 1 ATCC 35249 L. hackeliae serogroup 1 ATCC 35250 L. maceachernii ATCC 35300 L. jamestowniensis ATCC 35298 L. cherrii ATCC35252 L. rubrilucens ATCC 35304 L. erythra serogroup 1 ATCC 35303 L. israelensis ATCC 43119 L. birminghamensis ATCC 43702 L. cincinnatiensis ATCC 43753 L. moravica ATCC 43877 L. brunensis ATCC 43878 Non-Legionelfa bacteria Pseudomonas aeruginosa ATCC 27853 Pseudomonas fluorescens ATCC 13525 Acinetobacter calcoaceticus ATCC 23055 Staphylococcus aureus ATCC 25923 Enterococcus faecalis ATCC 29212 Clinical isolates of non-Legionella bacteria Stenotrophomonas maltophilia Alcaligenes faecalis Staphylococcus epidermidis Candidia albicans
Primers A 15mer primer L5SR105 (5'-ATCCTGGCGATGACC-3') located between base pair 105 and 119 of the Legionella 5S-ribosomal RNA was used for reverse transcription. Primers L5SL2 (5'-TCq~GGCGACTATAGCGATF-3') located between base pair 2 and 21 of the Legionella 5S-ribosomal RNA, and LSSR84 (5'-ACqqq'CGCATGAGGAAGCCT-3') located between base pair 84 and 103 were used for P C R reaction (Fig. 1).s,9
Extraction of RNA from samples Bacterial suspensions (1.0 m L ) or clinical samples (1.0 m L ) in a polypropylene tube were heat treated for 15 minutes at 100~ with 1.0-g glass beads (1.5 m m in diameter) . T h e n 100 p L of T r i s - E D T A buffer (10 m m o l / LTris-HC1, 1 m m o l / L E D T A [pH 8.0]) and 100 ~/L of proteinase K (0.1 mg) were added to the s a m p l e s . T h e y were incubated at 55~ for 2 hours in a water bath and then boiled at 100~ for 5 minutes. Five h u n d r e d / I L of solution D (4 mol/L guanidiumthiocyanate, 25 m m o l / L sodium citrate [pH 7.0], 0.5% sodium laurel sarcosin, 0.1mol/L 2-mercaptoethanol) and 50 //L of 2 m o l / L sodium acetate ( p H 4.0) and 0.5 m L o f p h e n o l - c h l o r o form-isoamylalcohol solution (25:24:1) were a d d e d to the heat-treated samples.They were vortexed and centrifuged at 10,000y for 15 minutes. T h e upper aqueous layer was moved to a new tube and equal volume of the same solutions added (solution D:sodium acetate:phenol-chloroform-isoamylalcohol solution). T h e mixture was centrifuged at 10,000c/for 30 minutes, and the aqueous layer was moved to a new tube and an equal volume of isopropanol was added. T h e resulting mixture was centrifuged at 25,000y for 30 minutes at 4~ T h e aqueous layer was discarded, and the remaining sediment was washed with 1 m L of 70% ethanol and recentrifuged at 25,000y for 30 m i n utes at 4~ T h e resultant sediment was dried at r o o m t e m p e r a t u r e for 30 minutes. One h u n d r e d btL volumes of serial tenfold dilution of clinical samples were treated by the same m e t h o d with one-tenth volume of each reagent. Dried R N A was dissolved with 8/,/L of distilled water and 2/,tL ofribonuclease inhibitor (280 U ; T a k a r a Shuzo, Shiga, Japan).
Reverse transcription using 5S-ribosomal RNA One microliter of the extracted RNA, 1 /IL of primer L5SR103 (10 mmol/L) and 4 # L of x 5 first-strand buffer (250 mmol/LTris-HC1 [pH 8.3], 375 m m o l / L potassium chloride [KC1], and 15 m m o l / L m a g n e s i u m chloride [MgC12] were transferred to a microtube and heat-treated at 94~ for 5 minutes and then at 50~ for 15 minutes. T w o / I L of deoxyribonucleoside triphosphate ( d N T P ) solution (dATP, d G T P , dCTP, d T T P , each 5 retool/L), 2 ~ L of 0.1 mol/L dithiothreitol and 1//L ofMoloney murine leukemia virus reverse transcriptase (200 U; Gibco B R L Life Technologies, Rockville, M D , USA) were added to the tube and reacted at 37~ for 1 hour and then at 92~
J Infect Chemother 1998;4:6-11 2
21 42 45 84
103
L. pneumophila
-UCUUGGCGACUAUAGCGAUU UCGA AGGCUUCCUCAUGCGAAAGU
A. calcoaceticus
GoC . . . . . . .
P. fluorescens
.....
A .... C .... A'CA"
C''"
G''U .... C .... U~176176
P. aeruginosa
G .... A,,,UC .... A.CG,
C,,-
G-.UC-..C .... U~
(cDNA)
TCTFGGCGACTATAGCGATF
C . . . . . A.GA
C "~176 G ' - U ~
.... U-,G,,.
TCCGAAGGAGTACGCTITCA
primer L5SL2
Taq 1
primer L5SR84
Fig. 1. Comparison of the alignment of the primer positions and Taq-1 restriction site in the 5S-ribosomal RNA between Legionella and systematically resembling bacteria. The common nucleotides are indicated by dots. The deleted nucleotides are indicated by dashes.
for 5 minutes. T h e excess primer was digested by adding 2 BL of exonuclease I (20 U, A m e r s h a m Life Science, Cleveland, O H , USA) followed by treating at 37~ for 15 minutes and at 80~ for 15 minutes. T h e resultant ribosomal-RNA complementary D N A sequence (2 to 119) was used for the following P C R reaction.
Elimination of contaminated DNA in polymerase chain reaction mixtures Eighty microliters of P C R reaction mixture that contained 10 mmol/LTris-HCl [pH 8.3], 50 mmol/L KC1, 3.0 retool/ L MgCl 2 , and 10 mg/L gelatin, 200 ~tmol/L each of the deoxynucleoside triphosphates, and 2.5 U of AmpliTaq D N A polymerase (Perkin-Elmer, Branchburg, NJ, USA) were used. A stock solutign of 2.5 m g / m L was prepared by dissolving 8-methoxypsoralen (Sigma Chemical, St. Louis, M O , USA) in dimethyl sulfoxide (Sigma Chemical). Appropriate dilutions of 8-methoxypsoralen in dimethyl s u l f o x i d e w e r e p r e p a r e d to r e s u l t in a final concentration of 1% dimethyl sulfoxide in the P C R mixture ( 1 / / L each of 12.5 Ftg/mL, 25 pg/mL, 50 #g/mL, 100 p g / m L solutions). T h e t r a n s p a r e n t 0 . 6 5 - m L plastic microcentrifuge tubes (Sorenson Bioscience, Salt Lake City, UT, USA) that contained 80/2L P C R mixture were irradiated from the side at a distance of 1 cm with longwave (366 nm) U V radiation by using a conventional U V hand monitor (UVP, San Gabriel, CA, USA) for 10, 15, 20, 25, 30, 35, and 40 minutes each. After U V treatment, we added 1 0 / t L of RT-products that contained c D N A from 102 C F U of L. pneumophila serogroup 1, 5 p L of primer L5SR84 and 5 p L of primer LSSL2 to the mixture and determined the P C R conditions. T h e samples (100/.tL) were initially denatured at 94~ for 5 minutes, and then a total of 35 P C R cycles
were performed by using a 3-temperature cycle with denaturation at 94~ for 1 minute, primer annealing at 55~ for 1 minute, and extension at 72~ for 1 minute. P C R amplified D N A s were separated by 4% Nuceive 3:1 (Takara Shuzo, Otsu, Japan) horizontal agarose gels. T h e gels were stained in 2 p g / m L ethidium bromide and observed with a U V transilluminator. After determining the necessary 8-methoxypsoralen concentration and U V irradiation time, we investigated the sensitivity of this P C R mixture-primer complex by adding RT-products that contained c D N A from the following: 102, 10, 1, 0.1, 0.01, and 0.001 C F U of L. pneumophila serogroup 1. As the second-stage P C R , 1 p L of these P C R - p r o d ucts was added to respective new mixtures and amplified with the same temperature cycle (94-55-72~ 35 cycles). T h e n we added RT-products from 106 and 102 C F U of various Legionella species and various non-Legionella bacteria to this mixture and investigated the specificity of these primers.
Polymerase chain reaction conditions for clinical samples O n e / / L of 2 5 g / m L 8-methoxypsoralen was added to 80 # L of the P C R mixtures and irradiated with U V for 20 minutes. T h e n 5 p L of p r i m e r L5SR84, 5 p L of p r i m e r LSSL2 and 10 BL of RT-products from clinical samples or their serial tenfold dilutions were added to this P C R mixture. T h e P C R p r o c e d u r e was p e r f o r m e d as described above.
Restriction enzyme analysis of polymerase chain reaction products One hundred/~L of the P C R products were treated with the phenol-chloroform-isoamylalcohol extraction method
Diagnosis of Legionella infection by RT-PCR
and then the 70% ethanol precipitation method as described above.The resultant pellet was dissolved in 10 p L of distilled water containing 280 U of ribonuclease inhibitor (Takara Shuzo). T h e n 1 p L of Taq 1 restriction endonuclease (10 U, Gibco BRL) and 1 p L o f x l 0 reaction buffer (500 m m o F L T r i s - H C l [pH 8.0], 100 m m o F L MgC12, 500 mmol/L sodium chloride [NaC1]) were added and reacted at 65~ for 1 hour. Reacted products were run on 4% Nuceive 3:1 agarose gel electrophoresis and stained in ethidium bromide solution. 1~ RESU LTS
Decontamination by 8-methoxypsoralen After 20 minutes of U V irradiation, 8-methoxypsoralene at a concentration of 0 #g/mL~ 12.5 ~g/mL,:and 25 pg/ m L did not interfere with the amplification of target D N A (cDNA extracted from 102 C F U ofL. pneumophila serogroup 1), whereas 50/~g/mL and 100 p g / m L conc e n t r a t i o n s inhibited the a m p l i f i c a t i o n (figure n o t shown). T h e reagent control produced a positive b a n d at a concentration of 0 p g / m L and 12.5 p g / m L (caused by contaminated D N A ) . Therefore, we chose 25 p g / m L (the same concentration as used by M e i e r and colleagues) for further experiments, s
more, of the remaining 20 specimens that were negative by both culture findings and mip-PCR, 2 specimens showed positive reactions with the 5 S - R T - P C R m e t h o d (Table 2, patient nos. 5 and 6). T h e s e 2 samples were pleural fluids collected from patients whose s e r u m antib o d y titer rose from 1:32 to 1 : 128 in both cases against L. pneumophila serogroup 1. T h e remaining 18 (both culture and mip-PCR negative) samples showed negative results with this R T - P C R method.
Effect of restriction enzyme analysis on polymerase chain reaction products Restriction enzyme analysis was performed to confirm the 102-bp positive band of P C R products.The digested product p r o d u c e d 37-bp and 65-bp bands on agarose gel after 1-hour reaction with Taq 1 restriction endonuclease (Fig. 4).
Elimination of contaminated DNA by ultraviolet irradiation C o n t a m i n a t e d D N A was eliminated by 20 minutes or m o r e of irradiation (at a concentration of 25 p g / m L of 8-methoxypsoralene), whereas after U V treatment of up to 35 minutes, added target D N A was amplified (Fig. 2). Therefore, we used 20 minutes of irradiation time for further experiments.
Sensitivity of the polymerase chain reaction method
Fig. 2. Effect of ultraviolet (UV) treatment on the amplification reaction. We added 8-methoxypsoralen at a final concentration of 25 pg/mL. Legionella cDNA (100 CFU) was added to reaction mixtures 1 to 8 after UV treatment. Legionella c D N A was not added to mixtures 1' to 8'. Lanes: 1 and 1', no UV treatment; 2 and 2', UV treatment for 10 minutes; 3 and 3', 15 minutes UV; 4 and 4', 20 minutes UV; 5 and 5', 25 minutes UV; 6 and 6', 30 minutes UV; 7 and 7', 35 minutes UV; 8 and 8', 40 minutes UV; M, 50-bp DNA ladder as molecular weight marker.
P C R mixtures with the addition of c D N A at concentrations from 102 to 0.1 C F U ofL. pneumophila serogroup 1 produced a positive band (figure not shown). In the second stage PCR, after the addition of c D N A at 0.01 and 0.001 CFU, L. pneumophila did not produce any bands. We concluded that the second-stage P C R was unnecessary.
Specificity of the polymerase chain reaction method Twenty-three Leg~bne//a species (38 strains) produced 102bp P C R products, but 4 Legionella strains (L. feeleii, L., spiritensis, L. israelensis, and L. birminghamensis) and all 9 non-Legionella strains did not produce any band (Fig. 3). Analysis of clinical samples of the R T - P C R m e t h o d in cases of consecutive specimens collected from 2 patients with positive cultures was 102 to 103 times as sensitive when c o m p a r e d to the mip-PCR m e t h o d (Table 2, patient nos. 1 and 2). In the case of specimens from 2 patients that were negative by culture findings, but mipP C R positive, R T - P C R was 102 times more sensitive than mip-PCR (Table 2, patient nos. 3 and 4). Further-
Fig. 3. Effect of 8-methoxypsoralen-ultraviolet (UV) treatment on the specificity of the amplification reaction. 8-methoxypsoralen was added at a final concentration of 25 pg/mL and treated with UV for 20 minutes, cDNA at 100 CFU of various Legionella and non-Legionella bacteria was added after UV treatment. Lanes:l, L. pneumophila serogroup 1; 2, L. bozemanii serogroup 1 ; 3, L. micdadei; 4, L. dumoffii; 5, L. feeleiiserogroup 1 ; 6, Acinetobacter calcoaceticus; 7, Pseudomonas fluorescens; 8, Pseudomonas aeruginosa; C, without cDNA; M, Hindlll-digested pHY300PLK and Haelll-digested pHY300.2PLK as molecular weight markers.
] Infect Chemother 1998;4:6-11 Table 2. Patients with Legionella pneumonia whose respiratory specimens showed positive results by 5Sreverse transcription-polymerase chain reaction (RT-PCR). Patient no. 1
2
3 4 5~ 6~:
Days after onset
Materials
3 29 59 8 20 28 7 8 3 5
BALF Sputum Sputum BALF Sputum Sputum Sputum Pleural fluid Pleural fluid Pleural fluid
Result of culture +a +b -
Sample dilution that showed PCR positive reaction by: Nested-mip-PCR 5S-RT-PCR 10~ 6 10~ 4 10~ 5 10~ 0-3 Negative Negative 10~ 100_10 1 Negative Negative
10~
-9
10~
-7
10~ -7 10~ -6 Negative Negative 10~ -1 100 10-3 10~ 10~
aL. pneumophila serogroup 1,1.1 x 106 CFU/mL; bL. pneumophila serogroup 1,1.0 x 103 CFU/mL; cindirect fluorescent antibody titer rose from 1:32 to 1:128 against L. pneumophila serogroup 1. mip, macrophage infectivity potentiator gene; BALI:, bronchoalveolar tavage fluid.
Fig. 4. Clinical application of 8-methoxypsoralen-UV treatment. 8-methoxypsoralen was added at a final concentration of 25 pg/mL and treated with UV for 20 minutes, cDNA made from sputum or pleural fluid was added after UV treatment. Lanes: 1, patient no. 3; 2, Taq-I digested PCR products of patient no. 3; 3, patient no. 4; 4, Taq-1 digested PCR products of patient no. 4; 5, patient no. 5; 6, Taq-1 digested PCR products of patient no. 5; 7, patient no. 6; 8, Taq-1 digested PCR products of patient no. 6, M, 50-bp DNA ladder as molecular weight marker.
DISCUSSION We and Mahbubani have previously reported that 5Sprimers amplified 5S-ribosomal-RNA complementary D N A sequence of Legionella, also produced positive bands for extracted D N A of Pseudomonas aeruginosa, Pseudomonas fluorescens, and A cinetobacter calcoaceticus. 1,2 Consequently, the Southern hybridization procedure was necessary to differentiate between them. We therefore avoided using D N A and selected an RNA-based method instead. Furthermore, as we know, 1 eubacterial cell contains at least 104 ribosomes, therefore the sensitivity while using R N A should be significantly higher than that using chromosomal D N A sequences. 11,12 If we amplify a eubacterial r R N A complementary D N A sequence, the exogenous bacterial D N A in AmpliTaq-polymerase (Perkin-Elmer) must be inactivated. Meier reported that 25 p g / m L concentration of 8-methoxypsoralene and 4
10
minutes of UV-irradiation was enough to inactivate them using Sarstedt transparent microtubes, 5 but we found that 20 minutes was necessary in the case of the Sorenson transparent microtube. The sequence between base pair 84 and 93 of 5Sribosomal R N A o f 4 Legionella species (L. feeleii, L. spiritensis, L. israelensis, and L. birmingharnensis) is significantly different from that of L. pneurnophila ( N C B I GenBank database). So these 4 species showed negative results by P C R using these primers.These 4 species of Legionella are not isolated, or are rarely isolated, from clinical specimens. But the other 23 Legionella species have similar sequences to L. pneurnophila. As this R T - P C R method has been shown to be very specific and sensitive for bacterial cultures, we applied this m e t h o d to clinical specimens. The results showed that this R T - P C R method was 102 to 103 times as sensitive compared to the nested-mip P C R method. 7,13,14 In addition, 2 samples showed positive reaction by RT-PCR, even though the nested-mip P C R results were negative. These 2 patients' serum had an indirect fluorescent antibody titer of 1 : 128 against the L.pneumophila serogroup 1 that indicated infection due to legionellae. In 1 culture-positive case, we even succeeded in detecting Legionella D N A from a sample taken 59 days after the onset of illness, by that time the patient had markedly improved. Confirmation of the specificity of P C R products by Taq-1 restriction enzyme analysis is not necessary, because other bacteria did not produce any D N A band in this R T - P C R system.We can avoid exogenous contamination (ofArnpliTaq-polymerase [Perkin-Elmer] origin) by the addition of 8-methoxypsoralene and U V irradiation. However, we must take care to avoid cross-contamination, as short length 5 S - r R N A may easily be carried on aerosols and contaminate neighboring sampies. In 1 series o f samples, this was suspected to have
Diagnosis of Legionella infection by RT-PCR c a u s e d o t h e r w i s e n e g a t i v e s a m p l e s to s h o w f a l s e - p o s i tive results, p r e s u m a b l y c o n t a m i n a t e d in this w a y b y 1 s a m p l e that c o n t a i n e d Legionella R N A . T h i s n e c e s s i t a t e d r e - e x t r a c t i o n o f R N A for e a c h s a m p l e a n d c o r r e s p o n d ing r e a g e n t control. Legionella i n f e c t i o n is u s u a l l y d i a g n o s e d b y t h e culture m e t h o d a n d d i r e c t o r i n d i r e c t i m m u n o f l u o r e s c e n t a n t i b o d y techniques.15 B o t h o f these m e t h o d s have their d r a w b a c k s . C u l t u r e o f Legionella is t i m e c o n s u m i n g a n d t h e s e r o l o g i c m e t h o d s have p o s s i b l e i n t r a l e g i o n e l l a e o r i n t e r g e n e r a cross reactions. 16-19 M o r e o v e r , t h e R T - P C R m e t h o d m a y e q u a l l y b e a p p l i e d to d e t e c t i n g Legionella R N A f r o m s e r u m a n d u r i n e , if n e c e s s a r y . l ~ RT-PCR t e c h n i q u e d e s c r i b e d h e r e will b e a v a l u a b l e tool for assisting d i a g n o s i s o f legionellosis.
6. 7.
8. 9. 10.
11. ACKNOWLEDGMENT
This work was supported by a research grant from the Ministry of Health and Welfare of Japan.
12. 13.
REFERENCES
1. Mahbubani M H , Bej AK, Miller R, Haft L, DiCesare J, Atlas RM. Detection of Legionella with polymerase chain reaction and gene probe methods. Mol Cell Probes 1990; 4:175-187. 2. Koide M, Saito A, Kusano N, Higa F. Detection of Legionella spp. in cooling tower water by the polymerase chain reaction method. Appl Environ Microbiol 1993; 59:1943-1946. 3. Hughes MS, Beck l_Jk, Skuce RA. Identification and elimination of D N A sequences in Taq D N A polymerase. J Clin Microbiol 1994;32:2007-2008. 4. Maiwald M, Ditton HJ, Sonntag HG, Doeberitz MK. Characterization of contaminating D N A in Taq polymer~ ase which occurs during amplification with a primer set for Legionella 5S ribosomal RNA. Mol Cell Probes 1994; 8:11 14. 5. Meier A, Persing D H , Finken M, Bottger EC. Elimination of contaminating D N A within polymerase chain reaction reagents: implications for a general approach to
14.
15. 16. 17. 18. 19.
detection of uncultured pathogens. J Clin Microbiol 1993; 31:646-652. Bottger E. C. Frequent contamination of Taq polymerase with DNA. Clin Chem 1990;36:1258-1259. Koide M, Saito A, Higa F, Yamashiro Y, Ishimine T, Futenma M, et al. Study of Legionella pneumophila detection by two step polymerase chain reaction (in Japanese). J Jpn Assoc Infect Dis 1993;67:1062-1067. MacDonell MT, Colwell RR.The nucleotide sequence of 5S rRNA from Legionella pneumophila. Nucl Acids Res 1987;15:1335. Wolters J, ErdmannVA. Compilation of 5S r R N A and 5S rRNA gene sequences. Nucl Acids Res 1988; 16:rl-r70. M u r d o c h D R , Walford EJ, Jennings L C , L i g h t GJ, Schousboe MI, Chereshsky AY, et al. Use of the polymerase chain reaction to detect Legionella D N A in urine and serum samples from patients with pneumonia. Clin Infect Dis 1996;23:475-480. Murry PR, Baron EJO, Pfaller MA, Tenover FC, Yolken RH. P C R amplification of RNA. In: Manual of clinical microbiology. 6th ed. Washington D C: American Society for Microbiology, 1995. Nomura M,Tissieres A, Lengyel R. Ribosomes. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1974. Koide M, Saito A. Diagnosis of Legionella pneumophila infection by polymerase chain reaction. Clin Infect Dis 1995;21:199-201. Koide M, Saito A, Kusano N, Tateyama M, Inadome J, KyanY, et al. Relation between the polymerase chain reaction and the indirect fluorescent antibody method in the diagnosis of Legionella infection. Clin Infect Dis 1996; 23:656-657. M e m o r a n d u m from a W H O meeting. Epidemiology, prevention and control of legionellosis. Bull W H O 1990;68: 155-164. Boswell TGJ, Marshall LE, Kudesia G. Crossreaction between Legionella and Campylobacter spp. Lancet 1992; 340:551. Edelstein PH. Legionnaires' disease. Clin Infect Dis 1993; 16:741-747. Finkelstein R, Palutke WA, Wentworth BB, Geiger JG, Bostic GD. Colonization of the respiratory tract with Legionella species. Isr J Med Sci 1993;29:277-279. Flournoy DJ, Belobraydic KA, Silberg SL, Lawrence G H , Guthrie PJ. False positive Legionella pneumophila direct immunofluorescent monoclonal antibody test caused by Bacillus cereus spores. Diagn Microbiol Infect Dis 1988; 9:123-125.
11