- Email: [email protected]
ComX activity of Streptococcus mutans growing in biofilms
FEMS Microbiology Letters 238 (2004) 167–174 www.fems-microbiology.org
ComX activity of Streptococcus mutans growing in biofilms Marcelo B. Aspiras, Richard P. Ellen, Dennis G. Cvitkovitch
*
Faculty of Dentistry, University of Toronto, 124 Edward Street, Toronto, Ont., Canada M5G 1G6 Received 26 May 2004; received in revised form 26 May 2004; accepted 15 July 2004 First published online 28 July 2004
Abstract In many streptococci, including Streptococcus mutans, genetic competence is regulated by a quorum sensing system mediated by a competence stimulating peptide (CSP) pheromone, encoded by the comC gene. In Streptococcus pneumoniae, a central component of this system is ComX, which acts as an alternative sigma factor to activate competence genes involved in DNA uptake and processing. The quorum sensing system responsible for genetic competence induction in S. mutans has been linked to biofilm formation and the acid tolerance response. To examine the response of comX to CSP in S. mutans, a transcriptional fusion of the comX promoter (pcomX) with lacZ was constructed to generate reporter vector pcomx::pALH122 (replicative vector) and transformed into S. mutans UA159 comC, which is unable to produce endogenous CSP. CSP was added and pcomX::lacZ relative expression index (REI) examined, revealing a 2-fold increase in maximal b-gal activity 5 and 10 min after CSP addition. The effect of endogenous CSP on pcomX::lacZ expression was also examined by measuring REI in cells grown as a biofilm; peak pcomX activity was observed at 3 h. To determine the temporal pattern of transformation frequency, pMA2, a Spr shuttle vector, was transformed into biofilm-grown cells, with maximal transformation frequency observed at 3 h. Confocal microscopy was performed to examine pcomX activity using a similarly constructed green fluorescent protein reporter vector, pcomX::gfp, in a 4-h biofilm, revealing active pcomX activity in high cell density areas within the biofilm population. These results demonstrated a positive correlation between pcomX activity, natural transformation and competence development in biofilms. 2004 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. Keywords: Competence; Biofilm; Streptococcus mutans
1. Introduction Genetic competence is a physiologic state that enables bacteria to internalize and incorporate foreign DNA into the chromosome. DNA uptake by a bacterium enhances its ability to survive and adapt in the natural environment [1–3]. Genetic competence in many streptococci is governed by a quorum sensing competence stimulating peptide (CSP)-dependent signal trans-
* Corresponding author. Tel.: +1 416 979 4917x4592; fax: +1 416 979 4936. E-mail address: [email protected] (D.G. Cvitkovitch).
duction system which regulates a range of bacterial adaptive responses to stimuli resulting from environmental changes [4–6]. Quorum sensing is initiated by a CSP, a cytoplasmic membrane integrated histidine kinase sensor and an intracellular response regulator [7,8]. As an effector molecule, the response regulator is involved in the up or downregulation of specific genes, including comX. Streptococcus mutans is a major contributor to human dental caries [9]. Under conditions of high carbohydrate intake by the host, acid production by these bacteria can lead to demineralization of the subjacent tooth surface. Bacterial cells are known to alter expression of certain genes in the transition from the planktonic (free living) state to the biofilm environment,
0378-1097/$22.00 2004 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. doi:10.1016/j.femsle.2004.07.032
168
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
and this would appear to be the case with S. mutans in dental plaque [10]. CSP activates expression of several competence genes including those encoding proteins of the DNA processing pathway [11,12]. At least six gene products encoded by comAB [12], comCDE [13] and comX [14] are known to be involved in cell–cell signaling in streptococci. In S. mutans, the role of these genes in competence induction and the central role played by CSP in their regulation has been demonstrated [15,13]. ComA and comB encode a CSP-specific exporting apparatus comprised of an ATP-binding cassette (ABC) transporter (ComA) and its accessory protein (ComB), which are involved in the processing and secretion of CSP. ComC, comD and comE, respectively encode the CSP precursor, its histidine kinase sensor protein and the cognate response regulator. ComC and comED are adjacently located on the chromosome and appear to be divergently transcribed, while comA and comB are situated in a different area of the chromosome [13]. In Streptococcus pneumoniae, ComE activates a number of early competence genes including ComX, an alternate sigma factor that initiates transcription of late competence genes required for DNA uptake and recombination [14]. ComX dependent genes including ssbB, dalA, ccl, celAB, cAAB, and cinA-recA possess a unique consensus sequence (TACGAATA) in their promoter regions. [1,16,17–20]. Similarly, the homolog of the comX alternate sigma factor in S. mutans is postulated to direct transcription by RNA polymerase of several competence related genes as a result of the CSP-induced signal cascade. The b-galactosidase (lacZ) gene has been extensively used to assay transcriptional activity of several genes in S. pneumoniae [21], including measurement of temporal activity of the pcomX promoter (pcomX) during competence induction [14]. LacZ has also been used successfully in S. mutans to measure gene expression in controlled conditions [22–24]. The GFP (green fluorescent protein) gene has also recently been used successfully as a reporter gene in S. mutans to assay transcriptional activity. As GFP requires no extraneous substrates or cofactors, it has an advantage over other reporter systems in experimental models where diffusion may limit access to a substrate [25,26]. In this study, we examined the effect of CSP on pcomX activity in S. mutans using lacZ and gfp gene reporters. The expression of pcomX::lacZ transcriptional fusions was examined in S. mutans UA159 and its comC mutant (SMCC3) defective in endogenous CSP production. For the gfp reporter, plasmid-based expression of pcomX::gfp transcriptional fusions was examined in biofilms of S. mutans UA159. Finally, the relationship between comX expression and transformation frequency in the natural growth cycle was explored in S. mutans
UA159 planktonic and biofilm cultures using pcomX:: lacZ.
2. Materials and methods 2.1. Bacterial strains and culture conditions S. mutans UA159 and comC mutant strains were maintained on Todd–Hewitt agar plates supplemented with 0.3% yeast extract (THYE) (BBL; Becton–Dickinson, Cockeysville, MD) supplemented with erythromycin (10 lg/ml) or spectinomycin (1200 lg/ml) as required. Strains were grown at 37 C overnight under 5% CO2. A summary of strains and plasmids used is shown in Table 1. 2.2. Construction of strain SMCC3 Strain SMCC3 harboring pcomX::lacZ was constructed by introduction of a spectinomycin gene into the comC locus via allelic exchange. Primer pairs comC-F, 5 0 -GACTAGTCATTGGCGGAAGCCTATCAAC-3 0 and comC-B, 5 0 -GCTCTAGAGCTCAGAACATCAAAAATGACCGTTTAGGAC-3 0 were used to amplify the PCRScript-comC plasmid outward from the flanking regions of comC. This generated a linear plasmid containing flanking S. mutans DNA without the intact comC open reading frame. A spectinomycin resistance cassette (primer pairs Spec F-5 0 -GCTCTAGAACTAATAACGTAACGTGACTGGC-3 0 containing an XbaI site and Spec B-5 0 -GACTAGTAAGTAGTTTCCGATATGGACGAG-3 0 containing a SpeI site) was amplified from pDL277 [27] and ligated to the PCR-Script-comC vector via XbaI and SpeI restriction sites. The new construct pComC2-KO was transformed into Epicurian E. coli XL-1 gold cells (Stratagene, La Jolla, CA) for propagation. Transformants were isolated on Luria–Bertani– spectinomycin (100 lg/ml) agar plates. Purified plasmids were digested with ScaI, transformed into S. mutans UA159 and transformants were selected on THYE–spectinomycin (1200 lg/ml) agar. 2.3. Construction pcomX::gfp vectors
of
pcomX::lacZ
reporter
and
For amplification of the S. mutans UA159 pcomX region, oligonucleotides were synthesized based upon the nucleotide sequence of pcomX and the intergenic region approximately 500 bp 5 0 upstream of the promoter region. The pcomX amplicon was then cloned into the S. mutans–E. coli replicative vector pALH122 [23] containing a promoterless lacZ reporter gene. Primer pairs (with restriction sites italicized) for cloning into pALH122 were 5 0 -TCCCCCGGGGGACTATTACGATGACCTCC-3 0 (PrF1 containing a SmaI site)
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
169
Table 1 List of strains and plasmids used Strain or plasmid
Relevant characteristic (s)a
Reference or source
S. mutans UA159 SMCC3 SMCOM1 SMCOM2 SMCOM3 SMCOM4 SMCOM5 SMCOM6
Wt; Sps Ems UA159::pcomC2-KO; comC Spr Ems SMCC3 containing pALH122 SMCC3 containing pcomX::pALH122 UA159 containing pDL277 UA159 containing pcomX::pDL277 UA159 containing pcomX::pALH122 UA159 containing pALH122
J. Ferretti, OU-ACGT This study This study This study This study This study This study This study
E. coli XL1-Blue
Cloning host
Stratagene
Plasmids PCR-script PcomC2-KO pALH122 pcomX::pALH122 pDL277 pMA2 pPROBE-ÔOT pcomX::pPROBE pcomX::pDL277
PCR cloning vector; Ampr PCR-script harboring an inactivated comC gene; Ampr Spr Streptococcus–E. coli shuttle vector containing lacZ cassette; Emr pALH122 containing pcomX-lacZ cassette; Emr Streptococcus–E.coli shuttle vector containing Sp cassette; Spr Streptococcus–E. coli shuttle vector used as transforming DNA; Spr Streptococcus–E. coli shuttle vector containing gfp cassette; Spr pPROBE-ÔOT containing pcomX::gfp cassette; Spr pDL277 containing pcomX-gfp cassette; Spr
Stratagene This study [27] This study
a
[28] This study This study
Wt, wild type.
and 5 0 -TCCCCCGGGGGACTATTAGAATGATTGTT-3 0 (PrB1 containing a SmaI site). This amplicon was cloned into the SmaI site of pALH122 generated pcomX::pALH122. The insert within pcomX::pALH122 was sequenced to confirm the orientation of the PCR amplified promoter region of the pcomX::lacZ insert. For the transformation frequency assays, pMA2 [28] was used as transforming DNA. To construct the pcomX::gfp reporter vector, a 200 bp region comprising pcomX and sequences 5 0 proximal was amplified with appropriately incorporated restriction sites for cloning. Primer pairs were 5 0 CGGAATTCAGGATCTGCTTAAGTGT (PrF5 containing an EcoRI site) and 5 0 -CCCAAGCTTGGGCTATTACGATGACCTCC (PrB6 contai- ning HindIII). The amplicon was subcloned into the EcoRI/HindIII site of pPROBE-ÔOT [29] upstream of the promoterless gfp cassette to generate pcomX::pPROBE-ÔOT. An amplicon consisting of the pcomX::gfp cassette was then PCR amplified from pcomX::PROBE-OTÕ using primer pairs PrF5 and 5 0 -ACATGCATGCTCATCCATGCCATGTGT (PrB7, incorpo- rating a Sph I site). The amplified pcomX::gfp cassette was cloned into the EcoRI/SphI site of pDL277[27] to generate pcomX::pDL277 and transformed into UA159 to generate strain SMCOM4. 2.4. b-Gal assay in planktonic and biofilm phase pComX transcriptional activity in planktonic cells was measured by a slight modification of the b-gal assay using 4-methyl-umbelliferyl b-D -galactopyranoside
(MUG) (Molecular Probes, Eugene, OR) as the b-galactosidase substrate [23]. Ten ml cultures grown overnight at 37 C TYE supplemented with 0.5% glucose (TYG) were pelleted in prewarmed medium and grown to early log phase (OD600 0.15–0.2) and to inoculate 90 ml prewarmed TYG and cells were grown to early log phase. For strain SMCC3 with a comC background, exogenous CSP (1 lg/ml) was added. For each sampling time, cells were centrifuged briefly, resuspended in TES (10 mM Tris, 1 mM EDTA, 150 mM NaCl, pH 8.0) and mechanically lysed in a beadbeater (BIO101 FastPrep 120) for 20 s, speed 6. Ten microliter lysate was added to 80 ll AB buffer (60 mM K2HPO4, 40 mM KH2PO4, 100 mM NaCl) in triplicate in microtiter wells (COSTAR black side, clear bottom wells). Twenty microliter MUG (1.2 mM) was added and reactions incubated for 30 min. Two hundred microliter AB buffer was then added to each well to slow or terminate the substrate reaction to minimum levels for standardization. Fluorescence intensity was measured in a fluorescent plate reader (BioTek FL600 Microplate Fluorescence Reader) at 355 nm excitation, 460 nm emission. Data for each replicate was expressed as mean fluorescence index (MFI), or mean fluorescent units (MFU) per total amount of protein (lg/ml) in 10 ll lysate assayed. A relative expression index (REI) for each sampling time was standardized by dividing mean values of lacZ reporter strains by mean values of wild type controls. Experiments were performed with triplicate independent cultures with the standard error of the mean calculated for triplicate relative expression indices.
170
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Analysis of b-gal reporter activity of pcomX in biofilm cells of S. mutans UA159 was similar to the measurement of b-gal activity in planktonic phase cells except for the following minor differences. Two hundred microliter of cultures grown overnight in THYE were transferred to 20 ml of 1:4 diluted biofilm medium (THYE with 5 mM glucose) in a standard size petri dish. Cells were grown overnight to allow for biofilm formation. Biofilm medium was then decanted carefully to preserve intact biofilms and the medium was replaced with fresh TYE. Biofilm cells were allowed to grow for 2 h to attain genetic competence. The supernatant was removed, and the competent biofilms cells were scraped and harvested from the petri dish substratum using a rubber scraper before resuspension in TES. The harvested biofilms were then processed for the b-gal assay as previously described.
activity assayed via lacZ reporter expression 5 min before CSP addition and 5, 10 and 15 min after addition of CSP. Data are presented as MFU/total protein (lg/ ml) in 10 ll lysate (Fig. 1). b-gal activity for control strain SMCOM1 was stably maintained for all time points assayed (data not shown). The REI was calculated by dividing mean values of strain SMCOM2 (pcomX::lacZ) with mean fluorescent values of strain SMCOM1 (pALH122). Five min and 10 min after CSP addition, REI of strain SMCOM2 increased by about 2-fold, decreasing to near time point 0 and 5 levels 15 min post-CSP addition. (Fig. 1) The mean at 5 and 10 min is almost 25% higher than that of the 0 and 5 time point levels. 3.2. Effect of endogenous CSP on b-gal activity in S. mutans UA159 during growth in biofilms
2.5. Transformation assay One microgram pMA2/ml [28] was added as the transforming DNA to determine the transformation frequency of the S. mutans UA159 biofilm. Plasmid DNA was added at the same time points used to assay pcomX activity following induction of competence after 2 h biofilm growth. Biofilms were scraped and harvested from the plate, dispersed by brief sonication and resuspended in 2 ml 10 mM KPO4 buffer (PB, pH 7.2). Cells were serially diluted and spread on THYE plates containing appropriate antibiotics (1200 lg/ml spec). After a 48-h incubation, transformation frequency was determined and expressed as the percentage of transformants over total viable recipient cells.
b-Gal activity was also assayed during growth of S. mutans UA159 during early biofilm development. Biofilms of strain SMCOM1 were grown to competence for 2 h before being pooled and harvested for assays. PcomX activity was determined for the first 10 min followed by samples assayed after 1, 2, 3 and 4 h (Fig. 2(a)). b-gal activity exhibited a significant increase (p = 0.002) of nearly 1.5-fold in REI at 1 h relative to the first 10-min time point. Relative b-gal activity was linear for 3 h post-CSP addition with maximal activity observed at 3 h. The 3 h activity was 3-fold higher than the 0.1 h start point (p < 0.001). Expression reached a plateau after 4 h.
2.6. Confocal scanning laser microscopy observation of pcomX::gfp activity 3
relative expression index
pComX transcriptional activity was visualized using SMCOM4 biofilms. Thirty microliter of an overnight THYE culture were transferred to 3 ml biofilm medium (1:4 diluted THYE with 5 mM glucose final concentration) in 35 · 10 mm petri dishes. After an overnight incubation, the medium was removed carefully so as not to disrupt the biofilm. Fresh THYE was added and the biofilm incubated for 4 h. Spent medium was decanted and 3 ml 50 mM phosphate buffer was carefully added to the biofilm to enhance fluorescence [21]. The biofilms were observed directly by CSLM with a 100· water immersion lens (LSM 510, Zeiss, Germany)
2.5
2 +CSP 1.5
1
0.5
0
3. Results 3.1. Effect of exogenous CSP on pcomX expression through b-gal reporter activity One microliter exogenous CSP was added at time point 0 to planktonic cultures and pcomX transcriptional
-5
0
5
10
15
time (min) post CSP addition Fig. 1. Effect of exogenous CSP on pcomX activity in strain SMCOM2. Results are expressed as the relative expression index (REI) and are derived by dividing mean fluorescence values of strain SMCOM2 by mean fluorescence values of control strain SMCOM1. Standard error of the mean of REI was calculated from triplicate independent cultures.
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174 pComX::lacZ reporter activity of S. mutansstrain SMCOM1 in harvested biofilms
relative expression index
(a) 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
0.1
(b) % transformation frequency
171
1
2 time (hr)
3
4
Temporal assay of natural transformation of S. mutans strain SMCOM1 biofilms 0.03 0.025 0.02 0.015 0.01 0.005 0 0 .1
1
2 time (hr)
3
4
pComx::pALH122
Fig. 2. Effect of endogenous CSP on pcomX::lacZ activity in biofilms of S. mutans strain SMCOM1. Biofilms were incubated for 2 h in fresh THYE medium prior to pooling. Data was expressed as the REI and mean standard deviation of triplicate samplings for each time point (a). In the temporal assay of natural transformation for strain SMCOM1, 1 lg/ml transforming DNA was added up to 4 h after a 2-h incubation in fresh THYE (b).
3.3. Transformation frequencies of S. mutans UA159 biofilms relative to pcomX::lacZ activity To determine if natural competence development in biofilms reflects a similar temporal trend to expression of pcomX::lacZ in strain SMCOM5, transformation frequencies were determined at the same time points used to assay b-gal activity. Biofilms were grown for 2 h to induce competence induction at which point 1 lg/ml pMA2 was transformed into the cells. Transformation frequencies were determined for several time points and plotted (Fig. 2(b)). A greater than 2-fold increase was seen in transformation frequency after the 10-min time point, with a maxima at 3 h with at least a 10-fold and 5-fold increase in transformation frequency relative to the 1 and 2-h time points, respectively. At the fourth hour, a nearly 5-fold reduction in transformation frequency relative to the third hour was observed, suggesting that transformability was maximal at 3 h after induction of competence. This time point coincided with the peak of b-gal activity observed after 3 h in biofilms grown to competence, suggesting a positive correlation between pcomX upregulation and increased uptake and expression of transforming DNA in S. mutans UA159 biofilms. A pronounced decrease
in transformation frequency relative to the slight increase in pcomX expression at 4 h could be due to the continued presence of saturating levels of accumulated CSP. Other physiological mechanisms involved in DNA uptake could be attenuated to conserve cellular energy as the bacterium senses that density dependent uptake of foreign DNA is no longer necessary. 3.4. CSLM of GFP expression of strain SMCOM4 in biofilms Biofilms of strain SMCOM4 grown on a polystyrene surface were observed under CSLM in situ after 4-h incubation in fresh medium. Control strain SMCOM3 revealed no GFP expression (data not shown). Upregulation of pcomX was evidenced by the sporadic expression of GFP visible in small subsets of the population (Fig. 3). Superimposition of the images from CSLM (Fig. 3(b)) over those from differential interference contrast (DIC) microscopy (Fig. 3(a)) revealed variations in fluorescence intensity among cell clusters (Fig. 3(c)). The overall patterns of GFP expression suggested a random distribution of ComX upregulation with peak expression within scattered microclusters of cells.
172
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Fig. 3. CSLM analysis of strain SMCOM4 containing a comX:: gfp reporter plasmid and grown as a 4 h biofilm. A DIC image of a single field of view (a); the same field of view by CSLM fluorescence detection (b); and overlay of DIC image from panel a on CSLM image in panel b (c). Panel c reveals GFP fluorescence in microclusters of high cell density in the biofilm population.
4. Discussion ComX is an alternative sigma factor that activates late competence genes which drive processing and integration of foreign DNA to the streptococcal chromosome. It is upregulated in response to CSP-induced activation of the competence cascade. The working model for the CSP regulon in S. mutans suggests that when CSP reaches a critical density outside the cell, adjacent cells will detect CSP through a sensor kinaseresponse regulator involving ComD and ComE, respectively. In its active form, phosphorylated ComE is then believed to induce expression of comX [15,13]. The use of a transcriptional fusion of pcomX to a lacZ gene allowed us to confirm the response of comX promoter driven transcription to the presence of active CSP in S. mutans and to correlate this with the competent state in biofilms. We observed an initial peak of pcomX transcription at the 5- and 10-min time points following exogenous CSP addition followed by attenuation after 15 min. It has been previously shown that in S. pneumoniae naive cells exposed to exogenous CSP there was a peak in pcomX mRNA levels after 5 min that continued to the 12-min time point, after which there was a steady reduction to near baseline levels after 15 min [14,19]. Luo and Morrison [30] also demonstrated through Western blot assay using anti-ComX antibody that the ComX protein in S. pneumoniae is maximally present at about 10–20 min after CSP addition. The steady reduction in pcomX transcriptional activity after 10 min in S. mutans UA159 planktonic cultures suggests that maximal transcriptional activity within a short time window of under 10 min appears to be present in both species after competence induction by exogenous CSP. The brief period of pcomX transcriptional activity may reflect a conservation of cellular activity so that the minimal requirements for acti-
vation of the competence genes are maintained. However, the extended competence window present in biofilms indicates that CSP may mediate many more processes in a biofilm, acting as a biofilm ‘‘switch’’ instead of merely a 10-min event observed during growth in liquid media (planktonic phase). Approximately 0.03% (3/1000) of biofilm cells were shown to be competent using the natural transformation assay. Using CSLM, a similar low percentage of cells exhibited GFP fluorescence. Significantly, only a small percentage of cells appear to be competent at any given time and take up DNA even under the CSP saturating conditions used. These data suggest that the time of peak transformation frequency observed in tandem with maximal competence induction likely represent parallel events in the competence regulatory cycle and that they occur in a scattered population of biofilm cells. Nevertheless, after a 4-h incubation in fresh medium, the biofilm cells would have produced sufficient amounts of CSP to upregulate pcomX transcription. Upregulation of competence genes may be localized to discrete microniches within the biofilm where signal transduction mechanisms related to quorum sensing are most active. These subpopulations may represent foci of optimal cell density, metabolic state, growth rate, substrate availability and end product accumulation. The general trend of a gradual increase in comX transcription in the biofilm reflects the stable nature of bacterial communities living as a biofilm. It is possible that an eventual build-up of cell density and its effect on subsequent CSP production and localized pcomX activation occurs in a more concerted pattern. The longer time during which pcomX expression in biofilms approaches maximal activity when compared with cells in planktonic culture possibly reflects the longer time it takes to achieve the stabilized critical density necessary for competence development in the biofilm.
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Nevertheless, after a 4-h incubation in fresh medium, biofilm cells in the population should likely have produced sufficient amounts of CSP to upregulate comX transcription. S. mutans in vitro biofilms, once well established and stable, are also a highly transformable system with a hyperactive competence induction system, acquiring DNA readily from the local environment [13]. Accumulation of extracellular substrates or macromolecules possibly mitigates immediate dispersion of signal peptides, such as CSP, to neighboring cells, leading to slower competence induction among cells in the biofilm. Future studies of comX expression in S. mutans biofilms will address the response of the competent biofilm as a whole to controlled environmental and metabolic changes such as pH and temperature, which can influence biofilm behavior and transformation efficiency.
Acknowledgements Our work was supported by a Grant from the National Institute of Dental and Craniofacial Research R01DE013230–03, Grant MT-15431 from The Canadian Institutes of Health Research. D.G. Cvitkovitch is supported by a Canada Research Chair. R.P. Ellen is a member of the CIHR group in Matrix Dynamics.
References [1] Claverys, J.P. and Martin, B. (1998) Competence regulons, genomics and streptococci. Mol. Microbiol. 29, 1126–1127. [2] Cvitkovitch, D.G. (2001) Genetic competence and transformation in oral streptococci. Crit. Rev. Oral. Biol. Med. 12 (3), 217–243. [3] Lorenz, M.G. and Wackernagel, W. (1994) Bacterial gene transfer by natural genetic transformation in the environment. Microbiol. Rev. 58, 563–602. [4] Havarstein, L.S. and Morrison, D.A. (1999) Quorum sensing and peptide pheromones in streptococcal competence for genetic transformation In: Cell–cell Signaling in Bacteria (Dunny, G.M. and Winans, S.C., Eds.), pp. 9–192. ASM Press, Washington, DC. [5] Lunsford, R.D. and London, J. (1996) Natural genetic transformation in Streptococcus gordonii comX imparts spontaneous on strain wicky. J. Bacteriol. 178, 5831–5835. [6] Pestova, E.V., Havarstein, L.S. and Morrison, D.A. (1996) Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol. Microbiol. 21, 853–862. [7] Dunny, G.M. and Leonard, B.A. (1997) Cell–cell communication in Gram-positive bacteria. Ann. Rev. Microbiol. 51, 527–564. [8] Kleerebezem, M., Quadri, L.E., Kuipers, O.P. and de Vos, W.M. (1997) Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Mol. Microbiol. 24, 895–904. [9] Loesche, W.J. (1986) Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50, 353–380.
173
[10] Costerton, J.W., Stewart, P.S. and Greenberg, E.P. (1999) Bacterial biofilms: a common cause of persistent infections. Science 248, 1318–1322. [11] Morrison, D.A. and Lee, M.S. (2000) Regulation of competence for genetic transformation in Streptococcus pneumoniae: a link between quorum sensing and DNA processing genes. Res. Microbiol. 151, 445–451. [12] Petersen, F.C. and Scheie, A.A. (2000) Genetic transformation in Streptococcus mutans requires a peptide secretion-like apparatus. Oral. Microbiol. Immunol. 15 (5), 329–334. [13] Li, Y.H., Lau, P.C., Lee, J.H., Ellen, R.P. and Cvitkovitch, D.G. (2001) Natural genetic transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183, 897–908. [14] Lee, M.S. and Morrison, D.A. (1999) Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation. J. Bacteriol. 181, 5004– 5016. [15] Li, Y.H., Tang, N., Aspiras, M.B., Lau, P.C.Y., Lee, J.H., Ellen, R.P. and Cvitkovitch, D.G. (2002) A quorum-sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation. J. Bacteriol. 184, 2699–2708. [16] Campbell, E.A., Choi, S.Y. and Masure, H.R. (1998) A competence regulon in Streptococcus pneumoniae revealed by genomic analysis. Mol. Microbiol. 27, 929–939. [17] Martin, B., Garcia, P., Castanie, M.P. and Claverys, J.P. (1995) The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls lysogenic induction. Mol. Microbiol. 15, 367–379. [18] Pestova, E.V. and Morrison, D.A. (1998) Isolation and characterization of three Streptococcus pneumoniae transformationspecific loci by use of a lacZ reporter insertion vector. J. Bacteriol. 180, 2701–2710. [19] Peterson, S., Cline, R.T., Tettelin, H., Sharov, V. and Morrison, D.A. (2000) Gene expression analysis of the Streptococcus pneumoniae competence regulons by use of DNA microarrays. J. Bacteriol. 182, 6192–6202. [20] Peterson, S.N., Sung, C.K., Cline, R., Desai, B.V., Snesrud, E.C., Luo, P., Walling, J., Li, H., Mintz, M., Tsegaye, G., Burr, P.C., Do, Y., Ahn, S., Gilbert, J., Fleischmann, R.D. and Morrison, D.A. (2004) Identification of competence pheromone responsive genes in Streptococcus pneumoniae by use of DNA microarrays. Mol. Microbiol. 51 (4), 1051– 1070. [21] Yoshida, A. and Kuramitsu, H.K. (2002) Streptococcus mutans biofilm formation:utilization of a gtfB promoter-green fluorescent protein (PgtfB::gfp) construct to monitor development. Microbiol. 148, 3385–3394. [22] Cvitkovitch, D.G., Gutierrez, J.A., Behari, J., Youngman, P.J., Wetz, J.E., Crowley, P.J., Hillman, J.D., Brady, J.L. and Bleiweis, A.S. (2000) Tn917-lac mutagenesis of Streptococcus mutans to identify environmentally regulated genes. FEMS Microbiol. Lett. 182 (1), 149–154. [23] Honeyman, A.L., Cote, C.K. and Curtiss III, R. (2002) Construction of transcriptional and translational lacZ gene reporter plasmids for use in Streptococcus mutans. J. Microbiol. Meth. 49, 163–171. [24] Sato, Y., Yamamoto, Y., Suzuki, R., Kizaki, H. and Kuramitsu, H.K. (1991) Construction of scrA::lacZ gene fusions to investigate regulation of the sucrose PTS of Streptococcus mutans. FEMS Microbiol. Lett. 63 (2-3), 339–345. [25] Chalfie, M., Tu, Y., Euskirchen, E., Ward, W.W. and Prasher, D.C. (1994) Green fluorescent protein as a marker for gene expression. Science 263, 802–805. [26] Cubitt, A.G., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A. and Tsien, R.Y. (1995) Understanding, improving and
174
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
using green fluorescent proteins. Trends Biochem. Sci. 20, 448–455. [27] Macrina, F.L., Evans, R.P., Tobian, J.A., Hartley, D.L., Clewell, D.B. and Jones, K.R. (1983) Novel shuttle plasmid vehicles for Escherichia–Streptococcus transgeneric cloning. Gene 25, 145–150. [28] Aspiras, M.B., Kazmerzak, K.K., Kolenbrander, P.E., McNab, R., Hardegen, N. and Jenkinson, H.F. (2000) Expression of green fluorescent protein in Streptococcus gordonii DL1 and its use as a species-specific marker in coadhesion with Streptococ-
cus oralis 34 in saliva-conditioned biofilms in vitro. Appl. Environ. Microbiol. 66, 4074–4083. [29] Miller, W.G., Leveau, J.H.J. and Lindow, S.E. (2000) Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol. Plant Microb. Interact. 13 (11), 1243–1250. [30] Luo, P. and Morrison, D.A. (2003) Transient association of an alternative sigma factor, comX, with RNA polymerase during the period of competence for genetic transformation in Streptococcus pneumoniae. J. Bacteriol. 185, 349–358.
ComX activity of Streptococcus mutans growing in biofilms Marcelo B. Aspiras, Richard P. Ellen, Dennis G. Cvitkovitch
*
Faculty of Dentistry, University of Toronto, 124 Edward Street, Toronto, Ont., Canada M5G 1G6 Received 26 May 2004; received in revised form 26 May 2004; accepted 15 July 2004 First published online 28 July 2004
Abstract In many streptococci, including Streptococcus mutans, genetic competence is regulated by a quorum sensing system mediated by a competence stimulating peptide (CSP) pheromone, encoded by the comC gene. In Streptococcus pneumoniae, a central component of this system is ComX, which acts as an alternative sigma factor to activate competence genes involved in DNA uptake and processing. The quorum sensing system responsible for genetic competence induction in S. mutans has been linked to biofilm formation and the acid tolerance response. To examine the response of comX to CSP in S. mutans, a transcriptional fusion of the comX promoter (pcomX) with lacZ was constructed to generate reporter vector pcomx::pALH122 (replicative vector) and transformed into S. mutans UA159 comC, which is unable to produce endogenous CSP. CSP was added and pcomX::lacZ relative expression index (REI) examined, revealing a 2-fold increase in maximal b-gal activity 5 and 10 min after CSP addition. The effect of endogenous CSP on pcomX::lacZ expression was also examined by measuring REI in cells grown as a biofilm; peak pcomX activity was observed at 3 h. To determine the temporal pattern of transformation frequency, pMA2, a Spr shuttle vector, was transformed into biofilm-grown cells, with maximal transformation frequency observed at 3 h. Confocal microscopy was performed to examine pcomX activity using a similarly constructed green fluorescent protein reporter vector, pcomX::gfp, in a 4-h biofilm, revealing active pcomX activity in high cell density areas within the biofilm population. These results demonstrated a positive correlation between pcomX activity, natural transformation and competence development in biofilms. 2004 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. Keywords: Competence; Biofilm; Streptococcus mutans
1. Introduction Genetic competence is a physiologic state that enables bacteria to internalize and incorporate foreign DNA into the chromosome. DNA uptake by a bacterium enhances its ability to survive and adapt in the natural environment [1–3]. Genetic competence in many streptococci is governed by a quorum sensing competence stimulating peptide (CSP)-dependent signal trans-
* Corresponding author. Tel.: +1 416 979 4917x4592; fax: +1 416 979 4936. E-mail address: [email protected] (D.G. Cvitkovitch).
duction system which regulates a range of bacterial adaptive responses to stimuli resulting from environmental changes [4–6]. Quorum sensing is initiated by a CSP, a cytoplasmic membrane integrated histidine kinase sensor and an intracellular response regulator [7,8]. As an effector molecule, the response regulator is involved in the up or downregulation of specific genes, including comX. Streptococcus mutans is a major contributor to human dental caries [9]. Under conditions of high carbohydrate intake by the host, acid production by these bacteria can lead to demineralization of the subjacent tooth surface. Bacterial cells are known to alter expression of certain genes in the transition from the planktonic (free living) state to the biofilm environment,
0378-1097/$22.00 2004 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. doi:10.1016/j.femsle.2004.07.032
168
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
and this would appear to be the case with S. mutans in dental plaque [10]. CSP activates expression of several competence genes including those encoding proteins of the DNA processing pathway [11,12]. At least six gene products encoded by comAB [12], comCDE [13] and comX [14] are known to be involved in cell–cell signaling in streptococci. In S. mutans, the role of these genes in competence induction and the central role played by CSP in their regulation has been demonstrated [15,13]. ComA and comB encode a CSP-specific exporting apparatus comprised of an ATP-binding cassette (ABC) transporter (ComA) and its accessory protein (ComB), which are involved in the processing and secretion of CSP. ComC, comD and comE, respectively encode the CSP precursor, its histidine kinase sensor protein and the cognate response regulator. ComC and comED are adjacently located on the chromosome and appear to be divergently transcribed, while comA and comB are situated in a different area of the chromosome [13]. In Streptococcus pneumoniae, ComE activates a number of early competence genes including ComX, an alternate sigma factor that initiates transcription of late competence genes required for DNA uptake and recombination [14]. ComX dependent genes including ssbB, dalA, ccl, celAB, cAAB, and cinA-recA possess a unique consensus sequence (TACGAATA) in their promoter regions. [1,16,17–20]. Similarly, the homolog of the comX alternate sigma factor in S. mutans is postulated to direct transcription by RNA polymerase of several competence related genes as a result of the CSP-induced signal cascade. The b-galactosidase (lacZ) gene has been extensively used to assay transcriptional activity of several genes in S. pneumoniae [21], including measurement of temporal activity of the pcomX promoter (pcomX) during competence induction [14]. LacZ has also been used successfully in S. mutans to measure gene expression in controlled conditions [22–24]. The GFP (green fluorescent protein) gene has also recently been used successfully as a reporter gene in S. mutans to assay transcriptional activity. As GFP requires no extraneous substrates or cofactors, it has an advantage over other reporter systems in experimental models where diffusion may limit access to a substrate [25,26]. In this study, we examined the effect of CSP on pcomX activity in S. mutans using lacZ and gfp gene reporters. The expression of pcomX::lacZ transcriptional fusions was examined in S. mutans UA159 and its comC mutant (SMCC3) defective in endogenous CSP production. For the gfp reporter, plasmid-based expression of pcomX::gfp transcriptional fusions was examined in biofilms of S. mutans UA159. Finally, the relationship between comX expression and transformation frequency in the natural growth cycle was explored in S. mutans
UA159 planktonic and biofilm cultures using pcomX:: lacZ.
2. Materials and methods 2.1. Bacterial strains and culture conditions S. mutans UA159 and comC mutant strains were maintained on Todd–Hewitt agar plates supplemented with 0.3% yeast extract (THYE) (BBL; Becton–Dickinson, Cockeysville, MD) supplemented with erythromycin (10 lg/ml) or spectinomycin (1200 lg/ml) as required. Strains were grown at 37 C overnight under 5% CO2. A summary of strains and plasmids used is shown in Table 1. 2.2. Construction of strain SMCC3 Strain SMCC3 harboring pcomX::lacZ was constructed by introduction of a spectinomycin gene into the comC locus via allelic exchange. Primer pairs comC-F, 5 0 -GACTAGTCATTGGCGGAAGCCTATCAAC-3 0 and comC-B, 5 0 -GCTCTAGAGCTCAGAACATCAAAAATGACCGTTTAGGAC-3 0 were used to amplify the PCRScript-comC plasmid outward from the flanking regions of comC. This generated a linear plasmid containing flanking S. mutans DNA without the intact comC open reading frame. A spectinomycin resistance cassette (primer pairs Spec F-5 0 -GCTCTAGAACTAATAACGTAACGTGACTGGC-3 0 containing an XbaI site and Spec B-5 0 -GACTAGTAAGTAGTTTCCGATATGGACGAG-3 0 containing a SpeI site) was amplified from pDL277 [27] and ligated to the PCR-Script-comC vector via XbaI and SpeI restriction sites. The new construct pComC2-KO was transformed into Epicurian E. coli XL-1 gold cells (Stratagene, La Jolla, CA) for propagation. Transformants were isolated on Luria–Bertani– spectinomycin (100 lg/ml) agar plates. Purified plasmids were digested with ScaI, transformed into S. mutans UA159 and transformants were selected on THYE–spectinomycin (1200 lg/ml) agar. 2.3. Construction pcomX::gfp vectors
of
pcomX::lacZ
reporter
and
For amplification of the S. mutans UA159 pcomX region, oligonucleotides were synthesized based upon the nucleotide sequence of pcomX and the intergenic region approximately 500 bp 5 0 upstream of the promoter region. The pcomX amplicon was then cloned into the S. mutans–E. coli replicative vector pALH122 [23] containing a promoterless lacZ reporter gene. Primer pairs (with restriction sites italicized) for cloning into pALH122 were 5 0 -TCCCCCGGGGGACTATTACGATGACCTCC-3 0 (PrF1 containing a SmaI site)
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
169
Table 1 List of strains and plasmids used Strain or plasmid
Relevant characteristic (s)a
Reference or source
S. mutans UA159 SMCC3 SMCOM1 SMCOM2 SMCOM3 SMCOM4 SMCOM5 SMCOM6
Wt; Sps Ems UA159::pcomC2-KO; comC Spr Ems SMCC3 containing pALH122 SMCC3 containing pcomX::pALH122 UA159 containing pDL277 UA159 containing pcomX::pDL277 UA159 containing pcomX::pALH122 UA159 containing pALH122
J. Ferretti, OU-ACGT This study This study This study This study This study This study This study
E. coli XL1-Blue
Cloning host
Stratagene
Plasmids PCR-script PcomC2-KO pALH122 pcomX::pALH122 pDL277 pMA2 pPROBE-ÔOT pcomX::pPROBE pcomX::pDL277
PCR cloning vector; Ampr PCR-script harboring an inactivated comC gene; Ampr Spr Streptococcus–E. coli shuttle vector containing lacZ cassette; Emr pALH122 containing pcomX-lacZ cassette; Emr Streptococcus–E.coli shuttle vector containing Sp cassette; Spr Streptococcus–E. coli shuttle vector used as transforming DNA; Spr Streptococcus–E. coli shuttle vector containing gfp cassette; Spr pPROBE-ÔOT containing pcomX::gfp cassette; Spr pDL277 containing pcomX-gfp cassette; Spr
Stratagene This study [27] This study
a
[28] This study This study
Wt, wild type.
and 5 0 -TCCCCCGGGGGACTATTAGAATGATTGTT-3 0 (PrB1 containing a SmaI site). This amplicon was cloned into the SmaI site of pALH122 generated pcomX::pALH122. The insert within pcomX::pALH122 was sequenced to confirm the orientation of the PCR amplified promoter region of the pcomX::lacZ insert. For the transformation frequency assays, pMA2 [28] was used as transforming DNA. To construct the pcomX::gfp reporter vector, a 200 bp region comprising pcomX and sequences 5 0 proximal was amplified with appropriately incorporated restriction sites for cloning. Primer pairs were 5 0 CGGAATTCAGGATCTGCTTAAGTGT (PrF5 containing an EcoRI site) and 5 0 -CCCAAGCTTGGGCTATTACGATGACCTCC (PrB6 contai- ning HindIII). The amplicon was subcloned into the EcoRI/HindIII site of pPROBE-ÔOT [29] upstream of the promoterless gfp cassette to generate pcomX::pPROBE-ÔOT. An amplicon consisting of the pcomX::gfp cassette was then PCR amplified from pcomX::PROBE-OTÕ using primer pairs PrF5 and 5 0 -ACATGCATGCTCATCCATGCCATGTGT (PrB7, incorpo- rating a Sph I site). The amplified pcomX::gfp cassette was cloned into the EcoRI/SphI site of pDL277[27] to generate pcomX::pDL277 and transformed into UA159 to generate strain SMCOM4. 2.4. b-Gal assay in planktonic and biofilm phase pComX transcriptional activity in planktonic cells was measured by a slight modification of the b-gal assay using 4-methyl-umbelliferyl b-D -galactopyranoside
(MUG) (Molecular Probes, Eugene, OR) as the b-galactosidase substrate [23]. Ten ml cultures grown overnight at 37 C TYE supplemented with 0.5% glucose (TYG) were pelleted in prewarmed medium and grown to early log phase (OD600 0.15–0.2) and to inoculate 90 ml prewarmed TYG and cells were grown to early log phase. For strain SMCC3 with a comC background, exogenous CSP (1 lg/ml) was added. For each sampling time, cells were centrifuged briefly, resuspended in TES (10 mM Tris, 1 mM EDTA, 150 mM NaCl, pH 8.0) and mechanically lysed in a beadbeater (BIO101 FastPrep 120) for 20 s, speed 6. Ten microliter lysate was added to 80 ll AB buffer (60 mM K2HPO4, 40 mM KH2PO4, 100 mM NaCl) in triplicate in microtiter wells (COSTAR black side, clear bottom wells). Twenty microliter MUG (1.2 mM) was added and reactions incubated for 30 min. Two hundred microliter AB buffer was then added to each well to slow or terminate the substrate reaction to minimum levels for standardization. Fluorescence intensity was measured in a fluorescent plate reader (BioTek FL600 Microplate Fluorescence Reader) at 355 nm excitation, 460 nm emission. Data for each replicate was expressed as mean fluorescence index (MFI), or mean fluorescent units (MFU) per total amount of protein (lg/ml) in 10 ll lysate assayed. A relative expression index (REI) for each sampling time was standardized by dividing mean values of lacZ reporter strains by mean values of wild type controls. Experiments were performed with triplicate independent cultures with the standard error of the mean calculated for triplicate relative expression indices.
170
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Analysis of b-gal reporter activity of pcomX in biofilm cells of S. mutans UA159 was similar to the measurement of b-gal activity in planktonic phase cells except for the following minor differences. Two hundred microliter of cultures grown overnight in THYE were transferred to 20 ml of 1:4 diluted biofilm medium (THYE with 5 mM glucose) in a standard size petri dish. Cells were grown overnight to allow for biofilm formation. Biofilm medium was then decanted carefully to preserve intact biofilms and the medium was replaced with fresh TYE. Biofilm cells were allowed to grow for 2 h to attain genetic competence. The supernatant was removed, and the competent biofilms cells were scraped and harvested from the petri dish substratum using a rubber scraper before resuspension in TES. The harvested biofilms were then processed for the b-gal assay as previously described.
activity assayed via lacZ reporter expression 5 min before CSP addition and 5, 10 and 15 min after addition of CSP. Data are presented as MFU/total protein (lg/ ml) in 10 ll lysate (Fig. 1). b-gal activity for control strain SMCOM1 was stably maintained for all time points assayed (data not shown). The REI was calculated by dividing mean values of strain SMCOM2 (pcomX::lacZ) with mean fluorescent values of strain SMCOM1 (pALH122). Five min and 10 min after CSP addition, REI of strain SMCOM2 increased by about 2-fold, decreasing to near time point 0 and 5 levels 15 min post-CSP addition. (Fig. 1) The mean at 5 and 10 min is almost 25% higher than that of the 0 and 5 time point levels. 3.2. Effect of endogenous CSP on b-gal activity in S. mutans UA159 during growth in biofilms
2.5. Transformation assay One microgram pMA2/ml [28] was added as the transforming DNA to determine the transformation frequency of the S. mutans UA159 biofilm. Plasmid DNA was added at the same time points used to assay pcomX activity following induction of competence after 2 h biofilm growth. Biofilms were scraped and harvested from the plate, dispersed by brief sonication and resuspended in 2 ml 10 mM KPO4 buffer (PB, pH 7.2). Cells were serially diluted and spread on THYE plates containing appropriate antibiotics (1200 lg/ml spec). After a 48-h incubation, transformation frequency was determined and expressed as the percentage of transformants over total viable recipient cells.
b-Gal activity was also assayed during growth of S. mutans UA159 during early biofilm development. Biofilms of strain SMCOM1 were grown to competence for 2 h before being pooled and harvested for assays. PcomX activity was determined for the first 10 min followed by samples assayed after 1, 2, 3 and 4 h (Fig. 2(a)). b-gal activity exhibited a significant increase (p = 0.002) of nearly 1.5-fold in REI at 1 h relative to the first 10-min time point. Relative b-gal activity was linear for 3 h post-CSP addition with maximal activity observed at 3 h. The 3 h activity was 3-fold higher than the 0.1 h start point (p < 0.001). Expression reached a plateau after 4 h.
2.6. Confocal scanning laser microscopy observation of pcomX::gfp activity 3
relative expression index
pComX transcriptional activity was visualized using SMCOM4 biofilms. Thirty microliter of an overnight THYE culture were transferred to 3 ml biofilm medium (1:4 diluted THYE with 5 mM glucose final concentration) in 35 · 10 mm petri dishes. After an overnight incubation, the medium was removed carefully so as not to disrupt the biofilm. Fresh THYE was added and the biofilm incubated for 4 h. Spent medium was decanted and 3 ml 50 mM phosphate buffer was carefully added to the biofilm to enhance fluorescence [21]. The biofilms were observed directly by CSLM with a 100· water immersion lens (LSM 510, Zeiss, Germany)
2.5
2 +CSP 1.5
1
0.5
0
3. Results 3.1. Effect of exogenous CSP on pcomX expression through b-gal reporter activity One microliter exogenous CSP was added at time point 0 to planktonic cultures and pcomX transcriptional
-5
0
5
10
15
time (min) post CSP addition Fig. 1. Effect of exogenous CSP on pcomX activity in strain SMCOM2. Results are expressed as the relative expression index (REI) and are derived by dividing mean fluorescence values of strain SMCOM2 by mean fluorescence values of control strain SMCOM1. Standard error of the mean of REI was calculated from triplicate independent cultures.
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174 pComX::lacZ reporter activity of S. mutansstrain SMCOM1 in harvested biofilms
relative expression index
(a) 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
0.1
(b) % transformation frequency
171
1
2 time (hr)
3
4
Temporal assay of natural transformation of S. mutans strain SMCOM1 biofilms 0.03 0.025 0.02 0.015 0.01 0.005 0 0 .1
1
2 time (hr)
3
4
pComx::pALH122
Fig. 2. Effect of endogenous CSP on pcomX::lacZ activity in biofilms of S. mutans strain SMCOM1. Biofilms were incubated for 2 h in fresh THYE medium prior to pooling. Data was expressed as the REI and mean standard deviation of triplicate samplings for each time point (a). In the temporal assay of natural transformation for strain SMCOM1, 1 lg/ml transforming DNA was added up to 4 h after a 2-h incubation in fresh THYE (b).
3.3. Transformation frequencies of S. mutans UA159 biofilms relative to pcomX::lacZ activity To determine if natural competence development in biofilms reflects a similar temporal trend to expression of pcomX::lacZ in strain SMCOM5, transformation frequencies were determined at the same time points used to assay b-gal activity. Biofilms were grown for 2 h to induce competence induction at which point 1 lg/ml pMA2 was transformed into the cells. Transformation frequencies were determined for several time points and plotted (Fig. 2(b)). A greater than 2-fold increase was seen in transformation frequency after the 10-min time point, with a maxima at 3 h with at least a 10-fold and 5-fold increase in transformation frequency relative to the 1 and 2-h time points, respectively. At the fourth hour, a nearly 5-fold reduction in transformation frequency relative to the third hour was observed, suggesting that transformability was maximal at 3 h after induction of competence. This time point coincided with the peak of b-gal activity observed after 3 h in biofilms grown to competence, suggesting a positive correlation between pcomX upregulation and increased uptake and expression of transforming DNA in S. mutans UA159 biofilms. A pronounced decrease
in transformation frequency relative to the slight increase in pcomX expression at 4 h could be due to the continued presence of saturating levels of accumulated CSP. Other physiological mechanisms involved in DNA uptake could be attenuated to conserve cellular energy as the bacterium senses that density dependent uptake of foreign DNA is no longer necessary. 3.4. CSLM of GFP expression of strain SMCOM4 in biofilms Biofilms of strain SMCOM4 grown on a polystyrene surface were observed under CSLM in situ after 4-h incubation in fresh medium. Control strain SMCOM3 revealed no GFP expression (data not shown). Upregulation of pcomX was evidenced by the sporadic expression of GFP visible in small subsets of the population (Fig. 3). Superimposition of the images from CSLM (Fig. 3(b)) over those from differential interference contrast (DIC) microscopy (Fig. 3(a)) revealed variations in fluorescence intensity among cell clusters (Fig. 3(c)). The overall patterns of GFP expression suggested a random distribution of ComX upregulation with peak expression within scattered microclusters of cells.
172
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Fig. 3. CSLM analysis of strain SMCOM4 containing a comX:: gfp reporter plasmid and grown as a 4 h biofilm. A DIC image of a single field of view (a); the same field of view by CSLM fluorescence detection (b); and overlay of DIC image from panel a on CSLM image in panel b (c). Panel c reveals GFP fluorescence in microclusters of high cell density in the biofilm population.
4. Discussion ComX is an alternative sigma factor that activates late competence genes which drive processing and integration of foreign DNA to the streptococcal chromosome. It is upregulated in response to CSP-induced activation of the competence cascade. The working model for the CSP regulon in S. mutans suggests that when CSP reaches a critical density outside the cell, adjacent cells will detect CSP through a sensor kinaseresponse regulator involving ComD and ComE, respectively. In its active form, phosphorylated ComE is then believed to induce expression of comX [15,13]. The use of a transcriptional fusion of pcomX to a lacZ gene allowed us to confirm the response of comX promoter driven transcription to the presence of active CSP in S. mutans and to correlate this with the competent state in biofilms. We observed an initial peak of pcomX transcription at the 5- and 10-min time points following exogenous CSP addition followed by attenuation after 15 min. It has been previously shown that in S. pneumoniae naive cells exposed to exogenous CSP there was a peak in pcomX mRNA levels after 5 min that continued to the 12-min time point, after which there was a steady reduction to near baseline levels after 15 min [14,19]. Luo and Morrison [30] also demonstrated through Western blot assay using anti-ComX antibody that the ComX protein in S. pneumoniae is maximally present at about 10–20 min after CSP addition. The steady reduction in pcomX transcriptional activity after 10 min in S. mutans UA159 planktonic cultures suggests that maximal transcriptional activity within a short time window of under 10 min appears to be present in both species after competence induction by exogenous CSP. The brief period of pcomX transcriptional activity may reflect a conservation of cellular activity so that the minimal requirements for acti-
vation of the competence genes are maintained. However, the extended competence window present in biofilms indicates that CSP may mediate many more processes in a biofilm, acting as a biofilm ‘‘switch’’ instead of merely a 10-min event observed during growth in liquid media (planktonic phase). Approximately 0.03% (3/1000) of biofilm cells were shown to be competent using the natural transformation assay. Using CSLM, a similar low percentage of cells exhibited GFP fluorescence. Significantly, only a small percentage of cells appear to be competent at any given time and take up DNA even under the CSP saturating conditions used. These data suggest that the time of peak transformation frequency observed in tandem with maximal competence induction likely represent parallel events in the competence regulatory cycle and that they occur in a scattered population of biofilm cells. Nevertheless, after a 4-h incubation in fresh medium, the biofilm cells would have produced sufficient amounts of CSP to upregulate pcomX transcription. Upregulation of competence genes may be localized to discrete microniches within the biofilm where signal transduction mechanisms related to quorum sensing are most active. These subpopulations may represent foci of optimal cell density, metabolic state, growth rate, substrate availability and end product accumulation. The general trend of a gradual increase in comX transcription in the biofilm reflects the stable nature of bacterial communities living as a biofilm. It is possible that an eventual build-up of cell density and its effect on subsequent CSP production and localized pcomX activation occurs in a more concerted pattern. The longer time during which pcomX expression in biofilms approaches maximal activity when compared with cells in planktonic culture possibly reflects the longer time it takes to achieve the stabilized critical density necessary for competence development in the biofilm.
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
Nevertheless, after a 4-h incubation in fresh medium, biofilm cells in the population should likely have produced sufficient amounts of CSP to upregulate comX transcription. S. mutans in vitro biofilms, once well established and stable, are also a highly transformable system with a hyperactive competence induction system, acquiring DNA readily from the local environment [13]. Accumulation of extracellular substrates or macromolecules possibly mitigates immediate dispersion of signal peptides, such as CSP, to neighboring cells, leading to slower competence induction among cells in the biofilm. Future studies of comX expression in S. mutans biofilms will address the response of the competent biofilm as a whole to controlled environmental and metabolic changes such as pH and temperature, which can influence biofilm behavior and transformation efficiency.
Acknowledgements Our work was supported by a Grant from the National Institute of Dental and Craniofacial Research R01DE013230–03, Grant MT-15431 from The Canadian Institutes of Health Research. D.G. Cvitkovitch is supported by a Canada Research Chair. R.P. Ellen is a member of the CIHR group in Matrix Dynamics.
References [1] Claverys, J.P. and Martin, B. (1998) Competence regulons, genomics and streptococci. Mol. Microbiol. 29, 1126–1127. [2] Cvitkovitch, D.G. (2001) Genetic competence and transformation in oral streptococci. Crit. Rev. Oral. Biol. Med. 12 (3), 217–243. [3] Lorenz, M.G. and Wackernagel, W. (1994) Bacterial gene transfer by natural genetic transformation in the environment. Microbiol. Rev. 58, 563–602. [4] Havarstein, L.S. and Morrison, D.A. (1999) Quorum sensing and peptide pheromones in streptococcal competence for genetic transformation In: Cell–cell Signaling in Bacteria (Dunny, G.M. and Winans, S.C., Eds.), pp. 9–192. ASM Press, Washington, DC. [5] Lunsford, R.D. and London, J. (1996) Natural genetic transformation in Streptococcus gordonii comX imparts spontaneous on strain wicky. J. Bacteriol. 178, 5831–5835. [6] Pestova, E.V., Havarstein, L.S. and Morrison, D.A. (1996) Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol. Microbiol. 21, 853–862. [7] Dunny, G.M. and Leonard, B.A. (1997) Cell–cell communication in Gram-positive bacteria. Ann. Rev. Microbiol. 51, 527–564. [8] Kleerebezem, M., Quadri, L.E., Kuipers, O.P. and de Vos, W.M. (1997) Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Mol. Microbiol. 24, 895–904. [9] Loesche, W.J. (1986) Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50, 353–380.
173
[10] Costerton, J.W., Stewart, P.S. and Greenberg, E.P. (1999) Bacterial biofilms: a common cause of persistent infections. Science 248, 1318–1322. [11] Morrison, D.A. and Lee, M.S. (2000) Regulation of competence for genetic transformation in Streptococcus pneumoniae: a link between quorum sensing and DNA processing genes. Res. Microbiol. 151, 445–451. [12] Petersen, F.C. and Scheie, A.A. (2000) Genetic transformation in Streptococcus mutans requires a peptide secretion-like apparatus. Oral. Microbiol. Immunol. 15 (5), 329–334. [13] Li, Y.H., Lau, P.C., Lee, J.H., Ellen, R.P. and Cvitkovitch, D.G. (2001) Natural genetic transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183, 897–908. [14] Lee, M.S. and Morrison, D.A. (1999) Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation. J. Bacteriol. 181, 5004– 5016. [15] Li, Y.H., Tang, N., Aspiras, M.B., Lau, P.C.Y., Lee, J.H., Ellen, R.P. and Cvitkovitch, D.G. (2002) A quorum-sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation. J. Bacteriol. 184, 2699–2708. [16] Campbell, E.A., Choi, S.Y. and Masure, H.R. (1998) A competence regulon in Streptococcus pneumoniae revealed by genomic analysis. Mol. Microbiol. 27, 929–939. [17] Martin, B., Garcia, P., Castanie, M.P. and Claverys, J.P. (1995) The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls lysogenic induction. Mol. Microbiol. 15, 367–379. [18] Pestova, E.V. and Morrison, D.A. (1998) Isolation and characterization of three Streptococcus pneumoniae transformationspecific loci by use of a lacZ reporter insertion vector. J. Bacteriol. 180, 2701–2710. [19] Peterson, S., Cline, R.T., Tettelin, H., Sharov, V. and Morrison, D.A. (2000) Gene expression analysis of the Streptococcus pneumoniae competence regulons by use of DNA microarrays. J. Bacteriol. 182, 6192–6202. [20] Peterson, S.N., Sung, C.K., Cline, R., Desai, B.V., Snesrud, E.C., Luo, P., Walling, J., Li, H., Mintz, M., Tsegaye, G., Burr, P.C., Do, Y., Ahn, S., Gilbert, J., Fleischmann, R.D. and Morrison, D.A. (2004) Identification of competence pheromone responsive genes in Streptococcus pneumoniae by use of DNA microarrays. Mol. Microbiol. 51 (4), 1051– 1070. [21] Yoshida, A. and Kuramitsu, H.K. (2002) Streptococcus mutans biofilm formation:utilization of a gtfB promoter-green fluorescent protein (PgtfB::gfp) construct to monitor development. Microbiol. 148, 3385–3394. [22] Cvitkovitch, D.G., Gutierrez, J.A., Behari, J., Youngman, P.J., Wetz, J.E., Crowley, P.J., Hillman, J.D., Brady, J.L. and Bleiweis, A.S. (2000) Tn917-lac mutagenesis of Streptococcus mutans to identify environmentally regulated genes. FEMS Microbiol. Lett. 182 (1), 149–154. [23] Honeyman, A.L., Cote, C.K. and Curtiss III, R. (2002) Construction of transcriptional and translational lacZ gene reporter plasmids for use in Streptococcus mutans. J. Microbiol. Meth. 49, 163–171. [24] Sato, Y., Yamamoto, Y., Suzuki, R., Kizaki, H. and Kuramitsu, H.K. (1991) Construction of scrA::lacZ gene fusions to investigate regulation of the sucrose PTS of Streptococcus mutans. FEMS Microbiol. Lett. 63 (2-3), 339–345. [25] Chalfie, M., Tu, Y., Euskirchen, E., Ward, W.W. and Prasher, D.C. (1994) Green fluorescent protein as a marker for gene expression. Science 263, 802–805. [26] Cubitt, A.G., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A. and Tsien, R.Y. (1995) Understanding, improving and
174
M.B. Aspiras et al. / FEMS Microbiology Letters 238 (2004) 167–174
using green fluorescent proteins. Trends Biochem. Sci. 20, 448–455. [27] Macrina, F.L., Evans, R.P., Tobian, J.A., Hartley, D.L., Clewell, D.B. and Jones, K.R. (1983) Novel shuttle plasmid vehicles for Escherichia–Streptococcus transgeneric cloning. Gene 25, 145–150. [28] Aspiras, M.B., Kazmerzak, K.K., Kolenbrander, P.E., McNab, R., Hardegen, N. and Jenkinson, H.F. (2000) Expression of green fluorescent protein in Streptococcus gordonii DL1 and its use as a species-specific marker in coadhesion with Streptococ-
cus oralis 34 in saliva-conditioned biofilms in vitro. Appl. Environ. Microbiol. 66, 4074–4083. [29] Miller, W.G., Leveau, J.H.J. and Lindow, S.E. (2000) Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol. Plant Microb. Interact. 13 (11), 1243–1250. [30] Luo, P. and Morrison, D.A. (2003) Transient association of an alternative sigma factor, comX, with RNA polymerase during the period of competence for genetic transformation in Streptococcus pneumoniae. J. Bacteriol. 185, 349–358.