- Email: [email protected]
The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms
ARTICLE IN PRESS International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
Contents lists available at ScienceDirect
International Journal of Antimicrobial Agents j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / i j a n t i m i c a g
The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms Martin Nilsson a, Morten Rybtke a, Michael Givskov a,b, Niels Høiby a,c, Svante Twetman d, Tim Tolker-Nielsen a,* a Costerton Biofilm Centre, Department of Immunology and Microbiology, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3B, Copenhagen DK-2200, Denmark b Singapore Centre on Environmental Life Sciences Engineering, Nanyang Technological University, Singapore c Department of Clinical Microbiology, University Hospital, Rigshospitalet, Copenhagen, Denmark d Department of Odontology, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark
A R T I C L E
I N F O
Article history: Received 12 February 2016 Accepted 5 June 2016 Keywords: Streptococcus mutans Biofilm Antimicrobial tolerance Gentamicin
A B S T R A C T
Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower than that of the wild-type. The minimum bactericidal concentration for planktonic cells (MBC-P) was only slightly reduced, indicating that the mechanism involved in the observed antimicrobial tolerance has a predominant role specifically in biofilms. Experiments with a knockout dltA mutant and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely is an important factor in the reduced tolerance of the dltA mutant biofilms towards the positively charged gentamicin. © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
1. Introduction Streptococcus mutans is a member of the complex microbiota of the oral cavity. Besides its ability to promote dental caries, it can also cause extra-oral infections such as infective endocarditis. Regardless of the kind of disease, formation of biofilm is an essential part of S. mutans pathogenicity [1]. Several features contribute to make S. mutans potent in outnumbering other bacteria in the dental plaque [1,2]. S. mutans uses sucrose to build glucan polymers that promote biofilm formation through adhesion to surfaces and other bacteria [3]. In addition, S. mutans is both aciduric and acidogenic and can produce antimicrobial compounds, such as mutacin, that display a spectrum of toxic activities on different bacteria [4].
* Corresponding author. Costerton Biofilm Centre, Department of Immunology and Microbiology, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3B, Copenhagen DK-2200, Denmark. E-mail address: [email protected] (T. Tolker-Nielsen).
Infective endocarditis is a typical biofilm-related disease frequently caused by viridans streptococci [5]. S. mutans can reach the blood circulation through lesions in the mouth [6]. Normally these minor bacteraemias are cleared rapidly by the immune defence. However, S. mutans possesses a set of virulence factors that can promote the establishment of a biofilm, e.g. at damaged heart valves. These virulence factors include the production of surface-associated adhesins that mediate binding to host protein, such as fibrinogen, laminin, collagen and fibronectin, and mediate adherence to damaged heart valves [7,8]. Development of biofilms can have major negative effects on the chance of curing a patient of an infection [9]. It is well established that biofilms are generally more tolerant to antibiotics than planktonic cells [10]. Many different mechanisms may be involved in the antibiotic tolerance of biofilms, e.g. restricted antibiotic penetration, the presence of bacteria in various physiological states, and expression of specific genes that promote antimicrobial tolerance. However, more knowledge about the factors involved in biofilmassociated tolerance to antibiotics is needed as a basis for the development of novel treatment scenarios.
http://dx.doi.org/10.1016/j.ijantimicag.2016.06.019 0924-8579/© 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
2
The aminoglycoside gentamicin is recommended in combination with penicillin to treat endocarditis caused by viridans streptococci [11], but this treatment may fail in cases where the bacteria have succeeded in forming a biofilm. In the present study, a S. mutans transposon mutant library was screened to identify genes that are important for biofilm-associated tolerance against gentamicin. The mutant screening indicated that the dltA gene plays a role in the tolerance of S. mutans biofilms towards gentamicin. Products of the dlt genes are known to mediate alanylation of teichoic acids, thus increasing their positive charge, which likely plays a role in the tolerance of S. mutans biofilms towards the positively charged gentamicin. 2. Materials and methods 2.1. Bacterial strains and growth conditions The bacterial strains used in this study are listed in Table 1. The S. mutans UA159 wild-type and mutants were grown aerobically in tryptone soya broth (TSB) (Oxoid Ltd., Basingstoke, UK) or Todd– Hewitt broth (THB) (BD, Becton Dickinson & Co., Le Pont de Claix, France) at 37 °C. Tryptone soya agar (TSA) (Oxoid Ltd.) was used for solid media, and the inoculated plates were incubated anaerobically (10% H2, 10% CO2 and 80% N2) or aerobically in the presence of 5% CO2. Escherichia coli was grown in Luria–Bertani medium (Oxoid Ltd.) at 37 °C. Antibiotics were used in the bacterial cultures at the following concentrations: for S. mutans strains, erythromycin (SigmaAldrich Chemie GmbH, Steinheim, Germany) at 10 μg/mL and spectinomycin (Sigma-Aldrich Chemie GmbH) at 1 mg/mL; and for E. coli, kanamycin (AppliChem GmbH, Darmstadt, Germany; or Life Technologies, Paisley, UK) at 50 μg/mL.
0.2 and then competence-stimulating peptide with the amino acid sequence NH2-SGSLSTFFRLFNRSFTQALGK-COOH (purity >95%) (TAG Copenhagen A/S, Copenhagen, Denmark) was added to a final concentration of 500 μg/mL together with DNA. The cell suspensions were subsequently incubated for 90 min, were concentrated by centrifugation and were spread on TSA plates containing erythromycin or spectinomycin to select for transformed bacteria. 2.3. Screening of a S. mutans transposon library for mutants impaired in biofilm-associated gentamicin tolerance Mutant screenings were done as published by Mah et al [17] with modifications. Colony spots were plated directly from transposon library microtitre plate glycerol stocks onto TSA plates (14 cm diameter Petri dishes) using a replicator with 3-mm pins. The plates were subsequently incubated anaerobically at 37 °C. Ninety-six well microtitre plates (TPP Techno Plastic Products AG, Trasadingen, Switzerland) containing 100 μL of THB supplemented with 1% sucrose (THBS) were inoculated from the plates with colony spots using a 96-pin replicator and were subsequently incubated at 37 °C. After 24 h of incubation, the medium was replaced with THBS containing 37.5 μg/mL gentamicin [eight times lower than the minimum bactericidal concentration for biofilms (MBC-B) of the wild-type]. Biofilms present on the walls of the wells were exposed to gentamicin for 24 h and were subsequently incubated with THB without any antibiotics (recovery medium) for an additional 24 h. To quantify bacterial viability, the 96-pin replicator was used to plate the cultures on TSA plates, which were subsequently incubated anaerobically at 37 °C. 2.4. Determination of minimum bactericidal concentrations for biofilms (MBC-B) and for planktonic cells (MBC-P)
2.2. Transformation of S. mutans Transformation was done as previously described [16] with modifications. A S. mutans overnight culture grown anaerobically in THB was diluted 20-fold in THB containing 5% heat-inactivated horse serum (PAA Laboratories GmbH, Linz, Austria). Cultures were incubated at 37 °C to reach an optical density at 600 nm (OD600) of
MBC-B values were determined using overnight cultures that were diluted to an OD600 of 0.02 in THBS. Microtitre tray cultures were grown aerobically in the presence of 5% CO2. Biofilms on the walls of the wells were exposed to two-fold serial dilutions of gentamicin in THB for 24 h of incubation at 37 °C. Subsequently, the medium was discarded and recovery medium was added to the
Table 1 Bacterial strains, plasmids and primers used in this study. Strain or plasmid Streptococcus mutans S. mutans UA159 S. mutans UA159 dltA-Tn S. mutans UA159 dltA S. mutans UA159 dltA/pDL277 S. mutans UA159 dltA/pDL277-dltA Escherichia coli E. coli HB101 Plasmids pDL277 Oligonucleotide primers erm5.2 erm5.3 erm3.3 erm3.2 arb1 arb3 erm-PA erm-PB dltA-P1 dltA-P2 dltA-P3 dltA-P4 dltAcompF dltAcompR
Relevant characteristics
Source
ATCC 700610 dltA transposon mutant Defined dltA knockout mutant Vector control strain Complemented dltA knockout mutant
[12] This study This study This study This study
recA thi pro leu hsdRM, Smr; strain used for maintenance and proliferation of plasmids
[13]
SpecR; plasmid used for complementation
[14,15]
AGATAATGCACTATCAACACACTC TCTACATTACGCATTTGGAATAC TACTTATGAGCAAGTATTGTCTA ATTCTATGAGTCGCTTTTGTA GGCCACGCGTCGACTAGTCANNNNNNNNNNGATAT GGCCACGCGTCGACTAGTCA GGCGCGCCCCGGGCCCAAAATTTGTTTGAT GGCCGGCCAGTCGGCAGCGACTCATAGAAT GATCGTGTGCGCAATGCTAA GGCGCGCCACCGGAAATTCTGCCTGTTCT GGCCGGCCCCTGCCTTCTAAGTTTTTGTACCGT GCAACACTTGATGTAACATTGCG TATAGGATCCAGCATATTTTTGATATAATGGACTTTGTT TATAGGATCCGCCAAATGATATAGAAAAACAAGGCA
ATCC, American Type Culture Collection.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
wells. After an additional 24 h of incubation in recovery medium, the cultures were plated and were grown aerobically at 37 °C in the presence of 5% CO2. The MBC-P value was determined using overnight cultures that were diluted to an OD600 of 0.02 in THB in microtitre trays. Antibiotics at two times serial dilutions were added to the bacteria in the microtitre trays and they were then incubated for 24 h, followed by plating as described above.
2.5. Identification of interrupted genes by arbitrary primed PCR The location of the mariner transposon insertions was determined through the use of the arbitrary primed PCR protocol described previously [18]. Approximately 100 ng of purified chromosomal DNA, obtained using a QIAGEN DNeasy® Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany), was used as template. In the first round of PCR, the arbitrary primer arb1 was paired with a primer that reads out from the erythromycin resistance gene, i.e. erm5.3 or erm3.3, in the mariner transposon. In the second PCR, a part of the product from the first PCR was PCR-amplified with the arb3 primer and a nested erm primer (either erm5.2 or erm3.2). Purified second-round products were used for DNA sequence analyses performed by Macrogen Europe (Amsterdam, The Netherlands) using one of the nested erm primers. Transposon insertion sites were identified with BLASTN searches against the annotated sequence of S. mutans UA159 using software provided by the National Center for Biotechnology Information (NCBI). The sequence of the primers used in the study are shown in Table 1.
2.6. Construction of a dltA deletion mutant An in-frame dltA deletion mutant was generated using PCR ligation mutagenesis as described previously [19]. This procedure has been shown to result in non-polar mutations [19]. Briefly, upstream and downstream fragments were PCR-amplified using purified S. mutans UA159 DNA as template and the primer pairs dltAP1/dltA-P2 and dltA-P3/dltA-P4, respectively. The upstream PCR products were digested with AscI (New England Biolabs Inc., Ipswich, MA) and the downstream PCR products were digested with FseI (New England Biolabs Inc.). The upstream and downstream fragments were separately ligated with an amplified AscI/FseI cleaved erm cassette, produced with primers erm-PA and erm-PB. The upstreamerm and downstream-erm ligations were subsequently mixed and overlap extension PCR with the dltA-P1 and dltA-P4 primers was performed. The resulting PCR fragments were purified and transformed into S. mutans UA159 and transformants were selected on TSA plates containing erythromycin. Mutant candidates were screened for the presence of the correct gene deletion by the use of PCR.
3
2.8. Isolation of lipoteichoic acid (LTA) and determination of and phosphorus content
D-alanine
LTA was extracted from biofilm-grown cells. Biofilms grown aerobically for 24 h in Petri dishes (14 cm in diameter) with 50 mL of THBS in the presence of 5% CO2 were washed in cold sodium acetate buffer (0.1 M, pH 4.7). Biofilms were scraped off the surface of the Petri dishes and were washed again with sodium acetate. Following centrifugation, the biofilm cells were re-suspended in the same buffer using sonication (10 min, 40 W) (Vibra-CellTM; Sonics & Materials Inc., Danbury, CT). LTA was extracted from the cells by the addition of an equal volume of 80% aqueous phenol and stirring at 65 °C for 1 h. Following centrifugation, the aqueous layer was collected and the procedure with phenol was repeated. The two collected fractions were pooled and were dialysed against 0.1 M sodium acetate buffer (pH 5.0) following lyophilisation. The d-alanine and phosphorus content was determined as described by Chan et al [15]. For d-alanine measurement, 2.7 U of amino acid oxidase (Sigma-Aldrich Chemie GmbH) was used instead of 8 U. Calibration curves were made with d-alanine and potassium phosphate monobasic from Sigma-Aldrich. 2.9. Cytochrome c-based charge determination of biofilm-grown cells To measure the charge of biofilm-grown cells, a modified protocol described by Buchanan et al [21] used for planktonic cells was used. Biofilms grown aerobically for 24 h on glass surfaces in THBS in the presence of 5% CO 2 were harvested in 3-(Nmorpholino)propanesulfonic acid (20 mM MOPS, pH 7.0). The cells were washed twice in MOPS prior to sonication (3 × 30 s, 4 W) and were re-suspended to an OD600 of 3.0. Cytochrome c was added to a final concentration of 0.5 mg/mL, the samples were incubated at 23 °C for 15 min and were then centrifuged. The amount of cytochrome c left in the supernatant was subsequently measuring the absorbance at 530 nm (A530). 2.10. Crystal violet (CV) assay A CV assay was performed essentially as described previously [22] to quantify the amount of CV bound by biofilms formed by S. mutans and derivatives. Briefly, 100 μL of THBS overnight cultures diluted to an OD600 of 0.02 was added to the wells of a 96-well microtitre plate, which was subsequently incubated aerobically at 37 °C for 24 h in the presence of 5% CO2. The wells were aspirated and the remaining planktonic bacteria were removed by addition and removal of 120 μL of H2O. The biofilms were stained for 15 min with 120 μL of 0.4% CV (Sigma-Aldrich). Quantification of the amount of CV bound by the biofilms was performed by washing the wells twice with 150 μL of H2O, followed by solubilising the CV with 30% acetic acid for 30 min and then measurement of the absorbance at 590 nm (A590).
2.7. Construction of a dltA-complemented strain To complement the dltA knockout mutant strain, a PCR fragment comprising the entire dltA open-reading frame and promoter sequence was generated using primers dltAcompF and dltAcompR. The fragments were digested with BamHI (Thermo Fisher Scientific Inc., Waltham, MA) and were ligated into the corresponding site of the shuttle vector pDL277 [20]. The sequence of the resulting plasmid termed, pDL277-dltA, was confirmed by sequencing and it was transformed into the dltA knockout mutant strain resulting in the S. mutans dltA/pDL277-dltA-complemented strain. In addition, the vector control strain S. mutans dltA/pDL277 was generated. Spectinomycin (1 mg/mL) was used to select for S. mutans strains harbouring pDL277 or pDL277-dltA.
2.11. Visualisation and COMSTAT image analyses of S. mutans biofilms grown on submerged cover glasses Ultraviolet-sterilised cover glasses were used as substratum for biofilms. Overnight cultures were diluted 50-fold in 20 mL of fresh THBS in Petri dishes each containing a cover glass. Following 24 h of incubation (aerobic with 5% CO2) at 37 °C, the biofilms formed on the cover glasses were washed with phosphate-buffered saline (PBS) and were stained with SYTO®9 (Life Technologies, Paisley, UK). Subsequently, the cover glasses were placed with the biofilm side down on microscope slides with silicon-made wells containing PBS. Visualisation of biofilms was done by confocal laser scanning microscopy (CLSM) using a Zeiss LSM 710 microscope (Carl Zeiss
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
4
Microscopy GmbH, Jena, Germany) with a 63× oil lens. Biofilms grown and stained as described above were quantified using CLSMcaptured images and COMSTAT software [23]. Image stacks consisted of images with 1-μm intervals in z-section from the substratum to the top of the biofilm. The biofilm parameters biomass and maximum thickness were determined. A fixed threshold value of 15 was used for all image stacks. Statistical analyses were used to compare the mean and standard deviation in all experiments.
confirm that dltA is responsible for the observed phenotype, the knockout strain was complemented. The biofilm-associated gentamicin tolerance of the complemented dltA knockout mutant was increased so that it was only two-fold lower than that of the wildtype (Table 2). The difference in the gentamicin tolerance values for the wild-type and complemented strain may be due to differences in the expression of the dlt genes. 3.2. Biofilm formation ability of the dltA mutant is similar to that of the wild-type
2.12. Statistical analysis Data were analysed using the t-test (two-sample, assuming equal variances), with P < 0.05 being considered significant, or by oneway analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. 3. Results 3.1. The dltA gene plays a role in the tolerance of S. mutans biofilms towards gentamicin The gentamicin MBC-B and MBC-P values for S. mutans UA159 were found to be 300 μg/mL and 1.5 μg/mL, respectively; thus, the wild-type biofilm has an MBC ca. 200 times higher than the planktonic cells. We have previously constructed a S. mutans mariner transposon mutant library containing ca. 5000 mutants [24]. To identify genes that have a role in the gentamicin tolerance of S. mutans biofilms, the mutant library was screened for mutants exhibiting reduced biofilm-associated gentamicin tolerance. Mutants that were found to exhibit lowered biofilm-associated gentamicin tolerance were re-screened and those mutants that repeatedly exhibited lowered gentamicin MBC-B values were selected for further analysis. Sequence analyses of the regions flanking the transposons in the selected mutants revealed that one of these had a transposon inserted in the dltA gene. The dltA gene is part of an operon together with dltB, dltC and dltD [25], and the gene products have been shown to mediate alanylation of LTA and cell wall teichoic acid [26]. The gentamicin MBC-B value for the dltA transposon mutant was at least eight-fold lower than that of the wild-type (Table 2). On the other hand, the MBC-P value for the dltA mutant was only ca. twofold lower than that of the wild-type. Thus, the mechanism involved in the observed antimicrobial tolerance has a predominant role in biofilm cells. S. mutans can form small aggregates in planktonic culture that may have biofilm-like properties, which may explain the slightly reduced MBC-P value for the dltA mutant. To confirm that disruption of the dltA gene by the transposon was responsible for the observed phenotype, a defined dltA knockout mutant was constructed and the gentamicin MBC-B and MBC-P values of the defined mutant were examined. The knockout mutant showed a similar reduction in biofilm-associated tolerance towards gentamicin as the transposon mutant, and the MBC-P values of the knockout and transposon mutant were similar (Table 2). To further
Subsequently, whether the lower MBC-B value of the dltA mutant could be due to diminished biofilm formation was investigated. Biofilms grown in the wells of microtitre trays are often quantified by the use of a CV assay. Biofilms formed by the S. mutans dltA mutants in microtitre trays, under conditions as in the MBC-B assays, bound more CV than the wild-type biofilm (Fig. 1). The dlt gene products have been shown to mediate alanylation of teichoic acids thereby increasing the positive charge of the cell surface [26]. The apparent high biomass value of the dltA mutant biofilms indicated by the CV assay could be due to increased binding of the cationic CV to the more negatively charged dltA mutant cells. Consequently, biofilms were also grown on submerged microscope glass slides and were quantified using SYTO ® 9 staining, CLSM and COMSTAT image analysis. The biofilms formed by the dltA mutant on the glass slides contained somewhat larger microcolonies than the corresponding wild-type biofilm (Fig. 2), but the overall amount of biomass and the height of the biofilms were similar to that found for the wild-type (Fig. 3). We find it unlikely that the slightly increased microcolony size in the dltA mutant biofilm should be the cause of the decreased gentamicin tolerance. The results thus indicate that reduced biofilm formation and altered biofilm structure are not the reasons for the decrease in biofilm-associated antimicrobial tolerance of the dltA mutant observed in the MBC-B assay. 3.3. Bacteria in dltA mutant biofilms are more negatively charged than bacteria in wild-type biofilms The results of the CV assay as well as the fact that the dlt gene products have been shown to mediate alanylation of teichoic acids [26] indicated that bacteria in dltA mutant biofilms are more negatively charged than bacteria in wild-type biofilms. We first
Table 2 Gentamicin minimum bactericidal concentration for biofilm cells (MBC-B) and for planktonic cells (MBC-P) for the Streptococcus mutans wild-type and derivatives. Fold change indicates the difference in MBC compared with the wild-type. Data are from a representative experiment performed with three replicates.
S. mutans UA159 S. mutans UA159 dltA-Tn S. mutans UA159 dltA S. mutans UA159 dltA/pDL277 S. mutans UA159 dltA/pDL277-dltA N/D, not determined.
MBC-B (μg/mL)
Fold change
MBC-P (μg/mL)
300 38 38 38 150
8× 8× 8× 2×
1.5 0.75 0.75 N/D N/D
Fold change 2× 2×
Fig. 1. Amount of crystal violet bound by biofilms formed in microtitre tray wells by the Streptococcus mutans UA159 wild-type (wt), the transposon mutant strain dltATn, and a defined knockout mutant strain dltA, determined by measuring the absorbance at 590 nm (A590). The mean ± standard deviation of six replicates is shown. *P < 0.05; n.s., not significant.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
5
Fig. 2. Biofilm formed by (A) Streptococcus mutans UA159 wild-type and (B) the dltA mutant on submerged glass surfaces. Biofilms were grown on submerged microscope cover glasses and were subsequently stained with SYTO®9 and imaged by confocal laser scanning microscopy. The images show three-dimensional projections with two flanking images representing vertical sections of the biofilms. Bars correspond to 20 μm.
confirmed that biofilm-grown S. mutans wild-type bacteria have higher levels of alanylated LTAs than biofilm-grown dltA mutant cells (Fig. 4A). Subsequently, an assay based on the positively charged cytochrome c was used to assess the charge of biofilm-grown S. mutans wild-type and dltA mutant cells. The dltA knockout mutant cells bound more cytochrome c than the wild-type cells (Fig. 4B), suggesting that bacteria in wild-type biofilms have a more positively charged envelope than the bacteria in dltA mutant biofilms, as expected.
Fig. 3. COMSTAT analysis of Streptococcus mutans wild-type (wt) and dltA mutant biofilms grown on submerged microscope cover glasses. The mean ± standard deviation of (A) biomass and (B) maximum thickness from three independent experiments (six image stacks per experiment) are shown. The data do not show any significant differences between the dltA mutant and the wild-type (P > 0.05).
Fig. 4. (A) d-alanine content of samples from Streptococcus mutans wild-type (wt) and the dltA mutant biofilms. Values indicate molar ratio of d-alanine to phosphorus. The mean ± standard deviation (S.D.) is based on duplicates. (B) Surface charge of bacteria in S. mutans wild-type (wt) and dltA mutant biofilms. Values indicate the fraction of unbound cytochrome c. A lower value correlates to more bound cytochrome c and a more negatively charged cell surface. The mean ± S.D. of three replicates is shown. *P < 0.05 compared with the wild-type.
4. Discussion We present evidence that the dltA gene in S. mutans UA159 plays a role in biofilm-associated tolerance towards the aminoglycoside gentamicin. Involvement of the dltA gene in biofilm-associated antimicrobial tolerance was found by screening of a S. mutans transposon mutant library for mutants lacking wild-type levels of biofilm-associated tolerance to gentamicin, and it was subsequently confirmed by construction and characterisation of defined knockout mutant and complemented strains. The dlt operon in S. mutans comprises dltA, dltB, dltC and dltD and shows homology to operons in various species, e.g. Lactobacillus rhamnosus and Bacillus subtilis [27]. The Dlt proteins have been shown to mediate incorporation of d-alanine into teichoic acids, which can either be linked to the cytoplasmic membrane (LTA) or anchored to the peptidoglycan (cell wall teichoic acid). d-alanylation of teichoic acids requires all four proteins encoded by the dlt operon [26]. dltA encodes a d-alanine:d-alanyl carrier protein ligase, dltC encodes a d-alanyl carrier protein, dltB encodes a transport protein, and dltD encodes a membrane protein that ensures the ligation of d-alanine to the d-alanyl carrier protein [26]. In S. mutans as well as in many other Gram-positive bacteria, it has been shown that deletions in the dlt operon lead to increased susceptibility to cationic antimicrobial peptides (CAMPs) [28–30]. Conversely, it is well established that resistance to CAMPs is commonly due to an increase of d-alanine residues in the teichoic acids [30]. The free amino group of d-alanine contributes to positive charges of the otherwise polyanionic cell wall. Thus, impaired incorporation of d-alanine into teichoic acid will lead to an increase in the net negative charge of the cell wall. The increased negative surface charge of dlt mutants has been proposed to result in accumulation of positively charged antimicrobial peptides with membrane-damaging activity on the cell surface, and thereby enhanced CAMP-mediated killing [30]. Gentamicin is a positively charged aminoglycoside at physiological conditions and therefore the mechanism described for CAMPs above may also explain a role of the dlt genes in biofilm-associated gentamicin tolerance. Although the target for gentamicin is intracellular, unlike the action of CAMPs towards the cell membrane, accumulation of gentamicin at the cell surface likely mediates higher transport of gentamicin into the cell and subsequently more efficient killing. Evidence has been provided that dlt expression in biofilm cells of S. mutans is two- to five-fold higher, depending on the strain investigated, than the level found in planktonic cells [31]. Accordingly, we found that the role of dltA in gentamicin tolerance was more pronounced when the bacteria were growing in biofilm mode compared with the planktonic mode.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
6
In many Gram-negative bacteria, resistance to antimicrobial peptides and polymyxins occurs through modification of cell wall lipopolysaccharide (LPS) [32]. Such alterations are often achieved by covalent cationic modifications of the lipid A moiety of LPS through the addition of 4-amino-4-deoxy-l-arabinose or phosphoethanolamine. Activation of the PhoP/PhoQ and PmrA/ PmrB two-component systems is triggered by environmental stimuli or specific mutations resulting in their constitutive activation, and subsequent overexpression of the pmrCAB and arnBCADTEF–pmrE genes results in cationic LPS modification and resistance to antimicrobial peptides and polymyxins [33–38]. In analogy with our findings, the pmr genes in Pseudomonas aeruginosa have been shown to be involved in biofilm-associated tolerance both to polymyxin and aminoglycosides [39,40]. CLSM and image analysis showed that dltA mutant and wildtype biofilms grown on glass slides had roughly the same amount of biofilm biomass. This is contrary to a previous report that a S. mutans UA159 dltC mutant grown in a glass-bottomed dish in sucrose-supplemented TSB produced approximately two-thirds the amount of biofilm than that of the wild-type [31]. We attempted to use LIVE/DEAD® staining to perform in situ investigations of the effect of gentamicin on the wild-type and dltA mutant biofilms. However, the correlation between the portion of dead cells seen on CLSM images after antibiotic challenge of the biofilms and CFUs obtained after plating of antibiotic-challenged disintegrated biofilm was poor (data not shown) and therefore we did not pursue these investigations further. In conclusion, we provide evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The dlt genes encode a system that mediates alanylation of teichoic acids, which increases their positive charge and may lead to less accumulation of positively charged gentamicin at the cell surface, and thereby decreased uptake of the antibiotic. These findings add to the knowledge about mechanisms underlying biofilm-associated antimicrobial tolerance in S. mutans, especially regarding gentamicin that is commonly used in combination with a β-lactam against viridans streptococci infections. Analogous to our findings, modification of LPS is involved in biofilm-associated tolerance to aminoglycosides in Gram-negative organisms. The results presented here, together with earlier findings, therefore suggest that modification of cell surface structures may be a common mechanism for biofilm-associated aminoglycoside tolerance. Knowledge about the molecular mechanism underlying biofilm-associated antimicrobial tolerance will form a basis for novel strategies for treatment of biofilm infections. Acknowledgements The authors are grateful to Natalia Christiansen and Jolanta Ludvigsen for technical assistance. The authors also thank Dr Dilani B. Senadheera for providing the erm cassette and plasmid pDL277. Funding: This work was supported by grants from Tandlægefonden, the Danish Council for Independent Research (DFF) [1323-00177] and the Lundbeck Foundation. Competing interests: None declared. Ethical approval: Not required. References [1] Krzysciak W, Jurczak A, Koscielniak D, Bystrowska B, Skalniak A. The virulence of Streptococcus mutans and the ability to form biofilms. Eur J Clin Microbiol Infect Dis 2014;33:499–515. [2] Takahashi N, Nyvad B. Caries ecology revisited: microbial dynamics and the caries process. Caries Res 2008;42:409–18. [3] Schilling KM, Bowen WH. Glucans synthesized in situ in experimental salivary pellicle function as specific binding sites for Streptococcus mutans. Infect Immun 1992;60:284–95.
[4] Kuramitsu HK, He X, Lux R, Anderson MH, Shi W. Interspecies interactions within oral microbial communities. Microbiol Mol Biol Rev 2007;71:653–70. [5] Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2004;2:95–108. [6] Parahitiyawa NB, Jin LJ, Leung WK, Yam WC, Samaranayake LP. Microbiology of odontogenic bacteremia: beyond endocarditis. Clin Microbiol Rev 2009;22: 46–64. [7] Bedran TBL, Azelmat J, Spolidorio DP, Grenier D. Fibrinogen-induced Streptococcus mutans biofilm formation and adherence to endothelial cells. Biomed Res Int 2013;2013:431465. [8] Nomura R, Naka S, Nemoto H, Inagaki S, Taniguchi K, Ooshima T, et al. Potential involvement of collagen-binding proteins of Streptococcus mutans in infective endocarditis. Oral Dis 2013;19:387–93. [9] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:1318–22. [10] Ceri H, Olson ME, Stremick C, Read RR, Morck D, Buret A. The Calgary Biofilm Device: new technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. J Clin Microbiol 1999;37:1771–6. [11] Verhagen DW, Vedder AC, Speelman P, van der Meer JT. Antimicrobial treatment of infective endocarditis caused by viridans streptococci highly susceptible to penicillin: historic overview and future considerations. J Antimicrob Chemother 2006;57:819–24. [12] Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J, Carson MB, et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci USA 2002;99:14434–9. [13] Kessler B, de Lorenzo V, Timmis KN. A general system to integrate lacZ fusions into the chromosomes of Gram-negative eubacteria: regulation of the Pm promoter of the TOL plasmid studied with all controlling elements in monocopy. Mol Gen Genet 1992;233:293–301. [14] Mair RW, Senadheera DB, Cvitkovitch DG. CinA is regulated via ComX to modulate genetic transformation and cell viability in Streptococcus mutans. FEMS Microbiol Lett 2012;331:44–52. [15] Chan KG, Mayer M, Davis EM, Halperin SA, Lin TJ, Lee SF. Role of d-alanylation of Streptococcus gordonii lipoteichoic acid in innate and adaptive immunity. Infect Immun 2007;75:3033–42. [16] Biswas I, Drake L, Johnson S, Thielen D. Unmarked gene modification in Streptococcus mutans by a cotransformation strategy with a thermosensitive plasmid. Biotechniques 2007;42:487–90. [17] Mah T-F, Pitts B, Pellock B, Walker GC, Stewart PS, O’Toole GA. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 2003;426:306– 10. [18] Li M, Rigby K, Lai Y, Nair V, Peschel A, Schittek B, et al. Staphylococcus aureus mutant screen reveals interaction of the human antimicrobial peptide dermcidin with membrane phospholipids. Antimicrob Agents Chemother 2009;53:4200– 10. [19] Lau PC, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG. PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods 2002;49:193–205. [20] LeBlanc DJ, Lee LN, Abu-Al-Jaibat A. Molecular, genetic, and functional analysis of the basic replicon of pVA380-1, a plasmid of oral streptococcal origin. Plasmid 1992;28:130–45. [21] Buchanan JT, Stannard JA, Lauth X, Ostland VE, Powell HC, Westerman ME, et al. Streptococcus iniae phosphoglucomutase is a virulence factor and a target for vaccine development. Infect Immun 2005;73:6935–44. [22] O’Toole GA, Kolter R. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 1998;30:295– 304. [23] Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersboll BK, et al. Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 2000;146:2395–407. [24] Nilsson M, Christiansen N, Høiby N, Twetman S, Givskov M, Tolker-Nielsen T. A mariner transposon vector adapted for mutagenesis in oral streptococci. Microbiologyopen 2014;3:333–40. [25] Boyd DA, Cvitkovitch DG, Bleiweis AS, Kiriukhin MY, Debabov DV, Neuhaus FC, et al. Defects in d-alanyl-lipoteichoic acid synthesis in Streptococcus mutans results in acid sensitivity. J Bacteriol 2000;182:6055–65. [26] Neuhaus FC, Baddiley J. A continuum of anionic charge: structures and functions of d-alanyl-teichoic acids in Gram-positive bacteria. Microbiol Mol Biol Rev 2003;67:686–723. [27] Spatafora GA, Sheets M, June R, Luyimbazi D, Howard K, Hulbert R, et al. Regulated expression of the Streptococcus mutans dlt genes correlates with intracellular polysaccharide accumulation. J Bacteriol 1999;181:2363–72. [28] Kristian SA, Datta V, Weidenmaier C, Kansal R, Fedtke I, Peschel A, et al. d-alanylation of teichoic acids promotes group A streptococcus antimicrobial peptide resistance, neutrophil survival, and epithelial cell invasion. J Bacteriol 2005;187:6719–25. [29] Peschel A, Otto M, Jack RW, Kalbacher H, Jung G, Gotz F. Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. J Biol Chem 1999;274:8405–10. [30] Peschel A. How do bacteria resist human antimicrobial peptides? Trends Microbiol 2002;10:179–86. [31] Mazda Y, Kawada-Matsuo M, Kanbara K, Oogai Y, Shibata Y, Yamashita Y, et al. Association of CiaRH with resistance of Streptococcus mutans to antimicrobial peptides in biofilms. Mol Oral Microbiol 2012;27:124–35. [32] Olaitan AO, Morand S, Rolain JM. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front Microbiol 2014;5:643.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
[33] Gunn JS, Miller SI. PhoP–PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance. J Bacteriol 1996;178:6857–64. [34] Gunn JS, Ryan SS, Van Velkinburgh JC, Ernst RK, Miller SI. Genetic and functional analysis of a PmrA–PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2000;68:6139–46. [35] Trent MS, Ribeiro AA, Lin SH, Cotter RJ, Raetz CRH. An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-l-arabinose to lipid A—induction in polymyxin-resistant mutants and role of a novel lipid-linked donor. J Biol Chem 2001;276:43122–31. [36] Abraham N, Kwon DH. A single amino acid substitution in PmrB is associated with polymyxin B resistance in clinical isolate of Pseudomonas aeruginosa. FEMS Microbiol Lett 2009;298:249–54.
7
[37] Barrow K, Kwon DH. Alterations in two-component regulatory systems of phoPQ and pmrAB are associated with polymyxin B resistance in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009;53:5150–4. [38] Miller AK, Brannon MK, Stevens L, Johansen HK, Selgrade SE, Miller SI, et al. PhoQ mutations promote lipid A modification and polymyxin resistance of Pseudomonas aeruginosa found in colistin-treated cystic fibrosis patients. Antimicrob Agents Chemother 2011;55:5761–9. [39] Pamp SJ, Gjermansen M, Johansen HK, Tolker-Nielsen T. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB–oprM genes. Mol Microbiol 2008;68:223–40. [40] Wilton M, Charron-Mazenod L, Moore R, Lewenza S. Extracellular DNA acidifies biofilms and induces aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2015;60:544–53.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
Contents lists available at ScienceDirect
International Journal of Antimicrobial Agents j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / i j a n t i m i c a g
The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms Martin Nilsson a, Morten Rybtke a, Michael Givskov a,b, Niels Høiby a,c, Svante Twetman d, Tim Tolker-Nielsen a,* a Costerton Biofilm Centre, Department of Immunology and Microbiology, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3B, Copenhagen DK-2200, Denmark b Singapore Centre on Environmental Life Sciences Engineering, Nanyang Technological University, Singapore c Department of Clinical Microbiology, University Hospital, Rigshospitalet, Copenhagen, Denmark d Department of Odontology, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark
A R T I C L E
I N F O
Article history: Received 12 February 2016 Accepted 5 June 2016 Keywords: Streptococcus mutans Biofilm Antimicrobial tolerance Gentamicin
A B S T R A C T
Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower than that of the wild-type. The minimum bactericidal concentration for planktonic cells (MBC-P) was only slightly reduced, indicating that the mechanism involved in the observed antimicrobial tolerance has a predominant role specifically in biofilms. Experiments with a knockout dltA mutant and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely is an important factor in the reduced tolerance of the dltA mutant biofilms towards the positively charged gentamicin. © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
1. Introduction Streptococcus mutans is a member of the complex microbiota of the oral cavity. Besides its ability to promote dental caries, it can also cause extra-oral infections such as infective endocarditis. Regardless of the kind of disease, formation of biofilm is an essential part of S. mutans pathogenicity [1]. Several features contribute to make S. mutans potent in outnumbering other bacteria in the dental plaque [1,2]. S. mutans uses sucrose to build glucan polymers that promote biofilm formation through adhesion to surfaces and other bacteria [3]. In addition, S. mutans is both aciduric and acidogenic and can produce antimicrobial compounds, such as mutacin, that display a spectrum of toxic activities on different bacteria [4].
* Corresponding author. Costerton Biofilm Centre, Department of Immunology and Microbiology, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3B, Copenhagen DK-2200, Denmark. E-mail address: [email protected] (T. Tolker-Nielsen).
Infective endocarditis is a typical biofilm-related disease frequently caused by viridans streptococci [5]. S. mutans can reach the blood circulation through lesions in the mouth [6]. Normally these minor bacteraemias are cleared rapidly by the immune defence. However, S. mutans possesses a set of virulence factors that can promote the establishment of a biofilm, e.g. at damaged heart valves. These virulence factors include the production of surface-associated adhesins that mediate binding to host protein, such as fibrinogen, laminin, collagen and fibronectin, and mediate adherence to damaged heart valves [7,8]. Development of biofilms can have major negative effects on the chance of curing a patient of an infection [9]. It is well established that biofilms are generally more tolerant to antibiotics than planktonic cells [10]. Many different mechanisms may be involved in the antibiotic tolerance of biofilms, e.g. restricted antibiotic penetration, the presence of bacteria in various physiological states, and expression of specific genes that promote antimicrobial tolerance. However, more knowledge about the factors involved in biofilmassociated tolerance to antibiotics is needed as a basis for the development of novel treatment scenarios.
http://dx.doi.org/10.1016/j.ijantimicag.2016.06.019 0924-8579/© 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
2
The aminoglycoside gentamicin is recommended in combination with penicillin to treat endocarditis caused by viridans streptococci [11], but this treatment may fail in cases where the bacteria have succeeded in forming a biofilm. In the present study, a S. mutans transposon mutant library was screened to identify genes that are important for biofilm-associated tolerance against gentamicin. The mutant screening indicated that the dltA gene plays a role in the tolerance of S. mutans biofilms towards gentamicin. Products of the dlt genes are known to mediate alanylation of teichoic acids, thus increasing their positive charge, which likely plays a role in the tolerance of S. mutans biofilms towards the positively charged gentamicin. 2. Materials and methods 2.1. Bacterial strains and growth conditions The bacterial strains used in this study are listed in Table 1. The S. mutans UA159 wild-type and mutants were grown aerobically in tryptone soya broth (TSB) (Oxoid Ltd., Basingstoke, UK) or Todd– Hewitt broth (THB) (BD, Becton Dickinson & Co., Le Pont de Claix, France) at 37 °C. Tryptone soya agar (TSA) (Oxoid Ltd.) was used for solid media, and the inoculated plates were incubated anaerobically (10% H2, 10% CO2 and 80% N2) or aerobically in the presence of 5% CO2. Escherichia coli was grown in Luria–Bertani medium (Oxoid Ltd.) at 37 °C. Antibiotics were used in the bacterial cultures at the following concentrations: for S. mutans strains, erythromycin (SigmaAldrich Chemie GmbH, Steinheim, Germany) at 10 μg/mL and spectinomycin (Sigma-Aldrich Chemie GmbH) at 1 mg/mL; and for E. coli, kanamycin (AppliChem GmbH, Darmstadt, Germany; or Life Technologies, Paisley, UK) at 50 μg/mL.
0.2 and then competence-stimulating peptide with the amino acid sequence NH2-SGSLSTFFRLFNRSFTQALGK-COOH (purity >95%) (TAG Copenhagen A/S, Copenhagen, Denmark) was added to a final concentration of 500 μg/mL together with DNA. The cell suspensions were subsequently incubated for 90 min, were concentrated by centrifugation and were spread on TSA plates containing erythromycin or spectinomycin to select for transformed bacteria. 2.3. Screening of a S. mutans transposon library for mutants impaired in biofilm-associated gentamicin tolerance Mutant screenings were done as published by Mah et al [17] with modifications. Colony spots were plated directly from transposon library microtitre plate glycerol stocks onto TSA plates (14 cm diameter Petri dishes) using a replicator with 3-mm pins. The plates were subsequently incubated anaerobically at 37 °C. Ninety-six well microtitre plates (TPP Techno Plastic Products AG, Trasadingen, Switzerland) containing 100 μL of THB supplemented with 1% sucrose (THBS) were inoculated from the plates with colony spots using a 96-pin replicator and were subsequently incubated at 37 °C. After 24 h of incubation, the medium was replaced with THBS containing 37.5 μg/mL gentamicin [eight times lower than the minimum bactericidal concentration for biofilms (MBC-B) of the wild-type]. Biofilms present on the walls of the wells were exposed to gentamicin for 24 h and were subsequently incubated with THB without any antibiotics (recovery medium) for an additional 24 h. To quantify bacterial viability, the 96-pin replicator was used to plate the cultures on TSA plates, which were subsequently incubated anaerobically at 37 °C. 2.4. Determination of minimum bactericidal concentrations for biofilms (MBC-B) and for planktonic cells (MBC-P)
2.2. Transformation of S. mutans Transformation was done as previously described [16] with modifications. A S. mutans overnight culture grown anaerobically in THB was diluted 20-fold in THB containing 5% heat-inactivated horse serum (PAA Laboratories GmbH, Linz, Austria). Cultures were incubated at 37 °C to reach an optical density at 600 nm (OD600) of
MBC-B values were determined using overnight cultures that were diluted to an OD600 of 0.02 in THBS. Microtitre tray cultures were grown aerobically in the presence of 5% CO2. Biofilms on the walls of the wells were exposed to two-fold serial dilutions of gentamicin in THB for 24 h of incubation at 37 °C. Subsequently, the medium was discarded and recovery medium was added to the
Table 1 Bacterial strains, plasmids and primers used in this study. Strain or plasmid Streptococcus mutans S. mutans UA159 S. mutans UA159 dltA-Tn S. mutans UA159 dltA S. mutans UA159 dltA/pDL277 S. mutans UA159 dltA/pDL277-dltA Escherichia coli E. coli HB101 Plasmids pDL277 Oligonucleotide primers erm5.2 erm5.3 erm3.3 erm3.2 arb1 arb3 erm-PA erm-PB dltA-P1 dltA-P2 dltA-P3 dltA-P4 dltAcompF dltAcompR
Relevant characteristics
Source
ATCC 700610 dltA transposon mutant Defined dltA knockout mutant Vector control strain Complemented dltA knockout mutant
[12] This study This study This study This study
recA thi pro leu hsdRM, Smr; strain used for maintenance and proliferation of plasmids
[13]
SpecR; plasmid used for complementation
[14,15]
AGATAATGCACTATCAACACACTC TCTACATTACGCATTTGGAATAC TACTTATGAGCAAGTATTGTCTA ATTCTATGAGTCGCTTTTGTA GGCCACGCGTCGACTAGTCANNNNNNNNNNGATAT GGCCACGCGTCGACTAGTCA GGCGCGCCCCGGGCCCAAAATTTGTTTGAT GGCCGGCCAGTCGGCAGCGACTCATAGAAT GATCGTGTGCGCAATGCTAA GGCGCGCCACCGGAAATTCTGCCTGTTCT GGCCGGCCCCTGCCTTCTAAGTTTTTGTACCGT GCAACACTTGATGTAACATTGCG TATAGGATCCAGCATATTTTTGATATAATGGACTTTGTT TATAGGATCCGCCAAATGATATAGAAAAACAAGGCA
ATCC, American Type Culture Collection.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
wells. After an additional 24 h of incubation in recovery medium, the cultures were plated and were grown aerobically at 37 °C in the presence of 5% CO2. The MBC-P value was determined using overnight cultures that were diluted to an OD600 of 0.02 in THB in microtitre trays. Antibiotics at two times serial dilutions were added to the bacteria in the microtitre trays and they were then incubated for 24 h, followed by plating as described above.
2.5. Identification of interrupted genes by arbitrary primed PCR The location of the mariner transposon insertions was determined through the use of the arbitrary primed PCR protocol described previously [18]. Approximately 100 ng of purified chromosomal DNA, obtained using a QIAGEN DNeasy® Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany), was used as template. In the first round of PCR, the arbitrary primer arb1 was paired with a primer that reads out from the erythromycin resistance gene, i.e. erm5.3 or erm3.3, in the mariner transposon. In the second PCR, a part of the product from the first PCR was PCR-amplified with the arb3 primer and a nested erm primer (either erm5.2 or erm3.2). Purified second-round products were used for DNA sequence analyses performed by Macrogen Europe (Amsterdam, The Netherlands) using one of the nested erm primers. Transposon insertion sites were identified with BLASTN searches against the annotated sequence of S. mutans UA159 using software provided by the National Center for Biotechnology Information (NCBI). The sequence of the primers used in the study are shown in Table 1.
2.6. Construction of a dltA deletion mutant An in-frame dltA deletion mutant was generated using PCR ligation mutagenesis as described previously [19]. This procedure has been shown to result in non-polar mutations [19]. Briefly, upstream and downstream fragments were PCR-amplified using purified S. mutans UA159 DNA as template and the primer pairs dltAP1/dltA-P2 and dltA-P3/dltA-P4, respectively. The upstream PCR products were digested with AscI (New England Biolabs Inc., Ipswich, MA) and the downstream PCR products were digested with FseI (New England Biolabs Inc.). The upstream and downstream fragments were separately ligated with an amplified AscI/FseI cleaved erm cassette, produced with primers erm-PA and erm-PB. The upstreamerm and downstream-erm ligations were subsequently mixed and overlap extension PCR with the dltA-P1 and dltA-P4 primers was performed. The resulting PCR fragments were purified and transformed into S. mutans UA159 and transformants were selected on TSA plates containing erythromycin. Mutant candidates were screened for the presence of the correct gene deletion by the use of PCR.
3
2.8. Isolation of lipoteichoic acid (LTA) and determination of and phosphorus content
D-alanine
LTA was extracted from biofilm-grown cells. Biofilms grown aerobically for 24 h in Petri dishes (14 cm in diameter) with 50 mL of THBS in the presence of 5% CO2 were washed in cold sodium acetate buffer (0.1 M, pH 4.7). Biofilms were scraped off the surface of the Petri dishes and were washed again with sodium acetate. Following centrifugation, the biofilm cells were re-suspended in the same buffer using sonication (10 min, 40 W) (Vibra-CellTM; Sonics & Materials Inc., Danbury, CT). LTA was extracted from the cells by the addition of an equal volume of 80% aqueous phenol and stirring at 65 °C for 1 h. Following centrifugation, the aqueous layer was collected and the procedure with phenol was repeated. The two collected fractions were pooled and were dialysed against 0.1 M sodium acetate buffer (pH 5.0) following lyophilisation. The d-alanine and phosphorus content was determined as described by Chan et al [15]. For d-alanine measurement, 2.7 U of amino acid oxidase (Sigma-Aldrich Chemie GmbH) was used instead of 8 U. Calibration curves were made with d-alanine and potassium phosphate monobasic from Sigma-Aldrich. 2.9. Cytochrome c-based charge determination of biofilm-grown cells To measure the charge of biofilm-grown cells, a modified protocol described by Buchanan et al [21] used for planktonic cells was used. Biofilms grown aerobically for 24 h on glass surfaces in THBS in the presence of 5% CO 2 were harvested in 3-(Nmorpholino)propanesulfonic acid (20 mM MOPS, pH 7.0). The cells were washed twice in MOPS prior to sonication (3 × 30 s, 4 W) and were re-suspended to an OD600 of 3.0. Cytochrome c was added to a final concentration of 0.5 mg/mL, the samples were incubated at 23 °C for 15 min and were then centrifuged. The amount of cytochrome c left in the supernatant was subsequently measuring the absorbance at 530 nm (A530). 2.10. Crystal violet (CV) assay A CV assay was performed essentially as described previously [22] to quantify the amount of CV bound by biofilms formed by S. mutans and derivatives. Briefly, 100 μL of THBS overnight cultures diluted to an OD600 of 0.02 was added to the wells of a 96-well microtitre plate, which was subsequently incubated aerobically at 37 °C for 24 h in the presence of 5% CO2. The wells were aspirated and the remaining planktonic bacteria were removed by addition and removal of 120 μL of H2O. The biofilms were stained for 15 min with 120 μL of 0.4% CV (Sigma-Aldrich). Quantification of the amount of CV bound by the biofilms was performed by washing the wells twice with 150 μL of H2O, followed by solubilising the CV with 30% acetic acid for 30 min and then measurement of the absorbance at 590 nm (A590).
2.7. Construction of a dltA-complemented strain To complement the dltA knockout mutant strain, a PCR fragment comprising the entire dltA open-reading frame and promoter sequence was generated using primers dltAcompF and dltAcompR. The fragments were digested with BamHI (Thermo Fisher Scientific Inc., Waltham, MA) and were ligated into the corresponding site of the shuttle vector pDL277 [20]. The sequence of the resulting plasmid termed, pDL277-dltA, was confirmed by sequencing and it was transformed into the dltA knockout mutant strain resulting in the S. mutans dltA/pDL277-dltA-complemented strain. In addition, the vector control strain S. mutans dltA/pDL277 was generated. Spectinomycin (1 mg/mL) was used to select for S. mutans strains harbouring pDL277 or pDL277-dltA.
2.11. Visualisation and COMSTAT image analyses of S. mutans biofilms grown on submerged cover glasses Ultraviolet-sterilised cover glasses were used as substratum for biofilms. Overnight cultures were diluted 50-fold in 20 mL of fresh THBS in Petri dishes each containing a cover glass. Following 24 h of incubation (aerobic with 5% CO2) at 37 °C, the biofilms formed on the cover glasses were washed with phosphate-buffered saline (PBS) and were stained with SYTO®9 (Life Technologies, Paisley, UK). Subsequently, the cover glasses were placed with the biofilm side down on microscope slides with silicon-made wells containing PBS. Visualisation of biofilms was done by confocal laser scanning microscopy (CLSM) using a Zeiss LSM 710 microscope (Carl Zeiss
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
4
Microscopy GmbH, Jena, Germany) with a 63× oil lens. Biofilms grown and stained as described above were quantified using CLSMcaptured images and COMSTAT software [23]. Image stacks consisted of images with 1-μm intervals in z-section from the substratum to the top of the biofilm. The biofilm parameters biomass and maximum thickness were determined. A fixed threshold value of 15 was used for all image stacks. Statistical analyses were used to compare the mean and standard deviation in all experiments.
confirm that dltA is responsible for the observed phenotype, the knockout strain was complemented. The biofilm-associated gentamicin tolerance of the complemented dltA knockout mutant was increased so that it was only two-fold lower than that of the wildtype (Table 2). The difference in the gentamicin tolerance values for the wild-type and complemented strain may be due to differences in the expression of the dlt genes. 3.2. Biofilm formation ability of the dltA mutant is similar to that of the wild-type
2.12. Statistical analysis Data were analysed using the t-test (two-sample, assuming equal variances), with P < 0.05 being considered significant, or by oneway analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. 3. Results 3.1. The dltA gene plays a role in the tolerance of S. mutans biofilms towards gentamicin The gentamicin MBC-B and MBC-P values for S. mutans UA159 were found to be 300 μg/mL and 1.5 μg/mL, respectively; thus, the wild-type biofilm has an MBC ca. 200 times higher than the planktonic cells. We have previously constructed a S. mutans mariner transposon mutant library containing ca. 5000 mutants [24]. To identify genes that have a role in the gentamicin tolerance of S. mutans biofilms, the mutant library was screened for mutants exhibiting reduced biofilm-associated gentamicin tolerance. Mutants that were found to exhibit lowered biofilm-associated gentamicin tolerance were re-screened and those mutants that repeatedly exhibited lowered gentamicin MBC-B values were selected for further analysis. Sequence analyses of the regions flanking the transposons in the selected mutants revealed that one of these had a transposon inserted in the dltA gene. The dltA gene is part of an operon together with dltB, dltC and dltD [25], and the gene products have been shown to mediate alanylation of LTA and cell wall teichoic acid [26]. The gentamicin MBC-B value for the dltA transposon mutant was at least eight-fold lower than that of the wild-type (Table 2). On the other hand, the MBC-P value for the dltA mutant was only ca. twofold lower than that of the wild-type. Thus, the mechanism involved in the observed antimicrobial tolerance has a predominant role in biofilm cells. S. mutans can form small aggregates in planktonic culture that may have biofilm-like properties, which may explain the slightly reduced MBC-P value for the dltA mutant. To confirm that disruption of the dltA gene by the transposon was responsible for the observed phenotype, a defined dltA knockout mutant was constructed and the gentamicin MBC-B and MBC-P values of the defined mutant were examined. The knockout mutant showed a similar reduction in biofilm-associated tolerance towards gentamicin as the transposon mutant, and the MBC-P values of the knockout and transposon mutant were similar (Table 2). To further
Subsequently, whether the lower MBC-B value of the dltA mutant could be due to diminished biofilm formation was investigated. Biofilms grown in the wells of microtitre trays are often quantified by the use of a CV assay. Biofilms formed by the S. mutans dltA mutants in microtitre trays, under conditions as in the MBC-B assays, bound more CV than the wild-type biofilm (Fig. 1). The dlt gene products have been shown to mediate alanylation of teichoic acids thereby increasing the positive charge of the cell surface [26]. The apparent high biomass value of the dltA mutant biofilms indicated by the CV assay could be due to increased binding of the cationic CV to the more negatively charged dltA mutant cells. Consequently, biofilms were also grown on submerged microscope glass slides and were quantified using SYTO ® 9 staining, CLSM and COMSTAT image analysis. The biofilms formed by the dltA mutant on the glass slides contained somewhat larger microcolonies than the corresponding wild-type biofilm (Fig. 2), but the overall amount of biomass and the height of the biofilms were similar to that found for the wild-type (Fig. 3). We find it unlikely that the slightly increased microcolony size in the dltA mutant biofilm should be the cause of the decreased gentamicin tolerance. The results thus indicate that reduced biofilm formation and altered biofilm structure are not the reasons for the decrease in biofilm-associated antimicrobial tolerance of the dltA mutant observed in the MBC-B assay. 3.3. Bacteria in dltA mutant biofilms are more negatively charged than bacteria in wild-type biofilms The results of the CV assay as well as the fact that the dlt gene products have been shown to mediate alanylation of teichoic acids [26] indicated that bacteria in dltA mutant biofilms are more negatively charged than bacteria in wild-type biofilms. We first
Table 2 Gentamicin minimum bactericidal concentration for biofilm cells (MBC-B) and for planktonic cells (MBC-P) for the Streptococcus mutans wild-type and derivatives. Fold change indicates the difference in MBC compared with the wild-type. Data are from a representative experiment performed with three replicates.
S. mutans UA159 S. mutans UA159 dltA-Tn S. mutans UA159 dltA S. mutans UA159 dltA/pDL277 S. mutans UA159 dltA/pDL277-dltA N/D, not determined.
MBC-B (μg/mL)
Fold change
MBC-P (μg/mL)
300 38 38 38 150
8× 8× 8× 2×
1.5 0.75 0.75 N/D N/D
Fold change 2× 2×
Fig. 1. Amount of crystal violet bound by biofilms formed in microtitre tray wells by the Streptococcus mutans UA159 wild-type (wt), the transposon mutant strain dltATn, and a defined knockout mutant strain dltA, determined by measuring the absorbance at 590 nm (A590). The mean ± standard deviation of six replicates is shown. *P < 0.05; n.s., not significant.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
5
Fig. 2. Biofilm formed by (A) Streptococcus mutans UA159 wild-type and (B) the dltA mutant on submerged glass surfaces. Biofilms were grown on submerged microscope cover glasses and were subsequently stained with SYTO®9 and imaged by confocal laser scanning microscopy. The images show three-dimensional projections with two flanking images representing vertical sections of the biofilms. Bars correspond to 20 μm.
confirmed that biofilm-grown S. mutans wild-type bacteria have higher levels of alanylated LTAs than biofilm-grown dltA mutant cells (Fig. 4A). Subsequently, an assay based on the positively charged cytochrome c was used to assess the charge of biofilm-grown S. mutans wild-type and dltA mutant cells. The dltA knockout mutant cells bound more cytochrome c than the wild-type cells (Fig. 4B), suggesting that bacteria in wild-type biofilms have a more positively charged envelope than the bacteria in dltA mutant biofilms, as expected.
Fig. 3. COMSTAT analysis of Streptococcus mutans wild-type (wt) and dltA mutant biofilms grown on submerged microscope cover glasses. The mean ± standard deviation of (A) biomass and (B) maximum thickness from three independent experiments (six image stacks per experiment) are shown. The data do not show any significant differences between the dltA mutant and the wild-type (P > 0.05).
Fig. 4. (A) d-alanine content of samples from Streptococcus mutans wild-type (wt) and the dltA mutant biofilms. Values indicate molar ratio of d-alanine to phosphorus. The mean ± standard deviation (S.D.) is based on duplicates. (B) Surface charge of bacteria in S. mutans wild-type (wt) and dltA mutant biofilms. Values indicate the fraction of unbound cytochrome c. A lower value correlates to more bound cytochrome c and a more negatively charged cell surface. The mean ± S.D. of three replicates is shown. *P < 0.05 compared with the wild-type.
4. Discussion We present evidence that the dltA gene in S. mutans UA159 plays a role in biofilm-associated tolerance towards the aminoglycoside gentamicin. Involvement of the dltA gene in biofilm-associated antimicrobial tolerance was found by screening of a S. mutans transposon mutant library for mutants lacking wild-type levels of biofilm-associated tolerance to gentamicin, and it was subsequently confirmed by construction and characterisation of defined knockout mutant and complemented strains. The dlt operon in S. mutans comprises dltA, dltB, dltC and dltD and shows homology to operons in various species, e.g. Lactobacillus rhamnosus and Bacillus subtilis [27]. The Dlt proteins have been shown to mediate incorporation of d-alanine into teichoic acids, which can either be linked to the cytoplasmic membrane (LTA) or anchored to the peptidoglycan (cell wall teichoic acid). d-alanylation of teichoic acids requires all four proteins encoded by the dlt operon [26]. dltA encodes a d-alanine:d-alanyl carrier protein ligase, dltC encodes a d-alanyl carrier protein, dltB encodes a transport protein, and dltD encodes a membrane protein that ensures the ligation of d-alanine to the d-alanyl carrier protein [26]. In S. mutans as well as in many other Gram-positive bacteria, it has been shown that deletions in the dlt operon lead to increased susceptibility to cationic antimicrobial peptides (CAMPs) [28–30]. Conversely, it is well established that resistance to CAMPs is commonly due to an increase of d-alanine residues in the teichoic acids [30]. The free amino group of d-alanine contributes to positive charges of the otherwise polyanionic cell wall. Thus, impaired incorporation of d-alanine into teichoic acid will lead to an increase in the net negative charge of the cell wall. The increased negative surface charge of dlt mutants has been proposed to result in accumulation of positively charged antimicrobial peptides with membrane-damaging activity on the cell surface, and thereby enhanced CAMP-mediated killing [30]. Gentamicin is a positively charged aminoglycoside at physiological conditions and therefore the mechanism described for CAMPs above may also explain a role of the dlt genes in biofilm-associated gentamicin tolerance. Although the target for gentamicin is intracellular, unlike the action of CAMPs towards the cell membrane, accumulation of gentamicin at the cell surface likely mediates higher transport of gentamicin into the cell and subsequently more efficient killing. Evidence has been provided that dlt expression in biofilm cells of S. mutans is two- to five-fold higher, depending on the strain investigated, than the level found in planktonic cells [31]. Accordingly, we found that the role of dltA in gentamicin tolerance was more pronounced when the bacteria were growing in biofilm mode compared with the planktonic mode.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
6
In many Gram-negative bacteria, resistance to antimicrobial peptides and polymyxins occurs through modification of cell wall lipopolysaccharide (LPS) [32]. Such alterations are often achieved by covalent cationic modifications of the lipid A moiety of LPS through the addition of 4-amino-4-deoxy-l-arabinose or phosphoethanolamine. Activation of the PhoP/PhoQ and PmrA/ PmrB two-component systems is triggered by environmental stimuli or specific mutations resulting in their constitutive activation, and subsequent overexpression of the pmrCAB and arnBCADTEF–pmrE genes results in cationic LPS modification and resistance to antimicrobial peptides and polymyxins [33–38]. In analogy with our findings, the pmr genes in Pseudomonas aeruginosa have been shown to be involved in biofilm-associated tolerance both to polymyxin and aminoglycosides [39,40]. CLSM and image analysis showed that dltA mutant and wildtype biofilms grown on glass slides had roughly the same amount of biofilm biomass. This is contrary to a previous report that a S. mutans UA159 dltC mutant grown in a glass-bottomed dish in sucrose-supplemented TSB produced approximately two-thirds the amount of biofilm than that of the wild-type [31]. We attempted to use LIVE/DEAD® staining to perform in situ investigations of the effect of gentamicin on the wild-type and dltA mutant biofilms. However, the correlation between the portion of dead cells seen on CLSM images after antibiotic challenge of the biofilms and CFUs obtained after plating of antibiotic-challenged disintegrated biofilm was poor (data not shown) and therefore we did not pursue these investigations further. In conclusion, we provide evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The dlt genes encode a system that mediates alanylation of teichoic acids, which increases their positive charge and may lead to less accumulation of positively charged gentamicin at the cell surface, and thereby decreased uptake of the antibiotic. These findings add to the knowledge about mechanisms underlying biofilm-associated antimicrobial tolerance in S. mutans, especially regarding gentamicin that is commonly used in combination with a β-lactam against viridans streptococci infections. Analogous to our findings, modification of LPS is involved in biofilm-associated tolerance to aminoglycosides in Gram-negative organisms. The results presented here, together with earlier findings, therefore suggest that modification of cell surface structures may be a common mechanism for biofilm-associated aminoglycoside tolerance. Knowledge about the molecular mechanism underlying biofilm-associated antimicrobial tolerance will form a basis for novel strategies for treatment of biofilm infections. Acknowledgements The authors are grateful to Natalia Christiansen and Jolanta Ludvigsen for technical assistance. The authors also thank Dr Dilani B. Senadheera for providing the erm cassette and plasmid pDL277. Funding: This work was supported by grants from Tandlægefonden, the Danish Council for Independent Research (DFF) [1323-00177] and the Lundbeck Foundation. Competing interests: None declared. Ethical approval: Not required. References [1] Krzysciak W, Jurczak A, Koscielniak D, Bystrowska B, Skalniak A. The virulence of Streptococcus mutans and the ability to form biofilms. Eur J Clin Microbiol Infect Dis 2014;33:499–515. [2] Takahashi N, Nyvad B. Caries ecology revisited: microbial dynamics and the caries process. Caries Res 2008;42:409–18. [3] Schilling KM, Bowen WH. Glucans synthesized in situ in experimental salivary pellicle function as specific binding sites for Streptococcus mutans. Infect Immun 1992;60:284–95.
[4] Kuramitsu HK, He X, Lux R, Anderson MH, Shi W. Interspecies interactions within oral microbial communities. Microbiol Mol Biol Rev 2007;71:653–70. [5] Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2004;2:95–108. [6] Parahitiyawa NB, Jin LJ, Leung WK, Yam WC, Samaranayake LP. Microbiology of odontogenic bacteremia: beyond endocarditis. Clin Microbiol Rev 2009;22: 46–64. [7] Bedran TBL, Azelmat J, Spolidorio DP, Grenier D. Fibrinogen-induced Streptococcus mutans biofilm formation and adherence to endothelial cells. Biomed Res Int 2013;2013:431465. [8] Nomura R, Naka S, Nemoto H, Inagaki S, Taniguchi K, Ooshima T, et al. Potential involvement of collagen-binding proteins of Streptococcus mutans in infective endocarditis. Oral Dis 2013;19:387–93. [9] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:1318–22. [10] Ceri H, Olson ME, Stremick C, Read RR, Morck D, Buret A. The Calgary Biofilm Device: new technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. J Clin Microbiol 1999;37:1771–6. [11] Verhagen DW, Vedder AC, Speelman P, van der Meer JT. Antimicrobial treatment of infective endocarditis caused by viridans streptococci highly susceptible to penicillin: historic overview and future considerations. J Antimicrob Chemother 2006;57:819–24. [12] Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J, Carson MB, et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci USA 2002;99:14434–9. [13] Kessler B, de Lorenzo V, Timmis KN. A general system to integrate lacZ fusions into the chromosomes of Gram-negative eubacteria: regulation of the Pm promoter of the TOL plasmid studied with all controlling elements in monocopy. Mol Gen Genet 1992;233:293–301. [14] Mair RW, Senadheera DB, Cvitkovitch DG. CinA is regulated via ComX to modulate genetic transformation and cell viability in Streptococcus mutans. FEMS Microbiol Lett 2012;331:44–52. [15] Chan KG, Mayer M, Davis EM, Halperin SA, Lin TJ, Lee SF. Role of d-alanylation of Streptococcus gordonii lipoteichoic acid in innate and adaptive immunity. Infect Immun 2007;75:3033–42. [16] Biswas I, Drake L, Johnson S, Thielen D. Unmarked gene modification in Streptococcus mutans by a cotransformation strategy with a thermosensitive plasmid. Biotechniques 2007;42:487–90. [17] Mah T-F, Pitts B, Pellock B, Walker GC, Stewart PS, O’Toole GA. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 2003;426:306– 10. [18] Li M, Rigby K, Lai Y, Nair V, Peschel A, Schittek B, et al. Staphylococcus aureus mutant screen reveals interaction of the human antimicrobial peptide dermcidin with membrane phospholipids. Antimicrob Agents Chemother 2009;53:4200– 10. [19] Lau PC, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG. PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods 2002;49:193–205. [20] LeBlanc DJ, Lee LN, Abu-Al-Jaibat A. Molecular, genetic, and functional analysis of the basic replicon of pVA380-1, a plasmid of oral streptococcal origin. Plasmid 1992;28:130–45. [21] Buchanan JT, Stannard JA, Lauth X, Ostland VE, Powell HC, Westerman ME, et al. Streptococcus iniae phosphoglucomutase is a virulence factor and a target for vaccine development. Infect Immun 2005;73:6935–44. [22] O’Toole GA, Kolter R. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 1998;30:295– 304. [23] Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersboll BK, et al. Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 2000;146:2395–407. [24] Nilsson M, Christiansen N, Høiby N, Twetman S, Givskov M, Tolker-Nielsen T. A mariner transposon vector adapted for mutagenesis in oral streptococci. Microbiologyopen 2014;3:333–40. [25] Boyd DA, Cvitkovitch DG, Bleiweis AS, Kiriukhin MY, Debabov DV, Neuhaus FC, et al. Defects in d-alanyl-lipoteichoic acid synthesis in Streptococcus mutans results in acid sensitivity. J Bacteriol 2000;182:6055–65. [26] Neuhaus FC, Baddiley J. A continuum of anionic charge: structures and functions of d-alanyl-teichoic acids in Gram-positive bacteria. Microbiol Mol Biol Rev 2003;67:686–723. [27] Spatafora GA, Sheets M, June R, Luyimbazi D, Howard K, Hulbert R, et al. Regulated expression of the Streptococcus mutans dlt genes correlates with intracellular polysaccharide accumulation. J Bacteriol 1999;181:2363–72. [28] Kristian SA, Datta V, Weidenmaier C, Kansal R, Fedtke I, Peschel A, et al. d-alanylation of teichoic acids promotes group A streptococcus antimicrobial peptide resistance, neutrophil survival, and epithelial cell invasion. J Bacteriol 2005;187:6719–25. [29] Peschel A, Otto M, Jack RW, Kalbacher H, Jung G, Gotz F. Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. J Biol Chem 1999;274:8405–10. [30] Peschel A. How do bacteria resist human antimicrobial peptides? Trends Microbiol 2002;10:179–86. [31] Mazda Y, Kawada-Matsuo M, Kanbara K, Oogai Y, Shibata Y, Yamashita Y, et al. Association of CiaRH with resistance of Streptococcus mutans to antimicrobial peptides in biofilms. Mol Oral Microbiol 2012;27:124–35. [32] Olaitan AO, Morand S, Rolain JM. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front Microbiol 2014;5:643.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019
ARTICLE IN PRESS M. Nilsson et al. / International Journal of Antimicrobial Agents ■■ (2016) ■■–■■
[33] Gunn JS, Miller SI. PhoP–PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance. J Bacteriol 1996;178:6857–64. [34] Gunn JS, Ryan SS, Van Velkinburgh JC, Ernst RK, Miller SI. Genetic and functional analysis of a PmrA–PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect Immun 2000;68:6139–46. [35] Trent MS, Ribeiro AA, Lin SH, Cotter RJ, Raetz CRH. An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-l-arabinose to lipid A—induction in polymyxin-resistant mutants and role of a novel lipid-linked donor. J Biol Chem 2001;276:43122–31. [36] Abraham N, Kwon DH. A single amino acid substitution in PmrB is associated with polymyxin B resistance in clinical isolate of Pseudomonas aeruginosa. FEMS Microbiol Lett 2009;298:249–54.
7
[37] Barrow K, Kwon DH. Alterations in two-component regulatory systems of phoPQ and pmrAB are associated with polymyxin B resistance in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009;53:5150–4. [38] Miller AK, Brannon MK, Stevens L, Johansen HK, Selgrade SE, Miller SI, et al. PhoQ mutations promote lipid A modification and polymyxin resistance of Pseudomonas aeruginosa found in colistin-treated cystic fibrosis patients. Antimicrob Agents Chemother 2011;55:5761–9. [39] Pamp SJ, Gjermansen M, Johansen HK, Tolker-Nielsen T. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB–oprM genes. Mol Microbiol 2008;68:223–40. [40] Wilton M, Charron-Mazenod L, Moore R, Lewenza S. Extracellular DNA acidifies biofilms and induces aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2015;60:544–53.
Please cite this article in press as: Martin Nilsson, Morten Rybtke, Michael Givskov, Niels Høiby, Svante Twetman, Tim Tolker-Nielsen, The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms, International Journal of Antimicrobial Agents (2016), doi: 10.1016/j.ijantimicag.2016.06.019