Constitutive intracellular expression of human leukocyte antigen (HLA)-DO and HLA-DR but not HLA-DM in trophoblast cells

Constitutive Intracellular Expression of Human Leukocyte Antigen (HLA)-DO and HLA-DR but not HLA-DM in Trophoblast Cells Anthi Ranella, Simon Vassiliadis, Chrisa Mastora, Michailidou Valentina, Eva Dionyssopoulou, and Irene Athanassakis ABSTRACT: The nonclassic human leukocyte antigen (HLA)-DM molecules have been proved to positively regulate antigen presentation in classic antigen-presenting cells, whereas in B lymphocytes HLA-DO have been identified as negative regulators of the process. The present report examines whether the negative expression of classic class II molecules in trophoblasts implies negative regulation by HLA-DO. It was revealed by immunofluorescence, confocal microscopy, and subcellular fractionation techniques that human trophoblasts, although not expressing any surface HLA-DR antigens, constitutively express intracellular HLA-DR, HLA-DO, and CD74, but not HLA-DM. Administration of interferon-␥ to the cell culture increased HLA-DR and CD74, induced HLA-DM, but did not alter the expression of HLA-DO and induced HLA-DR release from the cells. These results were confirmed by reverse transcriptase–polymerase chain ABBREVIATIONS ELISA enzyme-linked immunosorbent assay HLA human leukocyte antigen IFN-␥ interferon-␥

INTRODUCTION Studies on the antigen presentation process have revealed the maturation pathway of class II major histocompatibility complex (MHC) antigens starting from their assembly to the endoplasmic reticulum, their movement to

Department of Biology, Laboratory of Immunology (A.R., S.V., C.M., M.V., E.D., I.A.), and Faculty of Medicine, Division of Mother-Child (S.V., E.D.), University of Crete, Heraklion, Crete, Greece. Address reprint requests to: Dr. Irene Athanassakis, Department of Biology, University of Crete, P.O. Box 2208,714-09 Heraklion, Crete, Greece; Tel: ⫹30-2810394355; Fax: ⫹30-2810394379; E-mail: [email protected]. Received July 15, 2004; revised October 5, 2004; accepted October 7, 2004. Human Immunology 66, 43-55 (2005) © American Society for Histocompatibility and Immunogenetics, 2005 Published by Elsevier Inc.

reaction analysis except that HLA-DM mRNA was detected in control cells, indicating a posttranscriptional regulation. Under the same experimental conditions, human monocytes/macrophages were not expressing intracellular HLA-DO while exhibiting significant levels of HLA-DR, HLA-DM, and CD74. The results presented here reveal for the first time expression of HLA-DO in trophoblasts, which can be of great importance in maintaining the class II–negative state in these cells and consequently protecting the fetus from maternal immune attack. Human Immunology 66, 43-55 (2005). © American Society for Histocompatibility and Immunogenetics, 2005. Published by Elsevier Inc. KEYWORDS: HLA-DR; HLA-DO; HLA-DM; trophoblast cells; interferon-␥

MHC RT-PCR

major histocompatibility complex reverse transcriptase–polymerase chain reaction

endosomal compartments, loading of the antigenic peptide, and appearance to the cell membrane. This pathway involves the chaperones calnexin and BiP [1, 2], the invariant chain Ii, human leukocyte antigen (HLA)-DR, and nonclassic HLA-DM (H-2M) and HLA-DO (H-2O) proteins [1–7]. HLA-DM has been detected in all antigen-presenting cells, including macrophages, dendritic cells, B cells, and epithelial cells, and has been revealed to play an essential role in the antigen presentation process because, on binding to the ␣␤-class II-associated invariant chain peptide (CLIP) complex, it causes a conformational change, thus releasing CLIP and allowing binding of the antigen in the MHC class II compart0198-8859/05/$–see front matter doi:10.1016/j.humimm.2004.10.002

44

ments (MIIC) endocytic compartments (which are believed to be fusion products of endocytic vesicles containing the enzymatically processed antigen and secretion vesicles containing the ␣␤ heterodimer) and transport of the ␣␤/antigen complex to the cell membrane [8 –14]. Expression of HLA-DO has so far been restricted to B lymphocytes and some thymic epithelial and dendritic cells, where it is believed to actively participate in the self-/nonself-discrimination process during T-cell development [15–17]. Recently, HLA-DO (H-2O) has been proposed to play an inhibitory role in the antigen-presentation process in B cells, because it is thought to form a complex with HLA-DM, not allowing the peptide loading pathway to proceed [18 –20]. HLA-DO has not been well studied yet, possibly because of its poor tissue distribution. The proposed activity of HLA-DO finds direct application to the maternal-fetal interaction during pregnancy where trophoblast cells must avoid presentation of fetal antigens in order to protect the semiallogeneic embryo from rejection. Over the years, different mechanisms have been suggested to explain fetal protection from maternal immune attack, including the protective role of HLA-G [21, 22], the increased number of suppressor regulatory T cells, and the presence of suppressive factors [23–25]. The absence of surface class II molecules from trophoblasts has also been revealed to be part of the same protective mechanism [26 –28]. Methylation of class II gene or class II transactivator promoter IV, however, does not mediate such process because class II can be de novo induced by interferon-␥ (IFN-␥), a fact that is correlated to fetal abortion [27–29]. Furthermore, other studies have suggested that silencing of the class II transactivator (CIITA) transcription in trophoblasts involves an epigenetic mechanism rather than promoter type IV methylation [30]. The type III promoter of CIITA was found to be suppressed by human trophoblast noncoding RNA [31]. Recent studies from our laboratory gave a new insight in the regulation of class II in trophoblasts by revealing that in the murine system, although trophoblasts do not express surface class II molecules, they do contain intracellular pools that can be released from the cells on short-term treatment with IFN-␥ [32]. If this is also the case with human trophoblast cells, one should expect fine regulatory mechanisms to arrest class II molecules to intracellular compartments, allowing their movement solely to secretory vesicles and not to the cell membrane. The present report describes the profile of most of the components involved in the class II maturation pathway, including HLA-DO, and provides new insight as to their regulation by IFN-␥, their trafficking within the intracel-

A. Ranella et al.

lular compartments, and their involvement in the maintenance of the class II–negative state in trophoblasts. MATERIALS AND METHODS Reagents Human and mouse recombinant IFN-␥ were purchased from Endogen (Cambridge, MA) and used at concentrations of 1500 pg/ml. For the negative selection of human placental cells, a monoclonal antibody against CD14 (1 ␮g/ml; Immunotech S.A., Marseille, France) detected by an antimouse magnetic bead– coupled secondary antibody (Dynal) and an anti–HLA-DR, -DP, -DQ directly coupled to magnetic beads (Dynabeads HLA-II; Dynal Inc., Oslo, Norway), was used following the instructions of the manufacturer. The trophoblastic nature of the isolated cells was verified by the GB25 antibody (a gift from Dr. E. Menu, Institut Pasteur, Paris, France). Uncoupled mouse anti–HLA-DP, -DQ, -DR was purchased from Serotec (Kidlington, Oxford, UK) and used at the concentration of 1␮g/ml in immunofluorescence experiments. For double fluorescence experiments, a mouse anti–HLA-DR, -DP, -DQ coupled to FITC was used at the concentration of 1␮g/ml (BD Biosciences; San Diego, CA). Mouse anti–HLA-DM and HLA-DO were purchased from BD Biosciences and used at a concentration of 1 ␮g/ml. Monoclonal antibodies to CD74 were purchased from Serotec and used at a concentration of 1 ␮g/ml in the immunofluorescence experiments. Antirab7 monoclonal antibody (200 ␮g/ml) was purchased from Santa Cruz (Santa Cruz, CA) and used in enzymelinked immunosorbent assay (ELISA) experiments at a dilution of 1/1000. Antimouse immunoglobulin (Ig) G coupled to FITC or RITC (Sigma, St Louis, MO) was used as secondary antibody for the immunofluorescence experiments. Cell Lines The trophoblast cell line JAR was purchased from ATCC (HTB-144; Rockville, MD) and maintained in RPMI culture medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco). TROPHO-1 cells, naturally derived from day 13 BALB/c ⫻ BALB/c placentas, have been characterized as trophoblasts on the basis of morphogenic characteristics, invasiveness, cytokeratin-positive and vimentinnegative profile, and responsiveness to growth factors [33]. Isolation of Human Primary Cells Human trophoblast cells were obtained from aseptically isolated term placentas from five different donors during cesarian delivery at the Gynecology/Obstetrics

Expression of HLA-DO in Trophoblasts

Clinic, University of Crete Hospital, as previously described [34]. Human monocytes/macrophages were obtained after a 24-hour adherence of total leukocyte cell cultures isolated from 30 ml peripheral blood, run through a 60% Percoll’s gradient following standard procedures. Cell Cultures Primary human trophoblast cells, JAR cells, or monocytes/macrophages were cultured for 6 or 24 hours at the concentration of 1 ⫻ 106 cells/ml in 24-well plates (final volume 2 ml; Sarstedt; Numbrecht, Germany) in DMEM or RPMI culture medium supplemented with 10% fetal bovine serum, in the presence or not of IFN-␥. Upon culture termination, the cells were processed for immunofluorescence experiments to determine the intracellular levels of HLA-DR, HLA-DM, HLA-DO, and CD74. Culture supernatants were submitted to ELISA experiments to evaluate any soluble activity of HLA-DR. TROPHO-1 cells were cultured at the concentration of 200,000 cells/ml in DMEM medium supplemented with 10% fetal bovine serum (Gibco) in 70 mm2 flasks (Sarstedt) for mRNA isolation. Upon culture initiation, the cells were left to adhere for 24 hours; the culture medium was then replaced with fresh medium with or without IFN-␥ and incubated for 6 hours. Upon culture termination, the cells were processed for mRNA extraction. Cytoplasmic Indirect Immunofluorescence Staining and Indirect ELISA Cytoplasmic immunofluorescence experiments were performed as previously described [35]. Cells with weak or no staining were scored as negative. Positive cells were considered those with bright to very bright staining. The negative controls included mouse IgG (Sigma, 1 ␮g/ml) or control buffer (phosphate-buffered saline– bovine serum albumin). In some cases, cells were fixed with 25 ␮l/ml Mowiol (Sigma) and processed to confocal microscopy analysis. Culture supernatants from human or murine trophoblast cell cultures were used at the dilution of 1/2 in carbonate buffer pH 9.6 and submitted to ELISA experiments as previously described [35]. Each experiment was repeated at least four times. The results are expressed as a percentage of optical density value increase over background (⫾ SEM, calculated from four or more experiments). Subcellular Fractionation Subcellular fractionation was performed following the technique initially described by Qiu et al. [36] and slightly modified by Athanassakis et al. [32]. Seventy million untreated JAR cells or JAR cells treated with

45

IFN-␥ for 6 and 24 hours were collected, homogenized, and submitted to subcellular fractionation. The resulting fractions were tested by ELISA for detection of HLA-DR, -DM, -DO, CD74, and rab7 by means of an antimouse secondary antibody coupled to horseradish peroxidase. Following this experimental procedure, the lysosomal fractions are obtained at dense concentrations of the gradient and the endosomal fractions at light concentrations. The results are expressed as the mean of the percentage of optical density over background from triplicate samples (coating buffer was used as background control for all the different antibodies tested). The SEM varied in all cases from 3% to 6%. Reverse Transcriptase–Polymerase Chain Reaction Experiments Poly A⫹ RNA was extracted from 107 JAR or TROPHO-1 cells, incubated in the presence or absence of human or mouse IFN-␥, respectively (100 units/ml), with the Oligotex Direct mRNA kit (Qiagen, Crawley, West Sussex, UK). One microgram of mRNA was reverse-transcribed onto cDNA and amplified in a polymerase chain reaction (PCR) with the Qiagen OneStep reverse transcriptase (RT)-PCR kit according to the manufacturer’s recommended protocol with gene-specific primers at final concentration of 0.6 ␮M, 10 ␮M of each dNTP, 1⫻ Qiagen OneStep RT-PCR buffer (contains 12.5 mM MgCl2), 2 ␮l of Qiagen OneStep RT-PCR enzyme mix, in a final volume of 50 ␮l. Reverse transcriptase-PCR conditions consisted of the following: 30 minutes at 55°C (for DNA synthesis), followed by 15 minutes at 95°C (initial PCR activation step); 40 cycles of 94°C for 1 minute, 55°C for 1 minutes, and 72°C for 1 minute, and a final elongation period of 10 minutes at 72°C. Reverse transcriptase-PCR mixes without mRNA template were used as negative control. RT-PCR Primers For the amplification, we used specific primers for exon 2 of the HLA-DR␤, HLA-DM␤, HLA-DO␤, H-2Ad␣, H-2Md␣, and H-2Od␣ and the transmembrane region of the H-2Ad␣ gene. The primers used for amplification were as follows: HLA-DR␤: 5=-TGCGGTTCCTGGAGAGATAC-3= and 5=-AACCCCGTAGTTGTGTCTGC3=; HLA-DM␤: 5=-TGGAAAGCACCTGTCTGTTG-3= and 5=-TGGTTGAGGTGCTGTGAGAG-3=; HLADO␤: 5=-CCTGGGTGAGGTAAAGGACA-3= and 5=GGCAATGGGGATTAATGATG-3=; H-2Ad␣: 5=-ATTGAGGCCGACCACGTA-3= and 5=-GTTTCAGAACCGGCTCCTC-3=; H-2Md␣: 5=-CTCGCGCATCTACACCA-3= and 5’GGCTTCTTGTTAAAACACAAGCTCA-3=; H-2Od␣: 5=-GGTACTCCTAACCGTAATGAGCT-3= and 5=- GGTGGTGGGGTAAGCACTTG3=; transmembrane region of the H-2Ad␣: 5=-GCTGA-

46

CAGAAACTGTGGTGTG-3= and 5=-ATAAAGGCCCTGGGTGTCTG-3=. PCR-Product Sequencing The amplified PCR products were resolved on a 1.5% agarose gel. The appropriate bands were excised. The DNA was isolated with QIAquick Gel Extraction Kit (Qiagen) and sequenced in both directions with a ABI377 sequencer (Perkin-Elmer, Norwalk, CT; hardware program, ABI PRISM 377xl collector) to ensure that RT-PCR products were not artifacts. Statistical Analysis Student’s t-test was used to compare the significance levels (p) between control and test values.

RESULTS HLA-DO molecules have been proposed to act as negative regulators to antigen presentation in B lymphocytes. Such a property could be of great importance in the maintenance of the class II–negative state in trophoblasts, a hypothesis that is tested in the present report by use of different trophoblast cell populations, including the human trophoblast cell line JAR, primary human trophoblasts isolated from term placentas, and the murine trophoblast cell line TROPHO-1. Trophoblasts Constitutively Express HLA-DO Molecules JAR cells were cultured as described in Methods for 6, 24, and 48 hours and examined for surface HLA-DR and intracellular HLA-DR, -DO, -DM, and CD74 expression by immunofluorescence. As shown in Table 1, A, JAR cells did not express HLA-DR on their surface in any of the time intervals tested. However, HLA-DR was expressed intracellularily in a stable manner varying from 62% to 67% of the cells in the time intervals tested. Surprisingly, a high percentage of JAR cells were revealed to express HLA-DO and CD74 (95% and 51% of the cells, respectively), which decreased thereafter. However, no HLA-DM expression could be detected in any of the time intervals tested. In the presence of IFN-␥, which is the most effective inducer of class II antigens, JAR cells failed to express biologically considerable amounts of surface HLA-DR (Table 1A), whereas the intracellular expression of HLA-DR was significantly reduced (p⬍ 0.001), results that agree with previous observations on murine trophoblasts [32]. The expression of HLA-DO, as expected, was not affected by IFN-␥ in any of the time intervals tested. However, IFN-␥ induced HLA-DM antigens, which followed an increasing pattern of expression in relation to time of incubation. Finally, the constitutive expression of CD74 was

A. Ranella et al.

found to increase in the presence of IFN-␥, reaching a peak of production at 24 hours of culture (Table 1A). Primary human trophoblast cells were isolated as described in Methods and cultured for 6 or 24 hours, and the presence of surface HLA-DR and intracellular HLA-DR, -DM, -DO, or CD74 was estimated by immunofluorescence (Table 1, B). Although surface HLA-DR expression was not detected, the cells demonstrated highly detectable HLA-DR, HLA-DO, and CD74 levels, whereas HLA-DM could not be detected at the culture periods tested. In the presence of IFN-␥, primary trophoblasts did not demonstrate any biologically significant expression of surface HLA-DR antigens, but a significant reduction of the intracellular expression of these molecules compared with controls (p⬍ 0.001). The percentage of HLA-DO–positive cells was not affected by the 6- or 24-hour treatment with IFN-␥, whereas HLA-DM, which is not expressed in these cells, demonstrated a six- and tenfold increase of expression compared with untreated controls, respectively (p⬍ 0.001). The constitutive expression of CD74 was also found to increase in the presence of IFN-␥ (Table 1, B). In order to compare trophoblast cells with classic antigen-presenting cells, the above experimental protocol was also applied to primary human monocyte/macrophages. As expected, monocytes/macrophages expressed surface HLA-DR antigens. After intracellular staining, it was demonstrated that except from HLADO, a significant number of cells expressed HLA-DR, HLA-DM, and CD74 (Table 1C). A 6-hour treatment with IFN-␥ increased the percentage of HLA-DM positive cells compared with control (p⬍ 0.001) and decreased the number of CD74-positive cells (p⬍ 0.005), but did not alter the percentage of HLA-DR– or HLADO–positive cells. The 24-hour treatment, however, increased the percentage of both HLA-DR–, HLA-DM–, and CD74-positive cells by 80%, 312%, and 71%, respectively (p⬍ 0.001), compared with controls, although it did not affect the negative expression of HLA-DO (Table 1, C). Trophoblasts Produce Soluble Class II MHC Molecules The obtained results so far demonstrate that classic antigen-presenting cells and trophoblasts follow different regulatory pathways, as does class II antigen expression. By using the knowledge already acquired from the murine trophoblast model, it became necessary to test whether the intracellular pools of classic class II antigens can be released from the cells upon short-term treatment with IFN-␥. For this, culture supernatants from primary trophoblasts or JAR cells with or without IFN-␥ treatment for 6 or 24 hours were used and tested for their content in soluble

Expression of HLA-DO in Trophoblasts

47

TABLE 1 Expression of classic and nonclassic class II antigens in JAR cells, primary human trophoblasts, and primary human macrophages Net percentage of fluorescent cells ⫾ SEMa Hours of culture

Antibody specificity

Untreated cells

A

IFN-␥–treated cellsb JAR cells

Surface expression Intracellular expression

6 24 48 6

24

48

HLA-DR HLA-DR HLA-DR HLA-DR HLA-DO HLA-DM CD74 HLA-DR HLA-DO HLA-DM CD74 HLA-DR HLA-DO HLA-DM CD74

0 1⫾1 1⫾0 4⫾1 1⫾0 8⫾1 62 ⫾ 2 15 ⫾ 1 95 ⫾ 5 96 ⫾ 3 4⫾0 28 ⫾ 2 51 ⫾ 2 67 ⫾ 4 67 ⫾ 3 8⫾2 41 ⫾ 1 41 ⫾ 5 5⫾0 36 ⫾ 3 31 ⫾ 2 71 ⫾ 4 62 ⫾ 2 15 ⫾ 2 51 ⫾ 6 46 ⫾ 2 2⫾0 67 ⫾ 1 34 ⫾ 1 52 ⫾ 5 Primary human trophoblasts

HLA-DR HLA-DR HLA-DR HLA-DO HLA-DM CD74 HLA-DR HLA-DO HLA-DM CD74

1⫾1 3⫾1 1⫾0 6⫾1 58 ⫾ 1 13 ⫾ 3 57 ⫾ 4 56 ⫾ 5 1⫾1 6⫾1 60 ⫾ 3 85 ⫾ 4 19 ⫾ 2 4⫾1 85 ⫾ 2 87 ⫾ 6 3⫾1 29 ⫾ 2 51 ⫾ 1 91 ⫾ 8 Primary human macrophages

HLA-DR HLA-DR HLA-DR HLA-DO HLA-DM CD74 HLA-DR HLA-DO HLA-DM CD74

32 ⫾ 2 44 ⫾ 3 63 ⫾ 4 10 ⫾ 1 50 ⫾ 1 72 ⫾ 4 35 ⫾ 3 7⫾1 17 ⫾ 2 38 ⫾ 2

B Surface expression Intracellular expression

6 24 6

24

C Surface expression Intracellular expression

6 24 6

24

55 ⫾ 1 65 ⫾ 1 62 ⫾ 3 12 ⫾ 1 72 ⫾ 4 53 ⫾ 5 63 ⫾ 3 8⫾1 70 ⫾ 4 65 ⫾ 5

Abbreviations: HLA ⫽ human leukocyte antigen; IFN ⫽ interferon. a The results represent the mean of triplicate cultures. The experiments have been repeated three times and similar results were obtained. b IFN-␥ was added to the cells for 6, 24, or 48 hours at the concentration of 1500 pg/ml.

HLA-DR antigens by ELISA. As shown in Figure 1, IFN-␥ induced secretion of soluble HLA-DR antigens from both types of cells tested, whereas this was not the case for classic monocytes/macrophages (data not shown). Soluble HLA-DR release was obtained after 6 and 24 hours of stimulation with IFN-␥ and the increase of production varied from 4- to 11-fold (p⬍ 0.001) compared with untreated cells, respectively.

Intacellular Distribution and Colocalization Analysis of HLA-DR, -DO, and -DM Antigens in Trophoblasts In an attempt to visualize possible colocalization of HLA-DR, DM, and -DO in regard to CD74 and rab7 (used as a marker for endosomes [30]), double fluorescence experiments were performed. In the system used, monoclonal antibodies to HLA-DR were directly cou-

48

FIGURE 1 Short-term treatment with interferon-␥ induces secretion of classic human leukocyte antigen class II molecules from primary human trophoblasts and JAR cells as tested by enzyme-linked immuno-sorbent assay (ELISA) experiments. Primary human trophoblasts and JAR cells were isolated, cultured, and processed for ELISA as described in Methods. The results represent the mean of triplicate cultures and are expressed as percentage of optical density increase over background ⫾ SEM. The experiment was repeated five times, and similar results were obtained.

pled to FITC, whereas anti–HLA-DO, -DM, CD-74, and rab7 were stained with an antimouse IgG secondary antibody covalently lined to RITC. In primary trophoblast cells, HLA-DR expression was demonstrated to colocalize with HLA-DO, CD74, and rab7 in control cells after 6 hours of culture. In the presence of IFN-␥ the percentage of double positive cells was minimal (Figure 2). IFN-␥ seemed to upregulate CD74 production (42% increase, p⬍ 0.001) while it downregulated the rab7 expression (decrease by 19%, p⬍ 0.005). The 6-hour treatment of cells with IFN-␥ was not sufficient to reveal a significant increase of the HLA-DM expression (results that agree with the single immunofluorescence experiments). Confocal microscopy analysis after a double fluorescence staining (Figure 3) of untreated cells detected the following: a partial colocalization of HLA-DR and HLA-DO molecules; a partial colocalization of HLA-DR and CD74; a complete colocalization of HLA-DR and rab7; and a complete absence of HLA-DM expression. The confocal analysis applied on trophoblast cells treated with IFN-␥ for 6 hours revealed a significant decrease of HLA-DR staining; the appearance of HLA-DM staining, which colocalized with the existing small amounts of the HLA-DR staining; and the maintenance of HLA-DO, CD74 and rab7 staining. In order to analyze the colocalization pattern of class II molecules within the endosomal/lysosomal cellular compartments, JAR cells with or without treatment with IFN-␥ were submitted to subcellular fractionation and the endosomal fractions examined by ELISA for the presence of HLA-DR, -DO, -DM, CD74, and rab7. The subcellular fractionation of untreated JAR cells revealed a 17- to tenfold increase of HLA-DR activity in fractions

A. Ranella et al.

8 to 13 compared with background, whereas a smaller peak of activity with 54% to 27% of increase over background was present in fractions 16 to 19 (Figure 4). Although no HLA-DM activity was detected in untreated cells, three panels of HLA-DO activity were detected: the first corresponded to the lysosomal fractions (fractions 1–7), the second colocalizing mainly with the HLA-DR activity (fractions 9 –14, middle endosomal fractions), and the third colocalizing with the second HLA-DR peak of activity (fractions 17–19, light endosomal fractions). After a 6-hour treatment with IFN-␥ (Figure 4) the main HLA-DR peak of activity at fractions 8 –13 disappeared, whereas the second peak of activity (fractions

FIGURE 2 Colocalization of class II human leukocyte antigen molecules within the intracellular compartments of primary human trophoblasts with or without a 6-hour interferon-␥ treatment by double fluorescence experiments. Primary human trophoblast cells were isolated, cultured, and processed for intracellular immunofluorescence staining as described in Methods. The results represent the mean of triplicate cultures and are expressed as net percentage of fluorescent cells ⫾ SEM. The experiment was repeated five times, and similar results were obtained.

Expression of HLA-DO in Trophoblasts

49

FIGURE 3 Confocal microscopy analysis of primary human trophoblasts with (right panel) or without (left panel) a 6-hour interferon-␥ treatment.

14 –19) was maintained at almost the same levels as control cells. The three panels of HLA-DO activity were generally maintained (fractions 1–7, fractions 9 –11, and fractions 16 –20), but their magnitude (especially the activity observed in the middle endosomal fractions) was decreased. The presence of IFN-␥ for 6 hours in the cell cultures induced the appearance of HLA-DM, which revealed a small peak of activity at fractions 7 and 8 (51% and 20% of increase over background) and another panel of activity in fractions 12–20, which was revealed to be higher than that of HLA-DR and HLA-DO. After a 24-hour treatment with IFN-␥, JAR cells were revealed to considerably increase the HLA-DR activity in

the light endosomal fractions (fractions 13–20), which was colocalized with a lower-magnitude activity of HLA-DO and HLA-DM (Figure 4). A smaller amount of HLA-DR activity started appearing in the middle endosomal fractions (fractions 7–11). In all these experiments, rab7 was used as an endosomal marker. A similar pattern of expression was observed with the endosomal marker rab11 (data not shown). The distribution of CD74 within the endosomal/lysosomal fractions of JAR cells followed in most cases the pattern of HLA-DR activity. Thus, in untreated cells, CD74 was localized in fractions 1–7, 9 –14, and 17–20 in cells treated for 6 hours with IFN-␥ in fractions 1–3,

50

A. Ranella et al.

the 6-hour period seemed too short for the transcriptional activation of HLA-DM gene by IFN-␥, the presence of specific mRNA in untreated JAR cells was tested by RT-PCR experiments. Thus, the use of specific primers for HLA-DO␤, -DM␤, and -DR␤ detected the presence of such transcripts in untreated cells (Figure 6A, lanes 2, 5, and 8, respectively) and in cells treated with IFN-␥ (Figure 6A, lanes 3, 6, and 9, respectively). In order to test whether murine trophoblasts follow the

FIGURE 4 Determination of human leukocyte anigen (HLA)-DR–, -DM–, -DO–, and rab7-positive fractions after JAR cell fractionation by ELISA. Control JAR cells (A), cells treated with interferon (IFN)-␥ for 6 hours (B), or cells treated with IFN-␥ for 24 hours (C) were fractionated as described in Methods and submitted to enzyme-linked immuno-sorbent assay experiments to determine their content in HLA-DR, -DM, -DO, and rab7. The results are expressed as the percentage of optical density readings over background levels (y-axis) and represent the mean of triplicate samples of one of three experiments performed in each case where identical results were obtained. SEM varied in all cases from 3% to 6%.

8 –10, and 16, and in cells treated with IFN-␥ for 24 hours in fractions 2–3, 9, and 12–20, with the last panel exhibiting a magnitude of activity higher than that of HLA-DR (Figure 5). Analysis of mRNA of Human and Murine Class II Antigens by RT-PCR As has already been demonstrated, HLA-DM could be detected after a 6-hour treatment with IFN-␥. Because

FIGURE 5 Determination of human leukocyte antigen (HLA)-DR– and CD74-positive fractions after JAR cell fractionation by enzyme-linked immuno-sorbent assay (ELISA). Control JAR cells (A), cells treated with interferon (IFN)-␥ for 6 hours (B), or cells treated with IFN-␥ for 24 hours (C) were fractionated as described in Methods and submitted to ELISA experiments to determine their HLA-DR and CD74 content. The results are expressed as the percentage of optical density readings over background levels (y-axis) and represent the mean of triplicate samples of one of three experiments performed in each case where identical results were obtained. SEM varied in all cases from 3% to 6%.

Expression of HLA-DO in Trophoblasts

51

FIGURE 6 Agarose gel electrophoresis of polymerase chain reaction (PCR) products after selective reverse transcriptase (RT)-PCR. Messenger RNA isolated from JAR cells (A) and TROPHO-1 cells (B, C) were reverse transcribed and amplified with a set of primers that specifically amplified the exon 2 of HLA-DO␤, HLA-DM␤, HLA-DR␤, H-2O␣, H-2M␣, and H-2A␣ class II major histocompatibility complex antigen genes as well as the transmembrane region of the H-2A␣ gene (C). Messenger RNA was extracted from JAR and TROPHO-1 cells after 6 hours of incubation with (lanes 3, 6, 9, 14, 15, 18, 21) or without (lanes 2, 5, 8, 13, 16, 17, 20) interferon-␥. RT-PCR mixes without mRNA template were used as negative controls (lanes 1, 4, 7, 10, 11, 12, 19). A molecular weight marker (M) ranging from 0.12 to 8.45 kb was used.

same pattern of H-2O and H-2M expression, mRNAs isolated from the murine trophoblast cell line TROPHO-1 after a 6-hour incubation with or without IFN-␥ were submitted to RT-PCR experiments that used oligonucleotide primers specific for the H-2O␣, H-2M␣, and H-2A␣ chains of H-2O, H-2M, and H-2A proteins, respectively. The results demonstrated that H-2O␣ was constitutively expressed in the cells and was not regulated by IFN-␥ because the amount of mRNA transcript remained unchanged upon IFN-␥ addition to the cultures (Figure 6, lanes 13 and 14). H-2M␣ was expressed in TROPHO-1 cells, and the mRNA transcript increased after the 6-hour treatment with IFN-␥ (Figure 6B, lanes 16, 15). Finally, classic H-2A␣ was detected constitutively in the absence or presence of IFN-␥ to the cultures (Figure 6B, lanes 17

and 18). The murine system was also used to test the presence of the transmembrane region of H-2A␣ chain. The use of a specific primer (see Methods) revealed that the mRNA transcripts of control as well as IFN-␥–treated cells contain the transmembrane region of the molecule (Figure 6C, lanes 20 and 21, respectively). Sequencing of all amplified RT-PCR products verified the identity of HLA-DR␤, HLA-DO␤, HLA-DM␤, H-2O␣, H-2M␣, and H-2A␣ genes (data not shown). DISCUSSION The negative expression of class II MHC on trophoblasts is part of the protective mechanisms evoked by the fetus to avoid immune allorecognition and attack [26 –28].

52

Yet the pathways by which class II antigens are inhibited to reach the membrane are still unknown. During the antigen presentation process, the role attributed to HLA-DO in B lymphocytes is to regulate HLA-DM binding to classic class II molecules and inhibit antigen presentation [34, 35]. In the present study, we examined whether the nonclassic class II MHC molecules may be part of the mechanism that influence the surface expression of classic class II antigens on trophoblasts. By using the human trophoblast cell line JAR, primary human trophoblasts from term placentas, the murine trophoblast cell line TROPHO-1 and primary human monocytes/macrophages isolated from peripheral blood, the expression of HLA-DR, -DM, -DO, and CD74 was studied in various time intervals of cell cultures in the presence or absence of IFN-␥. It is revealed here that trophoblasts contained intracellular pools of classic HLADR, nonclassic HLA-DO, and CD74 antigens while not expressing HLA-DM. Primary macrophages demonstrated a reverse pattern of expression in regard to HLA-DM and -DO. Treatment with IFN-␥ influenced all parameters tested except from HLA-DO, results that unfold another important property of HLA-DO in the regulation of maternal-fetal interaction. In order to follow up the events underlying the class II antigen expression and study the constitutive versus inducible expression, different time intervals of cell culture were performed, including 6, 24, and 48 hours for JAR cells and 6 and 24 hours for primary human cells. Surface expression of HLA-DR in JAR cells and primary human trophoblasts was undetectable in any of the time intervals tested, which is in agreement with the findings of previous reports [26 –28, 36]. Upon IFN-␥ treatment and within the time intervals tested, the cells failed to induce considerable amounts of these antigens. However, studies in mice as well as immunohistologic examinations of abortive placentas in humans demonstrate that trophoblasts can express surface class II antigens [26]. Despite the absence of surface HLA-DR molecules, intracellular pools of these antigens were detected in all cases tested. Thus, JAR cells demonstrated a stable pattern of intracellular HLA-DR expression at 6, 24, and 48 hours, where 60% of the cells were found to contain these antigens. In primary trophoblast cells, this percentage of HLA-DR–positive cells dropped to 20% after 24 hours of culture. Such a decrease could be from the inevitable different cell synchronization of primary populations. These results indicate that regulatory mechanisms should be arresting HLA-DR molecules within intracellular compartments. Following the alreadyknown pathway in classic antigen-presenting cells, the class II antigen maturation process involves HLA-DM, HLA-DO, and CD74 molecules. In the present study, it was found that in trophoblasts, the above molecules

A. Ranella et al.

follow a specific pattern of expression that differs from that of classic antigen-presenting cells. Almost all JAR cells were expressing HLA-DO at 6 hours of culture, whereas no HLA-DM expression could be detected. CD74 was present in 51%, 31%, and 34% of the cells after 6, 24, and 48 hours of culture, respectively. According to Liljedahl et al. [17], HLA-DO exits the endoplasmic reticulum only when complexed with HLADM; otherwise it is catabolized. However, in the case of trophoblasts where HLA-DM is not expressed, the amount of HLA-DO detected in 41% and 51% of the cells at 24 and 48 hours of culture, respectively, should be complexed either to HLA-DR or to CD74, whereas in cells not expressing HLA-DR or CD74 at 6 hours of culture (38% and 49% of the total population, respectively), HLA-DO should be catabolized, therefore dropping the expression of 95% of the cells at 6 hours of culture to 41% and 51% at 24 and 48 hours of culture. In the presence of IFN-␥, a significant decrease in intracellular HLA-DR is observed. Because no significant surface HLA-DR could be detected, the amount of HLA-DR lost from the cells could be either catabolized or secreted. Indeed, HLA-DR activity could be detected by ELISA in culture supernatants of IFN-␥–treated JAR cells or primary trophoblasts. HLA-DO expression was not affected by the IFN-␥ treatment, whereas HLA-DM was induced in a time-dependent manner detected in 67% of the cells after 48 hours of culture, results that are in agreement with observations from other laboratories [39 – 41]. The expression of CD74 was also found to increase upon treatment with IFN-␥. However, because IFN-␥ decreases the expression of HLA-DR, the induced amounts of CD74 should have an additional role, other than their binding to HLA-DR molecules. In order to compare the regulation of class II in trophoblasts versus classic antigen-presenting cells, the same experimental protocol was applied to human monocytes/macrophages isolated from peripheral blood. These cells did not express HLA-DO but did exhibit intracellular HLA-DR and HLA-DM antigens, which are increased upon treatment with IFN-␥. It has to be noted that surface HLA-DR expression also increased upon IFN-␥ treatment in monocyte/macrophages, and no soluble HLA-DR could be detected in culture supernatants (data not shown). In order to localize the expression of HLA-DR, -DM, -DO, and CD74 molecules within the intracellular compartments of trophoblasts, double fluorescence experiments, confocal microscopy analysis, and subcellular fractionation experiments were performed. Thus, the double fluorescence experiments and microscopy analysis in primary human trophoblasts revealed that HLA-DR expression was colocalized with HLA-DO, CD74, and rab7 in control cells after 6 hours of culture. After the 6-hour

Expression of HLA-DO in Trophoblasts

treatment with IFN-␥, a significant decrease of HLA-DR expression was detected that, however, colocalized with the newly arising HLA-DM expression. Subcellular fractionation experiments in untreated JAR cells localized a considerably high activity of HLA-DR in the in the middle zone endosomal fractions, which disappeared after the 6-hour treatment with IFN-␥ and displayed a de novo appearance after a 24-hour treatment with IFN-␥. This middle endosomal portion of HLA-DR activity could correspond to the HLA-DR being released from the cells, as detected by the previously described ELISA experiments. This pattern also agrees with the decrease of HLA-DR caused by IFN-␥ in the immunofluorescence experiments and the confocal microscopy analysis. A small portion of the HLA-DR activity observed in the middle endosomal fractions of untreated JAR cells colocalized with HLA-DO and CD74 indicating that at least some of the HLA-DR molecules in these compartments would be bound to HLA-DO and loaded with CD74 (possibly one of its proteolytic products). The lower activity of HLA-DR observed in the light endosomal fractions could represent newly produced HLA-DR molecules, which also colocalize with HLA-DO and CD74 in untreated cells; on stimulation with IFN-␥, they are found to colocalize with HLA-DM. Because IFN-␥ stays longer in culture a significant increase of the light endosomal HLA-DR and CD74 activity is observed, possibly corresponding to the newly synthesized HLA-DR and CD74 molecules, which should thereafter move to the middle endosomal zone for secretion from the cell or follow the pathway toward the cell membrane. It is interesting to note that at 24 hours of culture with IFN-␥, the HLA-DR activity in the light endosomal fractions colocalizes with HLA-DM and HLA-DO, where according to the knowledge acquired from the B-cell studies the presence of HLA-DO should block the HLA-DM–mediated transport of HLA-DR to the cell membrane. However, the fact that HLA-DO is not regulated by IFN-␥ lets us to assume that upon continuous stimulation with IFN-␥ the HLA-DM levels should overcome those of HLA-DO so that quantitatively HLA-DO would not be able to block HLA-DM and therefore some of the HLA-DR/ HLA-DM activity should be allowed to reach the membrane. As it has been found in many systems (macrophages, dendritic cells, B cells), IFN-␥ induces, among others, HLA-DM expression and this is also the case for the JAR cells described here. Yet the HLA-DM activity could be detected as soon as 6 hours of IFN-␥ treatment, which in most cellular systems is not enough time for transcription, translation, and appearance of the active product. It is therefore necessary to hypothesize that the HLA-DM mRNA preexisted in the untreated cells and that IFN-␥ would only affect intracellular rearrangements and as-

53

sembly of the molecule’s constituents. Indeed, RT-PCR experiments that used specific HLA-DM␤ primers detected the presence of HLA-DM␤ transcripts in untreated JAR, which, under the same PCR conditions, increased upon the 6-hour treatment with IFN-␥. Similarly, the RT-PCR experiments detected the presence of HLA-DO␤ and HLA-DR␤ transcripts in untreated JAR cells. Upon treatment with IFN-␥, only the HLA-DR␤ transcript was found to increase, which is in agreement with the many other reports in the literature. A similar type of regulation was obtained with the murine trophoblast experimental model. Because of the lack of commercial monoclonal antibodies against H-2O and H-2M, this system was approached only by RT-PCR experiments that used specific primers for the A␣, O␣, and M␣ chains of H-2A, H-2O, and H-2M, respectively. The results revealed that the H-2O␣ message was constitutively expressed in trophoblasts and not regulated by IFN-␥; the classic H-2A␣ messages were constitutively expressed in the untreated cells and their expression increased when IFN-␥ was added to the cultures. Finally, H-2M␣ mRNA was only detected in small amounts in the untreated cells but could be induced by IFN-␥. The murine system allowed to easily address the question of whether the mRNA transcript of classic class II genes possess the transmembrane region or whether there exists a different tailless isoform, which, as in the case of HLA-G5, facilitates secretion. The murine trophoblast experimental model expresses only the classic H-2A molecules because the H-2E genes were previously found to be methylated [27]. By use of a specific primer for the transmembrane region of the H-2A␣ gene, RT-PCR experiments detected the presence of this region in the untreated as well as the IFN-␥–treated TROPHO-1 cells. These results indicated that the primary transcript of classic class II H-2A␣ molecules contained the transmembrane region. Further experiments are needed to evaluate the exact physicochemical and structural properties of the secreted class II molecules. Taken together, these findings place trophoblast cells to the list of HLA-DO– expressing cells. Furthermore, the presence of intracellular HLA-DR and CD74 and the absence of HLA-DM molecules in these cells point to a novel regulatory mechanism of class II antigen expression, which, in the context of pregnancy, appears to embrace an important role in fetal survival toward maternal immune recognition and attack. Whether or not CIITA is part of the suppression mechanism of surface class II molecules in trophoblasts is still an open question. Preliminary results from our laboratory suggest that small amounts of CIITA are constitutively expressed in primary human trophoblasts and are not regulated by IFN-␥ (data not shown). It therefore seems that the regulation of class II molecule expression in trophoblasts

54

is a multiparameter issue in which, as suggested here, HLA-DO and HLA-DM are actively involved. REFERENCES 1. Marks MS, Germain RN, Bonifacino JS: Transient aggregation of major histocompatibility complex class II chains during assembly in normal spleen cells. J Biol Chem 270:10475, 1995. 2. Anderson KS, Cresswell P: A role for calnexin (IP90) in the assembly of class II molecules. EMBO J 13:675, 1994. 3. Cresswell P: Assembly, transport and function of MHC class II molecules. Annu Rev Immunol 12:259, 1994. 4. Roche PA, Teletski CL, Stang E, Bakke O, Long EO: Cell surface HLA-DR invariant chain complexes are targeted to endosomes by rapid internalization. Proc Natl Acad Sci U S A 90:8581, 1993. 5. Bènaroch P, Yilla M, Raposo G, Ito K, Miwa K, Geuze HJ, Ploegh HL: How MHC class II molecules reach the endocytic pathway. EMBO J 14:37, 1995. 6. Wolf PR, Ploegh HL: How MHC molecules acquire peptide cargo: biosynthesis and trafficking through the endocytic pathway. Annu Rev Cell Biol 1:267, 1995. 7. Alfonso C, Karlsson L: Non-classic MHC class II molecules. Ann Rev Immunol 18:113, 2000. 8. Busch R, Mellins ED: Developing and shedding inhibitions: how MHC class II molecules reach maturity. Curr Opin Immunol 8:51, 1996. 9. Morris P, Shaman J, Attaya M, Amaya M, Goodman S, Bergman C, Monaco JJ, Mellins E: An essential role for HLA-DM in antigen presentation by class II major histocompatibility molecules. Nature 368:551, 1994. 10. Kelly AP, Monaco JJ, Cho S, Trowsdale J: A new human HLA class II–related locus, DM. Nature 353:571, 1991. 11. Sloan YS, Cameron P, Porter G, Gammon M, Amaya M, Mellins E, Zaller EDM: Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature 375:802, 1995. 12. Denzin LK, Cresswell P: HLA-DM induces CLIP dissociation from MHC class II ␣␤ dimers and facilitates peptide loading. Cell 82:155, 1995. 13. Sherman MA, Weber DA, Jensen PE: DM enhances peptide binding to class II MHC by release of invariant chain-derived peptide. Immunity 3:197, 1995. 14. Kleijmeer MJ, Morkowski S, Griffith JM, Rudensky AY, Geuze HJ: Major histocompatibility complex class II compartments in human and mouse B lymphoblasts represent conventional endocytic compartments. J Cell Biol 139:639, 1997. 15. Karlsson L, Surh CD, Sprent J, Peterson PA: An unusual class II molecule. Immunol Today 13:469, 1992. 16. Douck DC, Altmann DM: HLA-DO is an intracellular class II molecule with distinctive thymic expression. Int Immunol 9:355, 1997.

A. Ranella et al.

17. Liljedahl M, Kuwana T, Fung-Leung W, Jackson MR, Peterson PA, Karlsson L: HLA-DO is a lysosomal resident which requires HLA-DM for efficient intracellular transport. EMBO J 15:4817, 1996. 18. van Ham SM, Tjin EP, Lillemeier BF, Gruneberg U, van Meijgaarden KE, Pastoors L, Verwoerd D, Tulp A, Canas B, Rahman D, Ottenhoff TH, Pappin DJ, Trowsdale J, Neefjes J: HLA-DO is a negative modulator of HLA-DM– mediated MHC class II peptide loading. Curr Biol 7:950, 1997. 19. Liljedahl M, Winqvist O, Surh CD, Wong P, Ngo K, Teyton L, Peterson PA, Brunmark A, Rudensky AU, Fung-leung WP, Karlsson L: Altered antigen presentation in mice lacking H2-O. Immunity 8:233, 1998. 20. van Ham M, van Lith M, Lillemeier B, Tjin E, Gruneberg U, Rahman D, Pastoors L, van Meijgaarden K, Roucard C, Trowsdale J, Ottenhoff T, Pappin D, Neefjes J: Modulation of the major histocompatibility complex class IIassociated peptide repertoire by human histocompatibility leukocyte antigen (HLA)-DO. J Exp Med 191:1127, 2000. 21. Hunt JS, Petroff MG, Morales P, Sedlmayer P, Geraghty DE, Ober C: HLA-G in reproduction: studies on the maternal-fetal interface. Hum Immunol 61:1113, 2000. 22. Carosella ED, Dausset J, Rouas-Freiss N: Immunotolerant functions of HLA-G. Cell Mol Life Sci 55:327, 1999. 23. Slapsus R, Clark DA: Active suppression of host versus graft reaction in pregnant mice. V. Kinetics, specificity and in vivo activity of non-T suppressor cells localized in the genital tract of mice during pregnancy. Am J Reprod Immunol 3:65, 1983. 24. Sano M, Miake S, Yashikai Y, Nomoto K: Existence of suppressor cells in the spleen of allogeneic and syngeneic primiparous pregnant mice. J Reprod Immunol 6:239, 1984. 25. Matthiensen L, Berg G, Ernrudh J, Hakansson L: Lymphocyte subsets and mitogen stimulation of blood lymphocytes in normal pregnancy. Am J Reprod Immunol 35:70, 1996. 26. Athanassakis I, Aifantis Y, Makrygiannakis A, Koumantakis E, Vassiliadis S: Placental tissue from human miscarriages express class II MHC antigens. Am J Reprod Immunol 34:281, 1995. 27. Athanassakis-Vassiliadis I, Galanopoulos VK, Grigoriou M, Papamatheakis J: Induction of class II MHC antigen expression on the murine placenta by 5-azacytidine correlates with fetal abortion. Cell Immunol 128:438, 1990. 28. Vassiliadis S, Tsoukatos D, Athanassakis I: Interferoninduced class II expression at the spongiotrophoblastic zone of the murine placenta is linked to fetal rejection and developmental abnormalities. Acta Physiol Scand 151: 485, 1994. 29. Morris AC, Spangler WE, Boss JM: Methylation of class II trans-activator promoter IV: a novel mechanism of MHC class II gene control. Immunology 164:4143, 2000.

Expression of HLA-DO in Trophoblasts

30. Holtz R, Choi JC, Petroff MG, Piskurich JF, Murphy SP: Class II transactivator (CIITA) promoter methylation does not correlate with silencing of CIITA transcription in trophoblasts. Biol Reprod 69:915, 2003. 31. Geirsson A, Lynch RJ, Paliwal I, Bothwell AL, Hammond GL: Human trophoblast non-coding RNA suppresses CIITA promoter III activity in murine B lymphocytes. Biochem Biophys Res Commun 301:718, 2003. 32. Athanassakis I, Ranella A, Vassiliadis S: IFN-␥ facilitates release of class II–loaded intracellular pools in trophoblast cells: a novel property independent of protein synthesis. J Interferon Cytokine Res 20:823, 2000. 33. Athanassakis I: Cytokine/hormonal production, responsiveness to growth factors and MHC inducibility of the murine trophoblast cell line TROPHO-1. Trophoblast Res 13:55, 1999. 34. Athanassakis I, Papadimitriou L, Koumantakis E, Vassiliadis S: Th1- and Th2-type lymphokine-assisted induction and release of chemokine receptors from primary human trophoblast cells. Hum Immunol 61:651, 2000. 35. Athanassakis I, Iconomidou B: Cytokine production in the serum and spleen of mice from day 6 to 14 of gestation. Dev Immunol 4:247, 1996.

55

36. Qiu Y, Xu X, Wandinger-Ness A, Dalke DP, Pierce SK: Separation of subcellular compartments containing distinct functional forms of MHC class II. J Cell Bio 125: 595, 1994. 37. Denzin LK, Sant’Angelo DB, Hammond C, Surman MJ, Cresswell P: Negative regulation by HLA-DO of MHC class II–restricted antigen processing. Science 278:106, 1997. 38. Jensen PE: Antigen processing: HLA-DO—a hitchhiking inhibitor of HLA-DM. Curr Biol 8:R128, 1998. 39. Vassiliadis S, Athanassakis I: Two novel colony-stimulating factor 1 (CSF-1) properties: it post-transcriptionally inhibits interferon-specific induction of class II antigens and reduces the risk of fetal abortion. Cytokine 6:295, 1994. 40. Rober JS, Collins T Jr, Gimbrone MA, Cortan RS, Githin JD, Fiers W, Clayberger C, Krensky AM, Burakoff SJ, Reiss CS: Lymphocytes recognize human vascular endothelial and dermal fibroblast Ia antigen induced by recombinant immune interferon. Nature 305:726, 1983. 41. Lee Y-J, Benveniste EN: Stat 1␣ expression is involved in IFN-␥ induction of the class II transactivator and class II MHC genes. J Immunol 157:1559, 1996.