Construction and Activity of Recombinant Adeno-associated Virus Expressing Vasostatin

CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 11, November 2008 Online English edition of the Chinese language journal RESEARCH PAPER

Cite this article as: Chin J Biotech, 2008, 24(11), 1949í1954.

Construction and Activity of Recombinant Adenoassociated Virus Expressing Vasostatin Yong Diao1, Jian Ma2, Xinyan Li1, 2, Xueying Sun1, and Ruian Xu1 1

Molecular Medicine Engineering Research Center of the Ministry of Education, and Institute of Molecular Medicine, Huaqiao University, Quanzhou 362021, China

2

Hong Kong University, Pokfulam, Hong Kong, China

Abstract: Vasostatin (VAS), a 180-amino acid fragment from the N-terminal domain of calreticulin, is a potent endogenous angiogenesis inhibitor, which can inhibit the growth of many kinds of experimental tumors. However, a recent report that vasostatin can enhance the malignant behavior of the neuroendocrine tumor reminds us to be cautious to develop it as an antitumor medicine. VAS cDNA was cloned into pAAV-2 expression vector; recombinant virus rAAV-VAS was generated by a three-plasmid, helper-free packaging method. MS1 mouse pancreatic endothelial cell and human colon tumor HCT-116 cell were infected with rAAV-VAS. Transgene expression was analyzed by Western blot analysis and cell proliferation was determined by MTT assay. The therapeutic potential of rAAV-VAS was evaluated in a subcutaneous HCT-116 xenograft mouse model. rAAV-VAS inhibited the proliferation of MS1, but not the HCT-116 cell. The HCT-116 cell, infected with rAAV-VAS, secreted VAS protein into the supernatant effectively. The intratumoral delivery of rAAV-VAS inhibited the xenograft growth and microvessel density in tumors significantly. The results show the effectiveness of rAAV-VAS as an angiogenesis inhibitor in suppressing tumor growth, validating the application of the rAAV-VAS gene therapy in treatment against colon cancer. Keywords: Vasostatin; colorectal neoplasms; angiogenesis; gene medicine; adeno-associated virus

Introduction Vasostatin (VAS), a 180-amino acid fragment from the N-terminal domain of calreticulin, is a potent endogenous angiogenesis inhibitor. Pike first reported that VAS could inhibit the proliferation of human umbilical vein endothelial cells (HUVEC) and fetal bovine heart endothelial cells (FBHE) induced by basic fibroblast growth factor (bFGF) [1,2]. Other studies demonstrated that VAS also inhibited the growth of bovine aortic EC (BAEC) and mouse endothelial cell (SVEC4-10) [3,4]. Angiogenesis is a major feature of tumor growth and metastasis. As such, targeting the tumor neovasculature is an

attractive strategy for effective cancer therapy. A number of endogenous angiogenesis inhibitors have been identified and tested in preclinical models, with more than 70 inhibitors, including endostatin and angiostatin, which have been introduced into clinical trials. Several were even approved for marketing. Several mice tumor models have shown that VAS inhibits the growth of tumor cells, such as, Burkitt lymphoma cell line (CA46), colorectal adenocarcinoma cell line (SW480), and pancreatic carcinoma[3,4]. Daily administration of recombinant VAS was shown to reduce xenograft growth in mice[1]. Repeated Vas gene delivery by DNA or adenoviral vectors also suppressed subcutaneous tumor growth in mice[3,4]. The

Received: May 27, 2008; Accepted: July 14, 2008 Corresponding author: Yong Diao. Tel: +86-595-22692516; E-mail: [email protected] Supported by: the State High-Tech Research and Development Program of China (863 Program, No. 2007AA02Z194), Hong Kong University Foundation (special donation from Madame Cho So Man) and Huaqiao University Foundation B105 Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.

Yong Diao et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1949–1954

anti-tumor activity of VAS stimulated the researchers' enthusiasm for development greatly, however, a recent study showed that VAS promotes tumor cell growth and tumor development[5]. It was reported that the gene transfer of vasostatin by using the FuGene 6 transfection reagent into the neuroendocrine tumor cell line (BON) caused an enhanced malignant behavior in vitro and in vivo. Therefore, the use of VAS as an anti-tumor agent should be cautiously evaluated. Although Liu et al suggested that VAS did not probably have a tumor growth inhibitory effect by itself [5], We think the gene delivery system or vector may be responsible for the ineffectiveness.

1

Materials and methods

1.1 Cells and animal Human embryonic kidney (HEK) 293 cell line and a colon adenocarcinoma cell line HCT-116 were purchased from the American Type Culture Collection. The cells were cultured in DMEM (Invitrogen, Grand Island, NY, USA) supplemented with 10% fetal calf serum (FCS), 100 units/ mL penicillin, and 100 Pg/mL streptomycin. Six- to eight-week old BALB/c nude mice, Ƃ, were obtained from the Laboratory Animal Unit of the University of Hong Kong. All surgical procedures and care administered to the animals were approved by the University Ethics Committee and performed according to the institutional guidelines. 1.2 Chemicals and reagents The AAV vector pAAV-2, helper vector pH22, and pFd6 were kept in the Institute of Molecular Medicine, Huaqiao University. The anti-CD34 (clone MEC 14.7), anti-Ki-67 antibodies were purchased from Santa Cruz (Santa Cruz, CA, USA). The monoclonal antibody against human calreticulin was purchased from Stressgen Biotechnologies). Horseradish peroxidase-conjugated secondary antibody and enhanced chemiluminescence detection were purchased from Amersham Pharmacia. 1.3 PCR primers PCR primers and their sequences are listed in table 1. 1.4 Amplification of VAS cDNA and construction of pAAV-VAS plasmid The full-length cDNA fragment of human VAS was amplified from human liver first-stranded cDNA by PCR with primer VAS-F and VAS-R. The PCR was performed under the following conditions: denaturation at 94o C for Table 1 PCR primers and sequences Primer

Sequence (5c–3c)

VAS-F

AACTCGAGCCCGCCATGCTGCTATCC

VAS-R

AAAAGCTTCTAGTTGTCTGGCCGCACAAT

WPRE-F

TGGCGTGGTGTGCACTGT

WPRE-R

GTTCCGCCGTGGCAATAG

60 s, followed by 36 cycles of denaturation at 94oC for 45 s, annealing at 50oC for 45 s, and elongation at 68oC for 45 s. The PCR product was inserted into the Xho I/ Hind III site of the pAAV-2 expression vector under the regulation of cytomegalovirus enhancer, chicken E-actin promoter, and a woodchuck hepatitis B virus posttranscriptional regulatory element (WPRE), to boost expression levels. The insertion of cDNA fragments into the vector was confirmed by restriction enzyme digestion. 1.5 Preparation of rAAV stocks rAAV particles were generated by a 3-plasmid, helper virus free packaging method. pAAV-VAS and the helper pFd6/H22 were transfected into 293 cells using calcium phosphate precipitation. Cells were harvested 70 hours after transfection and lysed by incubation with 0.5% deoxycholate in the presence of 30 u/mL benzonase for 30 minutes at 37oC. After centrifugation at 5000×g, the lysate was filtered through a 0.45 Pm Acrodisc syringe filter to remove any particulate matter. The rAAV particles were isolated by heparin affinity column chromatography. The peak virus fraction was dialyzed against 100 mM NaCl, 1 mM MgCl2, and 20 mM sodium mono- and dibasic phosphate (pH 7.4). The viral vector was stored at 70oC before animal experiments. 1.6 Titer assay of rAAV-VAS The titer of rAAV vectors was determined by real-time PCR analysis, with primers of WPRE-F and WPRE-R. An aliquot of rAAV-VAS was diluted serially, and digested sequentially with deoxyribonuclease I and Proteinase K. Viral DNA was extracted twice with phenol chloroform to remove proteins, and then precipitated with 2.5 equivalent volumes of ethanol. A standard amplification curve was established ranging from 102 to 107 copies of pAAV-VAS, and the amplification curve corresponding to each initial template copy number was obtained. 1.7 Inhibition of cell proliferation MS1 or HCT-116 cells were seeded onto 96-well plates at 2 × 103 cells per well. After 2 d incubation, the cells were infected with virus rAAV-VAS or rAAV-GFP (MOI, 104). The medium was replaced by a normal medium 5 h later. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays were done at 24 h, 48 h, and 72 h, and cell viability was determined according to the formula relative cell viability = (A570690 of treated cells)/(A570690 of control cells). Three independent experiments were done in triplicate for each treatment. 1.8 Transgene expression in vitro HCT-116 cells were seeded onto 24-well plates at 5×104 cells per well. After 2 d incubation, the cells were infected with virus rAAV-VAS (MOI, 104). The medium was replaced by normal medium 5 h later, and incubated for 72 h. Supernatants and protein extracts from cell lysates were

Yong Diao et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1949–1954

analyzed by Western blotting and probed with monoclonal antibody against human calreticulin, followed by horseradish peroxidase-conjugated secondary antibody and enhanced chemiluminescence detection. HCT-116 cells were infected with virus rAAV-VAS, with different MOI, and the secreted protein was determined with the same method mentioned earlier. 1.9 Subcutaneous HCT-116 xenograft model HCT-116 cells (2×106) resuspended in 100 PL PBS were injected into the dorsal flank of ten seven-week-old male BALB/c nude mice. When the tumor size reached about 50 mm3 (7 d later), mice were randomized into two groups (n = 5 per group). Particles (2×1011 vector genomes) of rAAV-VAS or rAAV-GFP were injected into the tumor under anesthesia. Tumor growth was monitored regularly for 60 days. The tumor volume was measured with a digital caliper and calculated using the formula 0.52×a×b2, where a and b were the largest and smallest diameters, respectively. 1.10 Immunohistochemistry Tumor samples were fixed, paraffin-embedded, and sectioned (5 Pm). Primary antibodies, including CD34 and Ki-67, were used for analysis of the tumor microvessel density and Ki-67 proliferation index. Microvessel density (MVD) was assessed after CD34 staining. Briefly, the numbers of microvessels (0.7386 mm2 per field) were counted from three hot spots in each tumor, and the mean value was taken as the MVD. For the Ki-67 proliferation index, positively stained cells were counted on a minimum of 10 randomly selected high power field (×400) from the representative tumor sections. 1.11 Analysis of in vivo gene expression by RT-PCR Total RNA from mice tumor tissues was extracted by Trizol, and first-strand cDNA was synthesized with Superscript II and tested for the expression of VAS with primer pairs VAS-F and WPRE-R. PCR conditions were 45 s each at 94oC, 55oC, and 72oC for 32 cycles. 18S rRNA was used as internal control.

of serial dilution of a basic AAV vector plasmid with known concentration. The amount of rAAV virus generated by using the method described previously was 1.5×10113.5×1011 vg/ per plate. 2.3 Suppression of MS1 cell growth rAAV-VAS clearly inhibits MS1 cell growth (Fig. 2). The relative cell viability of the rAAV-VAS group was 80% of the control group rAAV-GFP˄P < 0.05˅at 48 h after infection, and fell to 60%˄P < 0.01˅at 72 h. The cells became round and detached from the rAAV-VAS group, but no apparent changes were observed in the control. 2.4 Influence of HCT-116 cell Similar to the control rAAV-GFP, rAAV-VAS had no effect on the growth of HCT-116 cells (Fig. 3). 2.5 Expression of VAS in HCT-116 cells infected with rAAV-VAS Western blotting analysis using anticalreticulin antibody showed the production and secretion of VAS in both the culture medium and cell lysates 72 h after rAAV-VAS

Fig. 1 Schematic representation of pAAV-VAS expression cassette

Fig. 2

2

Results

2.1 Construction of pAAV-VAS The pAAV-VAS expression cassette that resulted is shown in Fig. 1. To attain a constitutive, high-level expression, the VAS cDNA was cloned into a pAAV-2 expression vector under the control of the CMV enhancer and chicken E-actin promoter. To boost transgene expression, WPRE was inserted into the construct, immediately after the expression cassette. The expression cassette was flanked by the AAV-2 ITRs. 2.2 Titration of rAAV virus The titer of rAAV vectors was determined by real-time PCR and expressed in terms of a number of vector genomes (vg). A standard curve was generated by the real-time PCR

Relative cell viability of MS1 cells infected with rAAV-VAS *

Fig. 3

P < 0.05 vs. control;

**

P < 0.01 vs. control

Relative cell viability of HCT-116 cells infected with rAAV-VAS

Yong Diao et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1949–1954

infection (Fig. 4). Protein expression was not detected in rAAV-GFP infected cells. The results demonstrated that rAAV-VAS transduced HCT-116 cells successively, and the expressed protein was secreted into the medium. The VAS expression levels in the medium correlated well with the rAAV-VAS amount used for the infection (Fig. 5). 2.6 Suppression of subcutaneous HCT-116 tumors in vivo The tumor size was about 50 mm3 7 d after subcutaneous inoculation. Tumor growth was significantly slower in the group treated with intratumoral delivery of rAAV-VAS than in the control (Fig. 6). The mean size of the tumors, 50 d after inoculation in mice treated with rAAV-Vas, was significantly smaller than that in rAAV-GFP treated mice (P < 0.05). 2.7 Inhibition of tumor angiogenesis To determine whether the poor growth of rAAV-VAS treated subcutaneous xenografts was due to poor blood vessel supply, the authors stained the tumor sections with antibodies against CD34 and measured MVD. A significant decrease in MVD (74 r 28 versus 243 r 78 vessels per high power field, P < 0.01) in mice treated with rAAV-VAS was observed compared with tumors in control mice (Fig. 7).

These results suggested that rAAV-VAS treatment was effective in reducing the number of capillary vessels, resulting in the repression of vascular tumor mass expansion 2.8 Inhibition of tumor proliferation The proliferation index (proportion of Ki67-positive cells) of subcutaneous xenografts was calculated (Fig. 8). The tumor cell proliferation index in the rAAV-VAS group was reduced slightly compared to the control group, but no. significant difference was found. The decrease of the proliferation index in the rAAV-VAS treated group was probably due to poor blood vessel supply, and not the activity of VAS. 2.9 Transgene expression For specific transgene expression analysis, the upper stream primer, corresponding to the human Vas gene, was used, and a sequence in the WPRE region of the vector acted as a downstream primer. RT-PCR was performed to detect Vas mRNA expression in the tumor tissues of rAAV-VAS-treated mice, which revealed that exogenous VAS mRNA was expressed specifically, compared to the control (Fig. 9).

Fig. 4 Western blotting analysis of Vasostatin expression in rAAV-VAS infected HCT-116 cells 1: cell medium; 2: cell lysate

Fig. 7

Inhibition of tumor angiogenesis

Sections of subcutaneous HCT-116 tumors from mice intratumorally injected with rAAV-GFP (left) and rAAV-VAS (right) two months after treatment were immunostained with anti-CD34 Ab. Representative photographs were shown

Fig. 5 Western blotting analysis of Vasostatin expression level with different rAAV-VAS 1: MOI=0; 2: MOI=10; 3: MOI=102; 4: MOI=103; 5: MOI=104

Fig. 6 Suppression of subcutaneous tumor growth by rAAV-VAS intratumoral injection *

P < 0.05 vs. control

Fig. 8

Proliferation index of HCT-116 cells treated with rAAV-VAS

Yong Diao et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1949–1954

Fig. 9 Specific rAAV-mediated transgene expression detected by RT-PCR in HCT-116 tumor from BABL/c nude mice two months after treatment with rAAV-VAS (lane 1 and 2) or rAAV-GFP(lane 3 and 4) 18 S rRNA was amplified as a PCR internal control

3

Discussion

The results show that gene medicine rAAV-VAS can inhibit endothelial cell proliferation in vitro, suppress neovascularization in vivo, lower blood supply to the tumor, and reduce the growth of the experimental tumor. rAAV-VAS has no direct effect on HCT-116 cells both in vitro and in vivo. After being infected with rAAV-VAS, the HCT-116 cells express and secrete VAS protein effectively. The expressing levels correspond well with the rAAV-VAS MOIs employed. The transgene expression is stable during the two-month experiment period. Angiogenesis is one of the most important events in tumor growth, invasion, and metastasis. Modulation of angiogenesis is an essential way of preventing tumor growth, which results in the development of different agents directed against angiogenesis. Most researches report that VAS is effective in the inhibition of tumor growth in murine models, by injecting VAS protein or the gene medicine encoding VAS cDNA. VAS is a naturally occurring angiogenesis inhibitor that is capable of blocking vascular endothelial cells from responding to both VEGF and bFGF[1,2], two major angiogenic stimulators. It is well known that the production of VEGF and bFGF by the HCT-116 human colorectal cell lines is indeed necessary for tumor angiogenesis and tumorigenic growth in nude mice[6]. The results here prove again that VAS is a good candidate for tumor therapy, because it has anti-proliferative effects in endothelial cells and mice tumor models. However, Liu’s report that VAS transfer caused enhanced malignant behavior of neuroendocrine tumor cell line (BON) [5], raises the authors’ attention. BON cells were transfected with VAS cDNA plasmid using the vector FuGene 6 transfection reagent. VAS-expressing BON cells were subcutaneously injected in the flank of the mice to develop tumors. Their data showed that VAS promoted cell growth and tumor development, and it was explained that it might be due to the different tumor developmental mechanisms in

neuroendocrine tumors; angiogenesis is an important factor in tumor growth, but probably not the prime factor in neuroendocrine tumors. It was shown in Liu’s article that the gene delivery vector FuGene 6 transfection reagent alone also promotes tumor growth when compared to wild BON cells, so the authors suspect that the vector may play an important role. Success in treatment targeting angiogenesis is highly dependent on the delivery method used and the ability to sustain persistent expression of the therapeutic molecule in vivo. Reduced subcutaneous tumor growth was achieved through repeated administration of VAS cDNA plasmid or adenoviral vectors [3,4]. The authors observed tumor suppression after a single dose of intratumoral injected rAAV-VAS. Potential advantages of anti-angiogenic gene therapy are the sustained expression of the anti-angiogenic factors and highly localized delivery. Despite these advantages, vector development is still in its infancy for this form of therapy. Adenoviruses are the vectors used most commonly for this strategy, and in several preclinical studies have shown promise. Nonetheless, expression of anti-angiogenic factors mediated by adenovirus-based vectors is limited by an effective host immune response and is also secondary to the episomal nature of the vector. AAV, on the other hand, possesses most of the salient features to be a desirable vector for anti-angiogenic gene therapy[7]. The advantages of rAAV over other vectors for anti-angiogenic gene therapy include limited host immune response, long-term in vivo expression, and efficient transduction of primary tumor cells. The present study shows that rAAV-mediated VAS gene delivery to pre-established subcutaneous HCT-116 xenograft in nude mice leads to a significant shrinkage of the tumor volume, associated with lower MVD, and provides a promising basis toward further studies and clinical application of rAAV-VAS for cancer therapy.

REFERENCES [1] Pike SE, Yao L, Jones KD, et al. Vasostatin, a calreticulin fragment, inhibits angiogenesis and suppresses tumor growth. J Exp Med, 1998, 188(12): 23492356. [2] Pike SE, Yao L, Setsuda J, et al. Calreticulin and calreticulin fragments are endothelial cell inhibitors that suppress tumor growth. Blood, 1999, 94(7): 24612468. [3] Xiao F, Wei Y, Yang L, et al. A gene therapy for cancer based on the angiogenesis inhibitor, vasostatin. Gene Ther, 2002, 9(18): 12071213. [4] Li L, Yuan YZ, Lu J, et al. Treatment of pancreatic carcinoma by adenoviral mediated gene transfer of vasostatin in mice. Gut, 2006, 55(2): 259265.

Yong Diao et al. / Chinese Journal of Biotechnology, 2008, 24(11): 1949–1954

[5] Liu MH, Imam H, Oberg K, et al. Gene transfer of

factor is necessary, but not sufficient for tumorigenicity of

Vasostatin, a calreticulin fragment, into neuroendocrine

human colorectal carcinoma cells. Proc Natl Acad Sci USA,

tumor cells results in enhanced malignant behavior. [6] Okada F, Rakj J, Croix BT, et al. Impact of oncogenes in tumor

angiogenesis:

Mutant

K-ras

1998, 95(7): 36093614. [7] Li HM, Qiu W, Wang F, et al. Construction and expression

Neuroendocrinology, 2005, 82(1): 110. up-regulation

of

vascular endothelial growth factoryvascular permeability

of

recombinant

adeno-associated

virus

expressing

brain-derived neurotrophic factor. Chin J Biotech, 2008, 24(2): 328332.