Construction and Immunological Characterization of Recombinant Marek's Disease Virus Expressing IBDV VP2 Fusion Protein

CHINESE JOURNAL OF BIOTECHNOLOGY Volume 22, Issue 3, May 2006 Online English edition of the Chinese language journal Cite this article as: Chin J Biotech, 2006, 22(3), 391−396.

RESEARCH PAPER

Construction and Immunological Characterization of Recombinant Marek's Disease Virus Expressing IBDV VP2 Fusion Protein LIU Hong-Mei1,2, QIN Ai-Jian1,*, LIU Yue-Long1, JIN Wen-Jie1, YE Jian-Qiang1, CHEN Hong-Jun1, SHAO Hong-Xia1, LI Ying-Xiao1 1

Key Laboratory of Jiangsu Preventive Veterinary Medicine, Yangzhou University, Yangzhou 225009, China

2

College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China

Abstract: A transfer plasmid vector, pUC18-US10-VP2, was constructed by inserting the gene of enhancer green fluorescent protein (eGFP) fused to VP2 gene of very virulent infectious bursal disease virus (IBDV) JS strain into the US10 fragment of the Marek's disease virus (MDV) CVI988/Rispens. The recombinant virus, designated as rMDV, was developed by co-transfection of CEF with the transfer plasmid vector and simultaneous infection with the CVI988/Rispens virus. The PCR and IFA results indicated that rMDV was stable after 31 passages. Chickens vaccinated with rMDV were protected from challenge with 100 LD50 of IBDV JS. The protection ratios of the chickens vaccinated with the 1 000, 2 000, and 5 000 PFU of the rMDV were 50 %, 60 %, and 80 %, respectively. It was interesting that the average histopathology BF lesion score of the chicken group immunized with 5 000 PFU of rMDV by one-time vaccination was almost the same as that of the chicken group vaccinated with IBDV live vaccine NF8 strain twice (2.0/1.5). There was no difference in protection between the two groups (P > 0.05), but there was significant difference between the groups immunized with 5 000 PFU of rMDV and normal MDV vaccine. This result demonstrated that the rMDV-expressing VP2 fusion protein was one of the most effective vaccine candidates against IBDV in SPF chickens. Key Words: recombinant Marek’s disease virus; CVI988/Rispens; infectious bursal disease virus; VP2; transfer vector; immunological characterization

Infectious bursal disease virus (IBDV) is the aetiological agent of infectious bursal disease (IBD) that causes significant loss in the poultry industries either by causing high mortality or immunodepression in young birds because of the destruction of B lymphocytes that develop in the bursa of Fabricius and play a very important role in the humoral immune response. Vaccination is the principal method for IBD control in chickens. However, most of the intermediate virulent vaccine viruses could induce immunosuppression in the vaccinated flocks. Thus, the safer and more efficacious IBD vaccines need to be studied for IBD control and

eradication. The VP2 protein of IBDV had been identified as the major protective antigen and contained major epitopes responsible for eliciting neutralizing antibodies. Passive antibodies to VP2 could protect chickens from the virus infection. It was also found that the expressed VP2 protein could be used as the subunit vaccine in many expression systems[1–3]. The viral vector system was one of the prospective systems for expressing VP2 protein due to its characterization of subunit vaccine and live vaccine[4–7]. CVI988/Rispens of Marek’s disease virus (MDV), a

Received: October 25, 2005; Accepted: February 10, 2006. This work was supported by the grants from the National High Technology Research and Development Program (No. 863-2002AA245051) and the Foundation for the National Excellent Doctoral Dissertation of China (No. 200256). * Corresponding author. Tel: +86-514-7979217; Fax: +86-514-7972218; E-mail: [email protected] Copyright © 2006, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

vaccine virus, is considered as one of the most potential herpes virus vectors for recombinant live vaccines expressing foreign antigens. The MDV vaccine strains, which are serotypes 1 (MDV1), MDV2, and MDV3 (herpesvirus of turkey [HVT]), had merits as a distinguished vector because: 1) MDV vaccines could overcome the inhibition of maternal antibodies by one-time vaccination and might induce longterm humoral and cellular immunity in the chickens; 2) the viruses had a native host range limited to avian species; 3) techniques for generating recombinant MDV had been well established[8,9]. Recently, many research groups have been developing recombinant polyvalent vaccines on the basis of attenuated MDV1 strains. They previously examined many sites for the insertion of a foreign gene (such as Escherichia coli lacZ gene, enhancer green fluorescent protein (eGFP) gene) into the MDV1 genome by homologous recombination and in the process identified several stable sites for expression of the gene in cultured cells. Of these insertion sites, the US10 site appeared to be the most stable and gave the recombinant virus good immunogenicity[10]. MDV CVI988/Rispens strain belonged to MDV serotype 1, and has been used worldwide as live vaccine against MD since its development. The eGFP was a widely used biological marker; its expression could be detected in living cells under physiological conditions. Visualization of eGFP autofluorescence using fluorescence microscope did disturb the cells expressing eGFP; in addition, eGFP itself was not damaged or exhausted by the detection method. In this study, we constructed recombinant MDV (rMDV) CVI988/Rispens expressing eGFP fused to the IBDV-VP2 under the control of the human cytomegalovirus (CMV) promoter inserted at the US10 site of MDV CVI988/Rispens and tested its protection efficiency against vvIBDV.

1

Materials and methods

1.1 Chickens Specific-pathogen-free (SPF) white leghorn chickens, a day old, were purchased from the SPF Chicken Company (Shandong, China) and reared in negative-pressure isolates. 1.2 Viruses and cells The MDV CVI988/rispens vaccine strain (purchased from Animal Science and Veterinary Medicine Institute in Beijing Academy of Agriculture and Forestry Sciences, China) was used as a parental virus for the construction of recombinant MDV (rMDV). The JS strain of very virulent IBDV (isolated and identified in Key Lab of Jiangsu Preventive Veterinary Medicine, China; LD50 of the virus is 103.6/mL) was used as the challenge virus. Live IBDV commercial vaccine, NF8 strain (immune dosage was 1 000 ELD50 per chicken, purchased from Nanjing Medicine and Appliance Company, China) was used as the control vaccine. Both MDV and

rMDV were cultured in CEF cells prepared from 9-day-old SPF chicken embryos. Dulbecco’s minimum essential medium (DMEM) supplemented with 5 % fetal calf serum and antibiotics was used as the growth medium. The JS strain of IBDV was propagated in SPF chickens. The bursa collected from these infected chickens was ground to extract the RNA of IBDV. 1.3 Amplification and cloning of IBDV VP2 gene IBDV virions were purified from bursa of Fabricius of chickens infected with JS strain following the method described by Azad[1]. Genomic RNA was extracted from purified virions treated with SDS (0.1 %) and proteinase K (100 µg/mL) and was recovered after phenol/chloroform extraction by ethanol precipitation. Complementary DNA (cDNA) was made by reverse transcribing the RNA with reverse primers. The cDNA was subsequently amplified by polymerase chain reaction (PCR) with the high-fidelity DNA polymerase (Promega) and specific primers, which were based on the published sequences of the IBDV genome STC strain. These primers were as follows: forward primer, 5′-TAAGGATCCACGAT CGCAGCGATGACAAACC-3′; reverse primer, 5′-TGGTCT AGATTACCTTAGGGCCCGGATT-3′. The PCR amplification program consisted of 30 cycles (94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min). The PCR products encompassed the entire capsid VP2 open reading frame with a predicted size of 1 371 bp. The purified PCR product was cloned into the pGEM-T-easy-vector (Promega). The plasmid DNA of positive bacterial clone was sequenced by TaKaRa Company (Dalian, China). The VP2 gene was cloned into a eukaryotic expression vector, pcDNA3.1 (Invitrogen) to make plasmid pcDNA3.1-VP2. 1.4 Construction of transfer vector plasmid pUC18US10-VP2 Total MDV DNA was prepared from the MDV CVI988-infected CEF cells as described previously[9] and used as a template to amplify a 1.5-kb and 1.8-kb MDV DNA fragment covering the US10 region and its flanks with two pairs of primers, which were made according to sequence of MDV GA strain[17]. p1 (5′-TCTGAGCTCAGAACCGGTT TGGA ATCGCAG -3′) and p2 (5′-AGCGGATCCCATACCTCTCCAATAT -3′), p3 (5′-AGCGGATCCCATA CCTCTCCAATAT-3′) and p4 (5′GCCAAGCTTCAGAGTCAATGCTACAATGTTCG -3′). The 1.5-kb and 1.8-kb fragments were cloned into a plasmid vector pUC18 (Invitrogen). The insertion vector pUC18-US10 was constructed as shown in Fig. 1. The DNA encoding eGFP gene from pEGFP-N1 (Clontech) was amplified by PCR with primers EGFP-1 (5′-CCTCT AGAAAGCTTGCCACCATGGTGAGCA-3′) and EGFP-2 (5′CCTCTAGATTAGGATCCCTTGTACAGCTCG-3'). The PCR product about 743bp in size was subcloned into the pcDNA3.1-VP2 vector giving rise to plasmid pcDNA3.1eGFP-VP2. By PCR with the primer 1 (5'-TTTGCATGCTTCG

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

CGATGTACGGGCCA-3') and the primer 2 (5'-GTTGCA TGCCATCCCCAGCtTGCCTGCTATTGTCTTCCCAA-3'), the 2.3-kb DNA fragment containing CMV promoter, the putative entire VP2, eGFP gene and the SV40 polyadenylation signal was amplified, and then cloned into the Sph I site in the US10

region of the transfer vector pUC18-US10. The resulting transfer vector plasmid in which the 2.3-kb DNA fragment was flanked by 1.5 kb and 1.8 kb MDV CVI988 DNA sequences was named as pUC18-US10-VP2 (Fig. 1).

Fig. 1 Scheme of construction of plasmid vector for pUC18-US10-VP2

1.5 Transfection and isolation of recombinant MDV CEF cells were grown overnight to 80 %–90 % confluence in a 35-mm petri dish. 2 μg of transfer vector pUC18US10-VP2 DNA was co-transfected by Lipofectin Reagent (Invitrogen) in 200 Plaque Forming Units (PFU) and cells infected with MDV CVI988[11–13]. The transfection and virus infection were completed simultaneously. Four to five days after co-transfection, the positive MDV plaques expressing eGFP were wiped with a small sterile filter paper and observed under fluorescence microscope. The wiped plaques were then digested in 0.05 % trypsin for 3–4 min. The trypsin was inactivated with 50 μL sterile-filtered calf serum. The digested plaque was then transferred to fresh 96-well seeded CEF cells. This recloning process was repeated until all of the plaques formed showed fluorescence. 1.6 Identification of rMDV rMDV and CVI988 strains were grown in CEF. The rMDV DNA was prepared from the rMDV-infected CEF cells with the QIAamp blood Kit (Qiagen, Germany) and used as a template for PCR analysis. The MDV DNA of CVI988infected CEF cells was used for control. The PCR wasperformed as above with the VP2 primer. The PCR products were analyzed in 1 % agarose gel to confirm the presence of the VP2 gene of IBDV in the rMDV. The expression of VP2 protein was identified in CEF cells

infected with rMDV by an indirect immunofluorescence assay (IFA). Briefly, the rMDV-infected CEF cells were fixed with a fixation solution (acetone:ethanol = 2:3) for 5 min; the cells were then rinsed with phosphate-buffered saline (PBS). Anti-VP2 monoclonal antibody (developed by Key Lab of Jiangsu Preventive Veterinary Medicine, China) was added to the fixed rMDV-infected CEF cells. After incubation for 1 h at 37 °C and subsequent washing with PBS, the plates were incubated with rhodamine-conjugated goat anti-mouse IgG (Sigma, 1:100 dilutions with the PBS). With final washing, the stained cells were visualized under a fluorescent microscope at 535-nm light. 1.7 IBDV challenge experiments A day old SPF white leghorn chickens were divided into six groups of 10 chickens each. Groups A–C were vaccinated subcutaneously with the 1 000, 2 000, 5 000 PFU of rMDV at day 1, respectively, whereas Group D was orally vaccinated with 1 000 ELD50 per chicken dosage of live IBD vaccine NF8 strain at 14, 24 days of age according to the recommendation. Both group E immunized with CVI988 vaccine and group F with sterile saline were used as challenge control groups (Table 1). All the chickens were reared in negative-pressure isolates. The chickens were challenged orally with 100 LD50 dose of vvIBDV JS strain at 32 days of age. The clinical signs and mortality were recorded. After completion of the

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

experiment, both the dead and the surviving chickens were subjected to gross examinations of the bursa of Fabricius (BF). Sera for Sandwich ELISA antibodies to IBDV were collected at days 0, 7, 14, 21, 32, and 42. The criterion for protection was that the bursa should have no gross lesion after the challenge.

The plasmid pUC18-US10-VP2 was determined by digestion with BamH I. The results of electrophoresis confirmed that the IBDV-VP2 and eGFP were correctly inserted into the MDV transfer vector pUC18-US10 (Fig. 2).

Table 1 Groups of chickens in experiments Group

Number of chicken

A

10

B

10

C

2

10

D

10

E

10

F

10

Virus and dosage

Immune methods

rMDV 1 000 PFU

subcutaneous

0.1 mL/chicken

injection

rMDV 2 000 PFU

subcutaneous

0.1 mL/chicken

injection

rMDV 5 000 PFU

subcutaneous

0.1 mL/chicken

injection

NF8 live vaccine 1 000 ELD50/chicken

nasal drip

CVI988 1 000 PFU

subcutaneous

0.1 mL/chicken

injection

Fig. 2 Identification of pUC18-US10-VP2 digested with BamH I

subcutaneous

A: 1 kb marker; B: pUC18-US10-VP2.

saline 0.1 mL/chicken

injection

Results

2.1 Construction of recombinant MDV expressing the IBDV VP2 gene The gene encoding eGFP was fused to the 5′-end of the IBDV-VP2 gene, creating a fusion protein-expressing cassette that inserted into the transfer vector pUC18-US10 (Fig. 1).

Purified pUC18-US10-VP2 DNA was co-transfected with MDV CVI988 in CEF cells. After 24 hours, the cells were examined by fluorescence microscope for eGFP expression. When the plaques expressed eGFP transfection post 3–4 days, they were picked out and reseeded in fresh cells. The recombinant virus expressing eGFP was recloned until all the plaques expressed eGFP (Fig. 3). These results confirmed that the rMDV expressing the IBDV-VP2 fused to eGFP was constructed successfully.

Fig. 3 Results of the rMDV in CEF using fluorescence microscope A: fluorescence of rMDV in CEF under fluorescence microscope; B: plaque of rMDV in CEF under normal microscope.

2.2 Expression of IBDV-VP2 in the rMDV-infected CEF cells Insertion of the VP2 expression cassette into the genome of

MDV CVI988 was identified by PCR amplification with the primers of VP2 gene. As shown in Fig. 4, the expected size of the DNA fragment (1.4 kb) was detected from DNA prepared

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

from the first and the thirty-one passages rMDV-infected CEF cells, whereas no band was detected in the CEF cells infected with CVI988 vaccine. The results indicated that the IBDV-VP2 gene controlled by the CMV promoter was stably integrated into the MDV CVI988 genome. The CEF cells infected with rMDV were examined using light microscope for MDV plaques (Fig. 5A) and fluorescence microscope for eGFP autofluorescence after 4 days (Fig. 5B, 490 nm). Thereafter, the cells were fixed, and stained with anti-VP2 monoclonal antibody for IBDV-VP2 expression. The second antibody was rhodamine-conjugated goat anti-mouse IgG. The results showed that all plaques showed red fluorescence (Fig. 5C, 535 nm). The results confirmed that the rMDV expressing eGFP could also express the VP2 protein of IBDV.

Fig. 4 The identification result of VP2 of rMDV by PCR A: 1kb marker; B: rMDV-P1 DNA; C: rMDV-P31 DNA; D: MDV CVI988 DNA.

Fig. 5 Co-expression of eGFP and IBDV-VP2 in rMDV-infected CEF A: the viral plaques of rMDV under light microscope; B: the eGFP expressing cells on 490-nm light under fluorescence microscope; C: the VP2 protein detected by IFA with goat anti-mouse IgG conjugated with rhodamine (535 nm) under fluorescence microscope.

2.3 Evaluation of protecting chickens from IBDV challenge The efficacy of the rMDVs as vaccines against IBDV infection was determined in vaccination and challenge experiments with SPF chickens. Different dosages of immunization were used to determine the level of protecting chickens with the rMDV from challenge and the group was compared with a commercial IBDV vaccine. Antibodies against the IBDV-VP2 protein were detected by Sandwich ELISA (Fig. 6). Protection of rMDV for SPF chickens was examined after IBDV challenge (Table 2). In the experiment, the chickens vaccinated with rMDV or commercial vaccine developed the antibodies against VP2 of IBDV at 7 days post vaccination, whereas the two challenge control groups (Groups E and F) had no anti-IBDV antibodies throughout the experiment. Although the level of the antibodies to VP2 of the chickens vaccinated with rMDV were lower than that of the commercial vaccinated chickens, the

level of the antibodies in the rMDV groups were maintained throughout the experiment, and increased by boost with the challenge. The mortality of the vaccinated rMDV groups with three different immunity doses (1 000 PFU, 2 000 PFU, 5 000 PFU) by one-time vaccination was 50 %, 40 %, and 20 %, respectively, whereas that of the normal control groups immunized with CVI988 or saline was 80 %–90 %. The surviving chickens vaccinated with rMDV or commercial vaccine had no gross lesions of BF after the challenge. In contrast, all the chickens in the two control groups showed severe gross lesions of BF. According to the criterion of protection, the protection ratio of the chickens vaccinated with the 1 0 0 0, 2 000, and 5 000 PFU of the rMDV was 50 %, 60 %, and 80 %, respectively. It was noteworthy that the chickens vaccinated with 5 000 PFU of the rMDV showed higher protective level from IBDV JS strain challenge, compared with the parental CVI988 group

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

(P < 0.01). However, there was no difference between chicken group immunized with 5 000 PFU of rMDV by one-time vaccination and the group that was vaccinated with IBDV live vaccine NF8 strain (P > 0.05) twice.

Fig. 6 Antibody responses of SPF chickens vaccinated with rMDV and commercial IBDV vaccines

3

Discussion

In recent years, many investigators have used biotechnology to express the structural protein VP2 of IBDV in different viral vector systems as subunit vaccines because recombinant viral vector vaccines can induce both anti-viralvectored immunity (MDV, FAV, or FPV) and anti-IBDV immunity[14,15].

Herpesviruses have been used successfully to deliver foreign genes to target cells. The large size of the DNA genome of MDV that contained 160–180 kb allowed for the incorporation of relatively large amounts of foreign DNA. Viral replication in the nucleus made it possible to use a variety of foreign cellular or viral promoters for controlling the expression of the cloned gene and also allowed for the expression of the spliced genes. Thus, MDV was suitable as a vector for the development of a polyvalent live vaccine against poultry diseases. rHVT/rMDV vaccines have been developed for IBDV. An rHVT expressing the VP2 protein of IBDV at the gI site of HVT under the control of CMV immediate-early promoter was constructed. The rHVT conferred 60 % protection against IBDV challenge with 104 PFU dose and 100 % with 105 PFU dose[6]. Similarly, an rMDV expressing the IBDV VP2 antigen at US2 site of MDV under the control of the SV40 promoter was constructed; the rMDV conferred 55 % protection against vvIBDV[9]. Recently, two rHVTs expressing VP2 antigen under the control of CMV promoter or CMV/β chimer promoter (rHVTcmvVP2 and rHVT-pecVP2) were constructed. rHVT-pecVP2 that expressed the VP2 antigen approximately four times more than that expressed byrHVT-cmvVP2 in vitro, induced complete protection against a lethal IBDV challenge in chickens; whereas, rHVT-cmvVP2 induced 58 % protection.

Table 2 Protection of recombinant vaccine for SPF chickens against IBDV challenge Group

A

B

C*

D

E

F

Morbidity

7/10

6/10

3/10

1/10

10/10

10/10

Mortality

5/10

4/10

2/10

0/10

8/10

9/10

BF loss lesions

0/5

0/6

0/8

0/10

2/2

1/1

Protection ratio / %

50

60

80

100

0

0

* Group C and Group E indicate very significant difference (P < 0.01); Group C and Group D indicate no significant difference (P > 0.05). Protection ratio / (%) = (Mortality of unvaccinated rMDV-challenged chickens − Mortality of vaccinated rMDV-challenged chickens) / Mortality of unvaccinated rMDV-challenged chickens ×100 %.

The results indicated that there were several factors that affected the efficacy of the recombinant herpesvirus vaccines: vector virus strains, insertion sites in the vector virus genome, promoters, and host-protective antigens. The MDV CVI-988 was the most effective MD vaccine obtained so far. It was shown that the insertion of a marker gene at the US10 site did not affect the viral replication of the recombinant virus in chickens[10]. Thus, the CVI988 vaccine strain was used as the vector, US10 as the gene insertion sites, CMV as the promoter, and eGFP as the screenable marker to construct the rMDV. In the experiment, the cell-associated nature of MDV

CVI-988 complicated the purification of MDV recombinants, but eGFP as marker gene was convenient for rMDV screening. The transfection method is that the MDV CVI988 virus infection and transfer plasmids DNA transfection was completed simultaneously, namely co-precipitation. By this method, rMDV expressing eGFP fused to the IBDV-VP2 was easily obtained. The co-precipitation method allowed the recombinant virus to be produced early in the replication cycle. As Marshall’s method, the recombinant event occurred early in the replication of the virus population in a given cell. This allowed the recombinant to be present in large numbers in the population to infect a large number of surrounding cells

LIU Hong-Mei et al. / Chinese Journal of Biotechnology, 2006, 22(3): 391–396

without contamination from wild-type virus. It was known that the VP2 was a conformational antigen and intra-cellular localization of VP2 was critical to preserve the native conformational structure of VP2[9]. In the experiment, using IFA of rhodamine-conjugated goat antimouse IgG as secondary antibody, the VP2 protein expressed by rMDV was accumulated in the cells by observing red fluorescence. This observation was in agreement with a previous study[4]. Results of the IBDV challenge experiment showed that the expression of the VP2 protein by rMDV was able to induce production of antibodies against VP2 in chickens and was able to protect most of the vaccinated chickens against mortality. In particular, despite the low levels of the antibodies, the survived chickens were protected completely (no BF lesions). These data also indicated that the rMDV might induce cellular immunity to VP2, which might work effectively for IBDV protection. The level of the antibodies against VP2 in the group immunized with 5 000 PFU of rMDV was lower than that in the groups with conventional live IBDV vaccine before challenge, but the protection level showed no significant difference (P>0.05). One possible reason was that the chickens were vaccinated with the rMDV only once and hence developed better cellular immune response, whereas chickens vaccinated with the commercial live IBDV vaccine were vaccinated twice. Further studies are required to improve the efficacy of the rMDV.

[5]

Sheppard M, Werner W, Tsatas E, et al. Fowl adenovirus recombinant expressing VP2 of infectious bursal disease virus induces protective immunity against bursal disease. Arch Virol, 1998, 143: 915–930.

[6]

Darteil R, Bublot M, Laplace E, et al. Herpesvirus of trudey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induces protection against an IBDV virulent challenge in chickens. Virology, 1995, 211(2): 481–490.

[7]

Tsukamoto K, Saito S, Saeki S, et al. Complete, long-lasting protection against lethal infectious bursal disease virus challenge by a single vaccination with an avian herpesvirus vector expressing VP2 antigens. Journal of Virology, 2002, 7: 5637–5645.

[8]

Witter RL. Increased virulence of Marek's disease virus field

[9]

Tsukamoto K, Kojima C, Komori Y, et al. Protection of

isolates. Avian Dis, 1997, 41: 149–163. chickens against very virulent infectious bursal disease virus (IBDV) and Marek's disease virus (MDV) with a recombinant MDV expressing IBDV VP2. Virology, 1999, 257: 352–362. [10] Sakaguchi M, Hirayama Y, Maeda HK, et al. Construction of recombinant Marek's disease virus type 1 (MDV1) expressing the Escherichia coli lacZ gene as a possible live vaccine vector: the US10 gene of MDV1 as a stable insertion site. Vaccine, 1994, 12: 953–957. [11] Cui ZZ, Qin AJ, Lee LF. Construction of a double-amino acid mutant in 38 kD phosphorylated protein of Marek’s disease virus vaccine strain CVI988. Journal of Shandong Agricultural University, 2000, 31(3): 231–235.

REFERENCES

[12] Cui ZZ, Lee LF. Construction and characterization of pointmutated Marek’s disease virus vaccine strain CVI988

[1]

Azad AA, Jagadish MN, Brownm A, et al. Deletion mapping and expression in Escherichia coli of the large genomic segment of a birnavirus. Virology, 1987, 161: 145–152.

[2]

Jagadish MN, Vaughan PR, Irving RA, et al. Expression and characterization of infectious bursal disease virus polyprotein in yeast. Gene, 1990, 95: 179–186.

[3]

protein. Chinese J Virol, 1999, 15(2): 147–153. [13] Morgan RW, Cantello JL, McDermott CH. Transfection of chicken embryo fibroblasts with Marek’s disease virus DNA. Avian Dis, 1990, 34: 345–351. [14] Liu Y. A review––current option of gene engineered vaccine

Dybing JK, Jackwood DJ. Antigenic and immunogenic

with avian virus vectors. Oversea Veterinary Medicine · Animal

properties of baculovirus expressed infectious disease viral

Husbandry and Poultry Infectious Disease, 1998, 18(4): 13–18.

proteins. Avian Dis, 1998, 42: 80–91. [4]

expressing the virulent epitope on its 38 kD phosphorylated

[15] Tsukamoto K, Sato T, Saito S, et al. Dual-viral vector approach

Heine HG, Boyle DB. Infectious bursal disease virus structural

induced strong and long-lasting protective immunity against

protein VP2 expressed by a fowlpox virus recombinant confers

very virulent infectious bursal disease virus. Virology, 2000,

protection against disease in chickens. Arch Virol, 1993, 131:

269: 257–267.

277–292.