- Email: [email protected]
Construction and characterization of a cDNA library from 4-week-old human embryo
Gene 278 (2001) 141–147 www.elsevier.com/locate/gene
Construction and characterization of a cDNA library from 4-week-old human embryo D.M. Gou a, L.M.C. Chow b, N.Q. Chen a, D.H. Jiang a, W.X. Li a,* a
b
College of Life Sciences, Wuhan University, Wuhan 430072, PR China Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, PR China Received 18 February 2001; received in revised form 11 July 2001; accepted 4 September 2001 Received by R. Di Lauro
Abstract Development and differentiation studies of early human embryos have been severely impeded by general difficulties in obtaining suitable samples. In order to isolate and identify new genes expressed during early human development, we constructed and characterized a PCRbased cDNA library using a 4-week-old chorion-free human embryo. The constructed cDNA library contained 6.3 £ 10 6 directional recombinants, and its insert size ranged from 0.4 to 1.8 kb. The cDNA library proportionally represents the mRNA population, containing b-actin, tPA and LINE1 repetitive sequences at the expected frequencies as in other conventionally constructed and PCR-based cDNA libraries. PCR analyses of the library for specific genes have also revealed the presence of cDNAs for developmentally important genes such as CD59, MCP, Quox-1 and ZNF268. Among the 70 randomly selected cDNA clones, 53% encoded previously known genes, 26% matched with anonymous sequences, and 17% showed no sequence similarity and were designated as human early embryo-specific ESTs. These results demonstrate the sequence complexity and relatively low redundancy of our cDNA library. Furthermore, approximately 40% of those randomly analyzed clones contained full-length encoding regions. To our knowledge, this is the first description of the PCR-based cDNA library from a 4-week-old chorion-free human embryo, and the presence of novel sequences within this library makes it a valuable and unique resource for studying gene expression and regulatory mechanisms that underlie the early process of human embryogenesis. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Embryo development; Reverse transcriptase-polymerase chain reaction; Sequence analysis; Gene expression; Expressed sequence tags
1. Introduction Although the structural genomics studies of the human genome project will shortly provide a complete inventory of human genes, our knowledge of human gene expression still remains at rudimentary levels (Tanaka et al., 2000). Highresolution gene expression studies are most conveniently carried out on the miniaturized tissues of the embryo (Claudio et al., 1998; Huang et al., 1999a; Hwang et al., 1995). However, the analysis of early human embryos has been difficult principally because of their small size and the inaccessibility of human embryonic specimens (Buraczynska et al., 1995). For these reasons, relatively little is known about how this special gene is regulated during the early stages of human embryonic development when the embryo begins to Abbreviations: ESTs, expressed sequence tags; ORF, open reading frame; RT-PCR, reverse transcriptase-polymerase chain reaction * Corresponding author. Tel.: 186-27-87682831; fax: 186-2787882661. E-mail address: [email protected] (W.X. Li).
develop and differentiate. As a result, and because of the evolutionary conservation of many developmentally important genes and developmental pathways, great reliance has been placed on extrapolation from similar studies using animal models, principally the mouse (Daniels et al., 1997; Fougerousse et al., 2000). However, increasing evidence from gene expression studies in human embryos has suggested that there are vital differences between mouse and human development. For example, Wnt7a, a very highly conserved gene known to be important in early development, shows significant differences in spatial and temporal expression patterns in the developing brains of human and mice (Fougerousse et al., 2000). It is therefore necessary to study the human embryos in order to better understand early developmental events in human. To overcome these limitations, we took advantage of the unique access to the early human embryos obtained from therapeutically terminated pregnancies from the Health Center of Hubei Women and Children’s Hospital in China. In this study, we described the construction of a
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00701-6
142
D.M. Gou et al. / Gene 278 (2001) 141–147
cDNA library by reverse transcription and polymerase chain reaction amplification (RT-PCR) from a 4-week-old chorion-free human embryo. A portion of the generated cDNA was directionally cloned into pZero-1 vector and the representativeness of the library was assessed.
2. Materials and methods 2.1. Embryo A 4-week-old human embryo was obtained from therapeutic termination of pregnancy, with appropriate advice and consent, at the Health Center of Hubei Women and Children’s Hospital in China. Great care was taken to remove contaminating chorion surrounding the embryo, and the embryo was frozen immediately in liquid nitrogen after washing with diethylpyrocarbonate (DEPC)-treated PBS.
2.2. Isolation of mRNA The QuickPrep mRNA purification kit (Amersham Pharmacia Biotech) was used for isolation of mRNA directly from the embryo. The eluted mRNA in 0.75 ml DEPCH2O was dried in a cold vacuum and directly used for cDNA synthesis without ethanol precipitation.
2.3. Reverse transcription and cDNA amplification A standard reverse transcription was carried out at 428C for 60 min using SuperscriptII Reverse Transcriptase (Life Technologies, Inc.) with 3 0 -oligo(dT) primer (5 0 -GAGCGGCCGCC(T)12-3 0 ) and 5 0 -SMART oligo (5 0 -TACGGCTGCGAGAAGACGACAGAAGGG-3 0 ). PCR amplification of double-strand cDNAs was performed in a 100 ml reaction containing 10 ml of the first-strand cDNA, 0.5 mM of each 5 0 -SMART primer (5 0 -TACGGCTGCGAGAAGACGACAGAA-3 0 ) and 3 0 -oligo(dT) primer (5 0 GAGCGGCCGCC(T)12-3 0 ) and 2 ml of 50 £ Advantage Polymerase Mix with provided buffer (Clontech, Palo Alto, CA). The cycling conditions consisted of an initial denaturation step at 958C for 1 min followed by 24 cycles of 958C for 15 s and 688C for 5 min using a Perkin-Elmer thermal cycler.
2.4. Size fractionation of cDNA and library construction After blunting the amplified cDNA ends with T4 DNA polymerase, the cDNA was digested with 5 ml of NotI restriction enzyme (10 IU/ml) at 378C overnight, extracted with phenol-chloroform and separated two times on a SizeSep 400 spun column (Amersham Pharmacia Biotech) to collect larger than 400 bp cDNA. Approximately 250 ng of cDNA was ligated into 100 ng of EcoRV-NotI double-digested pZero-1 vector (Invitrogen) and electroporated into TOP10 E. coli electro-competent cells using the Bio-RAD Gene Pulser under standard conditions. To determine the cloning efficiency, 10 and 100 ml of the transformation mix were plated on the Low Salt LB-Zeocin (25 mg/ml) agar plates. 2.5. Library screening and PCR amplification of specific genes To quantify the relative abundance of known transcripts, the library was plated at 5000 colonies/plate and transferred to Hybond nylon membrane in duplicate. The membranes were treated according to the manufacturer’s guidelines. Gel-purified DNA for specific genes to be used as probes (see Section 3 for details of specific probes) was labeled using [a- 32P]dCTP and a Prime-a-Gene w labeling system (Promega). Hybridization was performed as described previously (Gou et al., 2001). Specific PCR was performed in 25 ml reaction mixture containing 20 ng of amplified cDNA sample, 200 mM of each dNTP (Amersham Pharmacia Biotech), 25 pmol of each specific primer, 1 £ PCR buffer with 1.5 mM MgCl2 and 1 unit of Taq DNA polymerase (Promega). Temperature conditions typically consisted of an initial denaturation at 958C for 1 min followed by 35 cycles of denaturation at 958C for 30 s, annealing at 608C for 1 min and elongation at 728C for 1 min, and then a final elongation step at 728C for 10 min. The primer sequences are showed in Table 1. 2.6. Sequencing of cDNA clones Plasmid DNA of 70 randomly picked independent clones was prepared by using a GFX Micro plasmid Prep Kit (Amersham Pharmacia Biotech) and partially sequenced by using a Perkin-Elmer Big-Dye reagent kit with an ABI 310 sequencer and T7 or SP6 primer. Sequence similarity of cDNA was tested against various sequence databases, including the GenBank non-redundant nucleotide library and dbEST (by
Table 1 Oligonucleotide primers used for gene-specific PCR amplification Gene
Sense primer (5 0 –3 0 )
Anti-sense primer (5 0 –3 0 )
CD59 MCP Quox-1 ZNF268 b-Actin
CCGAATTCTGTGGACAATCACAATGG CTGGTCTAGACTTAGGGATGAAGGC CACGGTCAAAATATGAGCTCTTCGTAA GCAGAATAGAGAAAGTCCTAG TCACCAACTGGGACGACATG
CTGGTCTAGACTTAGGGATGAAGGC CAGCTGCATTCATGAGAGTG CTTGTGCTCCTTCTTCCACTTCATCCG AGTTGCGATTTCTTATTGAC TTCGTGGATGCCACAGGACT
D.M. Gou et al. / Gene 278 (2001) 141–147
the BLAST program), accessed through the National Center for Biotechnology Information at the following http server: http://www.ncbi.nlm.nih.gov. Clones whose sequences exhibited similarities to database sequences, with BLASTN scores higher than 200, were operationally classified as an identified group. Subsequently, the DNA sequences of clones other than the identified groups were examined for similarities to non-redundant protein sequences in databases constructed from GenPept, GenPept-upd, PIR, PRF and Switt-Prot, using the BLASTX program mail server at the Human Genome Center. Clones with sequences showing similarities to database sequences, with BLASTX scores higher than 100, were operationally added to the identified groups. DNA sequences that were determined to be unknown by BLAST analysis were subjected to further analysis in the EST database. 3. Results 3.1. Construction of a human embryo cDNA library Using the SMART cDNA synthesis and long-distance PCR (LD-PCR) amplification strategy (Barnes, 1994), a cDNA library was constructed from mRNA of a 4-weekold chorion-free human embryo. The majority of the cDNA produced from LD-PCR was analyzed on a 1.0% agarose gel and a homogeneous smear of PCR product ranging from 200 to 2400 bp in size was observed (Fig. 1A). This PCR product was size-selected by column purification and used in a cloning reaction to establish 6.3 £ 10 6 primary recombinants. To determine the modal insert size, a number of cDNA clones were randomly isolated and inserts were excised by EcoRI and XbaI double digestion. The distribution of the insert length was between 0.4 and 1.8 kb (Fig. 1B). 3.2. Qualitative analysis of the library In conventional cDNA library construction, each clone represents an independent mRNA molecule that has been
143
converted into cDNA. This is not the case for a cDNA library generated by PCR amplification, since it might favor certain sequences over others (Corrick et al., 1996). It was therefore critical to ascertain whether the embryo library we had constructed was proportionally representative of the mRNA population present in the human embryo. To this end, we used three different approaches: (1) we screened the library with a variety of human DNA probes representing abundant and rare mRNAs as well as 18S ribosomal RNA to ensure the quality of the library; (2) the library was tested by PCR with specific primers for the presence of the following genes: CD59, MCP, Quox-1 and ZNF268; and (3) we sequenced a number of randomly selected clones to determine the sequence complexity of the library. The results showed that our library contains 0.24% of bactin clones, corresponding to the published data from several conventionally constructed mouse embryonic cDNA libraries that contain 0.06–2.2% of actin clones (Corrick et al., 1996; Revel et al., 1995). In humans, repetitive elements account for 5% of the genome, and the transposition of LINE-1 and Alu sequences is likely to have occurred during meiosis or in early embryonic development. The clone frequency of human LINE-1 repetitive sequences was present in our library at a frequency of 1.1%, corresponding with a PCR-based human preimplantation embryonic cDNA library (Adjaye et al., 1997). The presence of these repetitive sequences in the cDNA library might be related to instability of transposable elements in embryonic cells (Adjaye et al., 1997). Demonstrating that our library also contains rare transcripts, a low abundant sequence of the tPA gene was detected at a frequency of 0.003% in the screening of 100,000 colonies (Hua and Gou, 1999). This result indicates that rare transcripts expressed only at low levels in early human embryo are also represented in our cDNA library. In addition, there was no detectable contamination of the library with rRNA sequences. One of the primary reasons for constructing cDNA libraries from early human embryos is to clone developmentally important genes. The cDNA library was tested by PCR
Fig. 1. (A) Agarose gel electrophoresis of PCR-amplified cDNA sampler from 4-week-old human embryo. The numbers to the left indicate the position of the DNA size standards (l DNA/HindIII marker, Gibco BRL). (B) cDNA inserts were excised by EcoRI and XbaI double digestion of approximately 2 mg of plasmid DNA from 18 randomly selected clones. The numbers to the left indicate the position of the DNA size standards (1 kb ladder, Gibco BRL).
144
D.M. Gou et al. / Gene 278 (2001) 141–147
Table 2 Summary of EST sequence categories Characterization
No. of clones (%)
Known genes Anonymous sequences Novel ESTs Mitochondrial rRNA Vector only Short insert with long poly(A) Total
37 (53) 18 (26) 12 (17) 0 0 0 3 (4) 70 (100)
with several specific primers. Two primers, amplifying homologous restriction factor CD59 cDNA and membrane cofactor MCP cDNA, were designed and synthesized according to previous reports (Sugita et al., 1988; Lublin et al., 1988). CD59 cDNA (0.42 kb) and MCP cDNA (1.2 kb) with full encoding regions were obtained by PCR amplification from this cDNA library (Huang et al., 1998, 1999b). Quox-1 is a novel homeobox gene isolated from the cDNA library of 5-week-old quail embryo. It is the only gene in the Hox family that has been found to be expressed in both prosencephalon and mesencephalon and involved in the central and peripheral nerve cell differentiation (Xue et al., 1991). Human Quox-1 gene was amplified from this cDNA library by PCR using Quox-1-specific primers (Zhu and Li, unpublished data). Another development-related gene, ZNF268 (Gou et al., 2001), was also detected from this library by PCR using ZNF268-specific primers (Table 1). These results indicate that our cDNA library offers a good source for finding development-specific genes and should be able to contribute to the understanding of human embryogenesis. In order to test the contamination of the genomic DNA, PCR amplification of the cDNA library was performed with primers specific for exon 2 and exon 4 of the b-actin gene (Table 1) (Nakajima-Iijima et al., 1985). The PCR products were separated by electrophoresis in 1.2% agarose gel. As expected, only a 602 bp fragment of b-actin cDNA amplicon was detected from the PCR amplification while the control product of the human genomic fragment (1138 bp) was not present. The result indicated that there is no detectable contamination of genomic DNA sequences within our cDNA library. To further assay the quality of the cDNA library, singlepass sequencing of 70 clones was performed, and the results of BLAST analysis with the combined characterization of all inserts are shown in Table 2. Sequence analysis demonstrated that 96% of the inserts are derived from known genes, anonymous sequences, or novel transcript ESTs. All inserts were cloned directionally and sequencing with the T7 primer revealed the presence of a poly(A 1) stretch at the beginning of each sequence. No clones were found to contain mitochondrial/bacterial rRNA sequences. However, 4% (three of 70) of the clones contained inserts with long poly(A) (.100 bp), but were too short to contain analyzable sequence.
BLAST analysis indicated that 53% of clones contained inserts from 31 different known genes including a number of housekeeping genes, such as gamma-actin, translation initiation factor 2, glutathione S-transferase and several ribosomal proteins. The known genes identified from this library are listed in Table 3. Among them, one clone best matched Chinese hamster sterol regulatory element binding protein (SREBP) cleavage activating protein (SCAP), which is a membrane-bound glycoprotein that regulates the proteolytic activation of SREBPs. The human SCAP partial cDNA sequence was found in this library and its sequence was submitted to GenBank Nucleotide Database under Accession number BG154198. The Dlx3 protein, a putative transcriptional activator that has been implicated during development and differentiation of epithelial tissue (Beanan and Sargent, 2000), was detected by random sequencing of 70 clones. This evidence further supports the potential application of this library in isolating development-related genes. The high frequency (9%) of ribosomal proteins in this library corresponds well with the previous data showing that ribosomal protein mRNAs account for 8–15% of the total mRNA in mouse blastocyst (Corrick et al., 1996). Thus, gene activation and protein synthesis appear to proceed actively at this stage of development. Table 3 Known genes identified from the library Gene name
Accession no.
RNA-helicase p68 Gamma-actin (ACTG1) Ribosomal protein L4 Calumein Ribosomal protein L26 Ras suppressor protein 1 (RSU-1/RSP-1) T-cluster binding protein Translation initiation factor 2 (elF-2-beta) Kinesin-like DNA binding protein Translocon-associated protein TRAP delta Anti-oxidant protein 2 Colony stimulating factor 3 receptor (CSF3R) DLX3 Alpha-1-antitrypsin mRNA Hypothetical protein FLJ20542 Hemoglobin gamma-G (HBG2) NADH dehydrogenase mRNA Small nuclear ribonucleoprotein D2 (SNRPD2) Heat shock 70 kDa protein 1A (HSPA1A) Ribosomal protein S11 Alpha-2 globin (HBA1) Chinese hamster SREBP cleavage activating protein Kallistatin (PI4) Glutaredoxin (grx) GDP dissociation inhibitor 2 (GDI2) Myeloid precursor protein Glutathione S-transferase M2 (GSTM2) Ribosomal protein P1 Human P53-binding protein 2 (TP53BP2) Ribosomal protein S9 Trophinin
AF015812 NM_001614 NM_000968 D45887 XM_008492 L12535 D64015 NM_003908 AB017430 X90583 NM_004905 XM_002205 AF028233 K01396 AK021939 NM_000184 AF092131 NM_004597 NM_005345 X06617 AF097635 U67060 L28101 X76648 NM_001494 D87675 NM_000848 P05386 NM_005426 XM_008957 NM_016157
D.M. Gou et al. / Gene 278 (2001) 141–147
Further sequence analysis indicated that 26% of sequences are derived from anonymous sequences, i.e. sequences reported by ESTs and genomic sequencing projects with no identification or assigned function. Their sequences were submitted to GenBank under Accession numbers BG154170–BG154185, BG154199 and BG154200. Of those, 14 ESTs showed identity or a high degree of similarity to known ESTs that were previously identified in other human cDNA libraries. BG154170 shared a sequence identity with a mouse EST (AW046572), and the other three ESTs best matched sequences previously deposited in the GenBank only by the genomic sequencing projects. Thus, contributions from our EST sequences may provide useful information in determining open reading frames (ORFs) within the respective genomic clones. Finally, there are 12 clones (17%) for which no significant similarities are found in the current database. These novel genes were therefore designated as human early embryospecific ESTs and their sequences were deposited in GenBank under Accession numbers BG154186–BG154197. The extent of redundancy in clones originating from known genes, ESTs and novel sequences was also determined. Five known genes were identified more than once. HBG2 was isolated three times whereas heat shock 70 kDa, ribosomal protein S11, translation initiation factor 2 and HBA1 were each identified twice. There was very little redundancy of ESTs, as only one EST sequence was identified twice. These results demonstrate the sequence complexity and relatively low redundancy of this library. Another particularly important criterion for defining the quality of a cDNA library is the percentage of the clones with full ORF. Of 31 known genes, 20 clones were sequenced from the 5 0 -end of cDNAs. We found eight clones (including calumein, ribosomal protein L26, eIF-2beta, TRAP delta, HBG2, HBA1, ribosomal protein L11 and GSTM2) that had the first ATG codon of the ORF. Thus, we concluded that 40% of the clones in our library contain full encoding regions. In addition, all of those clones corresponding to known genes do not contain introns within their cDNA sequences, further demonstrating that the nucleic acid used for oligo(dT)-initiated RT was mRNA and not contaminating genomic DNA.
4. Discussion A rapidly growing area of genome research is the generation of ESTs in which randomly selected cDNA clones are partially sequenced (Ko et al., 2000). The identification and sequencing of human cDNA sequences play a synergistic role to complete genome determination and represent a direct link to functional genomics (Adams et al., 1992). In particular, cDNA sequences greatly aid exon identification and are essential for the determination of tissue- and pathologyspecific exon usage in the form of alternatively spliced variants. Furthermore, repeated partial sequencing of EST
145
has proved a powerful tool for identification of genetic polymorphisms and for determination of differential gene expression (Dias Neto et al., 2000). However, the integrity of the data and the place at which novel sequences can be identified largely depend on the specific cDNA libraries. cDNA libraries therefore play an indispensable role in the isolation and characterization of mammalian genes (Liew et al., 1997). To date, the single-pass partial sequencing technique has led to the production of more than 3,100,000 ESTs isolated from more than 300 cDNA libraries that represent a wide variety of human tissues at several different developmental stages (Okubo et al., 1992; Sudo et al., 1994; Yang et al., 1996). However, the analysis of early human embryos has been difficult, principally because of their small size and the inaccessibility of human embryonic specimens (Jay et al., 1997). Nonetheless, a considerable body of information has accumulated about the biochemistry of the earliest stages of human development (Adjaye et al., 1997). We know very little, however, about the genetic systems involved in the differentiation processes in early human development. In this regard, the availability of early human embryo cDNA libraries would circumvent these difficulties and facilitate the study of expression of known genes and allow for the isolation and identification of novel development-related genes. Jay et al. (1997) constructed a 5–6-week-old human embryo cDNA library and identified 53 novel genes. Adjaye et al. (1997, 1999) constructed cDNA libraries from human oocytes, and from four-cell, seven-cell and blastocyst-stage embryos. To acquire earlier stages of human embryo cDNA library, we constructed 3-, 4- and 5-week-old human embryo cDNA libraries (Gou et al., 1999). However, those original libraries contained a high proportion of cDNA colonies restricted to the genes expressed in chorionic tissues. In this paper, we described a new improved method for producing a cDNA library from a 4-week-old human embryo without the contamination of chorion. The important feature of the present work is the use of SMART PCR to construct a cDNA library from a very limited amount of mRNA. The use of the SMART primer tags the 5 0 -end of the first-strand cDNAs and enables PCR amplification of the cDNAs towards their 5 0 -ends and eliminates the need for conventional second-strand cDNA synthesis and troublesome time-consuming adaptor ligation prior to cloning to an appropriate vector. Using the described methodology, we constructed a cDNA library with insert sizes ranging from 0.4 to 1.8 kb. The complexities of the library are over 6.3 £ 10 6 and we may expect that the library is fully representative of genes transcribed in the embryonic stage, given that the human genome is estimated to consist of about 35,000 genes. Even though PCR allows the synthesis of cDNA libraries from a very small amount of RNA, employing PCR has some disadvantages, such as a high mutation rate and difficulty in amplifying long DNA. However, the introduction of the LDPCR method greatly improved both the fidelity of the reaction and the length of PCR products (Barnes, 1994). Fig. 1
146
D.M. Gou et al. / Gene 278 (2001) 141–147
shows that most of the cDNA inserts range from 0.4 kb to 1.8 kb in size, similar to the inserts of most cDNA libraries made by non-PCR methods. Based on 5 0 -end sequencing results, we estimate that approximately 35% of clones in this library have full-length ORF, demonstrating the high quality of the SMART PCR-based cDNA library. Another disadvantage of PCR is the preferential amplification of one sequence over another. Library screening with a variety of human DNA probes suggests that the abundance of most genes remained at the initial level and also shows that even rare transcripts can be detected from this library. Specific PCR amplification implies that the library is indeed a good resource for finding development-specific genes. Additionally, we also chose to characterize this library by sequencing a number of randomly selected independent clones. This proved to be a quick and efficient approach to assess library quality, for the quality of the data generated by the ESTs project is determined by the quality of the used library (Peterson et al., 1998). All analyzable clones were derived from known genes, anonymous ESTs, or novel ESTs, with no clones containing bacterial, rRNA, mitochondrial, or vector-only sequences. In addition, no chimeric clones were found with the sequence that we were able to analyze. Moreover, one noticeable feature of this library is the high ratio of novel sequences. In conclusion, we constructed a LD-PCR-amplified cDNA library from a 4-week-old chorion-free human embryo. This is, to our knowledge, the first description of a PCR-based cDNA library from a 4-week-old human embryo. The results show that the library contains clones for several mRNAs at expected frequencies. The demonstration of specific transcripts (CD59, MCP, Quox-1 and ZNF268) and novel sequences within this library makes it a valuable resource with high sequence complexity for studying gene expression and regulatory mechanisms in 4week-old embryos. Queries regarding the use of the library should be directed to Dr Wen-xin Li.
Acknowledgements We acknowledge the invaluable contribution of the Health Center of Hubei Women and Children’s Hospital which provided therapeutically terminated human embryo. This work was supported by grants from the National Natural Science Foundation of China to D.M. Gou (No. 39900082), from the Wuhan High-Tech Program to W.X. Li and D.M. Gou (No. 996005123G) and from the Zi-Qiang Foundation of Wuhan University to D.M. Gou.
References Adams, M.D., Dubnick, M., Kerlavage, A.R., Moreno, R., Kelley, J.M., Utterback, T.R., Nagle, J.W., Fields, C., Venter, J.C., 1992. Sequence identification of 2,375 human brain genes. Nature 355, 632–634.
Adjaye, J., Daniels, R., Bolton, V., Monk, M., 1997. cDNA libraries from single human preimplantation embryos. Genomics 46, 337–344. Adjaye, J., Bolton, V., Monk, M., 1999. Developmental expression of specific genes detected in high-quality cDNA libraries from single human preimplantation embryos. Gene 237, 373–383. Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220. Beanan, M.J., Sargent, T.D., 2000. Regulation and function of Dlx3 in vertebrate development. Dev. Dyn. 218, 545–553. Buraczynska, M.J., Van Keuren, M.L., Buraczynska, K.M., Chang, Y.S., Crombez, E., Kurnit, D.M., 1995. Construction of human embryonic cDNA libraries: HD, PKD1 and BRCA1 are transcribed widely during embryogenesis. Cytogenet. Cell Genet. 71, 197–202. Claudio, J.O., Liew, C.C., Dempsey, A.A., Cukerman, E., Stewart, A.K., Na, E., Atkins, H.L., Iscove, N.N., Hawley, R.G., 1998. Identification of sequence-tagged transcripts differentially expressed within the human hematopoietic hierarchy. Genomics 50, 44–52. Corrick, C.M., Silvestro, M.J., Lahoud, M.H., Allen, G.J., Tymms, M.J., Kola, I., 1996. Construction of a mouse blastocyst cDNA library by PCR amplification from total RNA. Mol. Reprod. Dev. 43, 7–16. Daniels, R., Lowell, S., Bolton, V., Monk, M., 1997. Transcription of tissue-specific genes in human preimplantation embryos. Hum. Reprod. 12, 2251–2256. Dias Neto, E., Garcia Correa, R., Verjovski-Almeida, S., Briones, M.R., Nagai, M.A., da Silva, W., Zago, M.A., Bordin, S., Costa, F.F., Goldman, G.H., Carvalho, A.F., Matsukuma, A., Baia, G.S., Simpson, D.H., Brunstein, A., de Oliveira, P.S., Bucher, P., Jongeneel, C.V., O’Hare, M.J., Soares, F., Brentani, R.R., Reis, L.F., de Souza, S.J., Simpson, A.J., 2000. Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. Proc. Natl. Acad. Sci. USA 97, 3491–3496. Fougerousse, F., Bullen, P., Herasse, M., Lindsay, S., Richard, I., Wilson, D., Suel, L., Durand, M., Robson, S., Abitbol, M., Beckmann, J.S., Strachan, T., 2000. Human-mouse differences in the embryonic expression patterns of developmental control genes and disease genes. Hum. Mol. Genet. 9, 165–173. Gou, D.M., Huang, J., Li, W.X., Mao, X., Jiang, D.H., Hua, W.J., Fan, J.H., 1999. Construction of early human cDNA libraries and screening objective genes. Acta Biochim. Biophys. Sinica 31, 643–647. Gou, D.M., Sun, Y., Gao, L., Chow, L.C., Huang, J., Feng, Y.D., Jiang, D.H., Li, W.X., 2001. Cloning and characterization of a novel Kruppellike zinc finger gene, ZNF268, expressed in early human embryo. Biochim. Biophys. Acta 1518, 306–310. Hua, W.J., Gou, D.M., 1999. Screening full-length cDNA clone of tPA gene from human early stage embryo. Biotechnology 9, 1–3. Huang, G.M., Ng, W.L., Farkas, J., He, L., Liang, H.A., Gordon, D., Yu, J., Hood, L., 1999a. Prostate cancer expression profiling by cDNA sequencing analysis. Genomics 59, 178–186. Huang, J., Gou, D.M., Zhen, C.Y., Xia, Z.P., Jiang, D.H., Li, W.X., 1998. Cloning, sequencing and expressing of Chinese CD59 cDNA. J. Wuhan Univ. (Natural Science Edition) 44, 773–776. Huang, J., Li, W.X., Gou, D.M., Xia, Z.P., Jiang, D.H., 1999b. Cloning, sequencing of human membrane cofactor protein (MCP) and comparison with other isoforms. Prog. Biochem. Biophys. 26, 355–358. Hwang, D.M., Fung, Y.W., Wang, R.X., Laurenssen, C.M., Ng, S.H., Lam, W.Y., Tsui, K.W., Fung, K.P., Waye, M., Lee, C.Y., 1995. Analysis of expressed sequence tags from a fetal human heart cDNA library. Genomics 30, 293–298. Jay, P., Diriong, S., Taviaux, S., Roeckel, N., Mattei, M.G., Audit, M., Berge-Lefranc, J.L., Fontes, M., Berta, P., 1997. Isolation and regional mapping of cDNAs expressed during early human development. Genomics 39, 104–108. Ko, M.S., Kitchen, J.R., Wang, X., Threat, T.A., Hasegawa, A., Sun, T., Grahovac, M.J., Kargul, G.J., Lim, M.K., Cui, Y., Sano, Y., Tanaka, T., Liang, Y., Mason, S., Paonessa, P.D., Sauls, A.D., DePalma, G.E., Sharara, R., Rowe, L.B., Eppig, J., Morrell, C., Doi, H., 2000. Large-
D.M. Gou et al. / Gene 278 (2001) 141–147 scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development. Development 127, 1737–1749. Liew, C.C., Hwang, D.M., Wang, R.X., Ng, S.H., Dempsey, A., Wen, D.H., Ma, H., Cukerman, E., Zhao, X.G., Liu, Y.Q., Qiu, X.K., Zhou, X.M., Gu, J.R., Tsui, S., Fung, K.P., Waye, M.M., Lee, C.Y., 1997. Construction of a human heart cDNA library and identification of cardiovascular based genes (CVBest). Mol. Cell. Biochem. 172, 81–87. Lublin, D.M., Liszewski, M.K., Post, T.W., Arce, M.A., Le Beau, M.M., Rebentisch, M.B., Lemons, L.S., Seya, T., Atkinson, J.P., 1988. Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168, 181–194. Nakajima-Iijima, S., Hamada, H., Reddy, P., Kakunaga, T., 1985. Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns. Proc. Natl. Acad. Sci. USA 82, 6133–6137. Okubo, K., Hori, N., Matoba, R., Niiyama, T., Fukushima, A., Kojima, Y., Matsubara, K., 1992. Large scale cDNA sequencing for analysis of quantitative and qualitative aspects of gene expression. Nat. Genet. 2, 173–179. Peterson, L.A., Brown, M.R., Carlisle, A.J., Kohn, E.C., Liotta, L.A., Emmert-Buck, M.R., Krizman, D.B., 1998. An improved method for
147
construction of directionally cloned cDNA libraries from microdissected cells. Cancer Res. 58, 5326–5328. Revel, F., Renard, J.P., Duranthon, V., 1995. PCR-generated cDNA libraries from reduced numbers of mouse oocytes. Zygote 3, 241–250. Sudo, K., Chinen, K., Nakamura, Y., 1994. 2058 expressed sequence tags (ESTs) from a human fetal lung cDNA library. Genomics 24, 276–279. Sugita, Y., Nakano, Y., Tomita, M., 1988. Isolation from human erythrocytes of a new membrane protein which inhibits the formation of complement transmembrane channels. J. Biochem. 104, 633–637. Tanaka, T.S., Jaradat, S.A., Lim, M.K., Kargul, G.J., Wang, X., Grahovac, M.J., Pantano, S., Sano, Y., Piao, Y., Nagaraja, R., Doi, H., Wood, W.H., Becker, K.G., Ko, M.S., 2000. Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray. Proc. Natl. Acad. Sci. USA 97, 9127– 9132. Xue, Z.G., Gehring, W.J., Le Douarin, N.M., 1991. Quox-1, a quail-homeobox gene expressed in the embryonic nervous system, including the forebrain. Proc. Natl. Acad. Sci. USA 88, 2427–2431. Yang, Y., Peterson, K.R., Stamatoyannopoulos, G., Papayannopoulou, T., 1996. Human CD34 1 cell EST database: single-pass sequencing of 402 clones from a directional cDNA library. Exp. Hematol. 24, 605– 612.
Construction and characterization of a cDNA library from 4-week-old human embryo D.M. Gou a, L.M.C. Chow b, N.Q. Chen a, D.H. Jiang a, W.X. Li a,* a
b
College of Life Sciences, Wuhan University, Wuhan 430072, PR China Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, PR China Received 18 February 2001; received in revised form 11 July 2001; accepted 4 September 2001 Received by R. Di Lauro
Abstract Development and differentiation studies of early human embryos have been severely impeded by general difficulties in obtaining suitable samples. In order to isolate and identify new genes expressed during early human development, we constructed and characterized a PCRbased cDNA library using a 4-week-old chorion-free human embryo. The constructed cDNA library contained 6.3 £ 10 6 directional recombinants, and its insert size ranged from 0.4 to 1.8 kb. The cDNA library proportionally represents the mRNA population, containing b-actin, tPA and LINE1 repetitive sequences at the expected frequencies as in other conventionally constructed and PCR-based cDNA libraries. PCR analyses of the library for specific genes have also revealed the presence of cDNAs for developmentally important genes such as CD59, MCP, Quox-1 and ZNF268. Among the 70 randomly selected cDNA clones, 53% encoded previously known genes, 26% matched with anonymous sequences, and 17% showed no sequence similarity and were designated as human early embryo-specific ESTs. These results demonstrate the sequence complexity and relatively low redundancy of our cDNA library. Furthermore, approximately 40% of those randomly analyzed clones contained full-length encoding regions. To our knowledge, this is the first description of the PCR-based cDNA library from a 4-week-old chorion-free human embryo, and the presence of novel sequences within this library makes it a valuable and unique resource for studying gene expression and regulatory mechanisms that underlie the early process of human embryogenesis. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Embryo development; Reverse transcriptase-polymerase chain reaction; Sequence analysis; Gene expression; Expressed sequence tags
1. Introduction Although the structural genomics studies of the human genome project will shortly provide a complete inventory of human genes, our knowledge of human gene expression still remains at rudimentary levels (Tanaka et al., 2000). Highresolution gene expression studies are most conveniently carried out on the miniaturized tissues of the embryo (Claudio et al., 1998; Huang et al., 1999a; Hwang et al., 1995). However, the analysis of early human embryos has been difficult principally because of their small size and the inaccessibility of human embryonic specimens (Buraczynska et al., 1995). For these reasons, relatively little is known about how this special gene is regulated during the early stages of human embryonic development when the embryo begins to Abbreviations: ESTs, expressed sequence tags; ORF, open reading frame; RT-PCR, reverse transcriptase-polymerase chain reaction * Corresponding author. Tel.: 186-27-87682831; fax: 186-2787882661. E-mail address: [email protected] (W.X. Li).
develop and differentiate. As a result, and because of the evolutionary conservation of many developmentally important genes and developmental pathways, great reliance has been placed on extrapolation from similar studies using animal models, principally the mouse (Daniels et al., 1997; Fougerousse et al., 2000). However, increasing evidence from gene expression studies in human embryos has suggested that there are vital differences between mouse and human development. For example, Wnt7a, a very highly conserved gene known to be important in early development, shows significant differences in spatial and temporal expression patterns in the developing brains of human and mice (Fougerousse et al., 2000). It is therefore necessary to study the human embryos in order to better understand early developmental events in human. To overcome these limitations, we took advantage of the unique access to the early human embryos obtained from therapeutically terminated pregnancies from the Health Center of Hubei Women and Children’s Hospital in China. In this study, we described the construction of a
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00701-6
142
D.M. Gou et al. / Gene 278 (2001) 141–147
cDNA library by reverse transcription and polymerase chain reaction amplification (RT-PCR) from a 4-week-old chorion-free human embryo. A portion of the generated cDNA was directionally cloned into pZero-1 vector and the representativeness of the library was assessed.
2. Materials and methods 2.1. Embryo A 4-week-old human embryo was obtained from therapeutic termination of pregnancy, with appropriate advice and consent, at the Health Center of Hubei Women and Children’s Hospital in China. Great care was taken to remove contaminating chorion surrounding the embryo, and the embryo was frozen immediately in liquid nitrogen after washing with diethylpyrocarbonate (DEPC)-treated PBS.
2.2. Isolation of mRNA The QuickPrep mRNA purification kit (Amersham Pharmacia Biotech) was used for isolation of mRNA directly from the embryo. The eluted mRNA in 0.75 ml DEPCH2O was dried in a cold vacuum and directly used for cDNA synthesis without ethanol precipitation.
2.3. Reverse transcription and cDNA amplification A standard reverse transcription was carried out at 428C for 60 min using SuperscriptII Reverse Transcriptase (Life Technologies, Inc.) with 3 0 -oligo(dT) primer (5 0 -GAGCGGCCGCC(T)12-3 0 ) and 5 0 -SMART oligo (5 0 -TACGGCTGCGAGAAGACGACAGAAGGG-3 0 ). PCR amplification of double-strand cDNAs was performed in a 100 ml reaction containing 10 ml of the first-strand cDNA, 0.5 mM of each 5 0 -SMART primer (5 0 -TACGGCTGCGAGAAGACGACAGAA-3 0 ) and 3 0 -oligo(dT) primer (5 0 GAGCGGCCGCC(T)12-3 0 ) and 2 ml of 50 £ Advantage Polymerase Mix with provided buffer (Clontech, Palo Alto, CA). The cycling conditions consisted of an initial denaturation step at 958C for 1 min followed by 24 cycles of 958C for 15 s and 688C for 5 min using a Perkin-Elmer thermal cycler.
2.4. Size fractionation of cDNA and library construction After blunting the amplified cDNA ends with T4 DNA polymerase, the cDNA was digested with 5 ml of NotI restriction enzyme (10 IU/ml) at 378C overnight, extracted with phenol-chloroform and separated two times on a SizeSep 400 spun column (Amersham Pharmacia Biotech) to collect larger than 400 bp cDNA. Approximately 250 ng of cDNA was ligated into 100 ng of EcoRV-NotI double-digested pZero-1 vector (Invitrogen) and electroporated into TOP10 E. coli electro-competent cells using the Bio-RAD Gene Pulser under standard conditions. To determine the cloning efficiency, 10 and 100 ml of the transformation mix were plated on the Low Salt LB-Zeocin (25 mg/ml) agar plates. 2.5. Library screening and PCR amplification of specific genes To quantify the relative abundance of known transcripts, the library was plated at 5000 colonies/plate and transferred to Hybond nylon membrane in duplicate. The membranes were treated according to the manufacturer’s guidelines. Gel-purified DNA for specific genes to be used as probes (see Section 3 for details of specific probes) was labeled using [a- 32P]dCTP and a Prime-a-Gene w labeling system (Promega). Hybridization was performed as described previously (Gou et al., 2001). Specific PCR was performed in 25 ml reaction mixture containing 20 ng of amplified cDNA sample, 200 mM of each dNTP (Amersham Pharmacia Biotech), 25 pmol of each specific primer, 1 £ PCR buffer with 1.5 mM MgCl2 and 1 unit of Taq DNA polymerase (Promega). Temperature conditions typically consisted of an initial denaturation at 958C for 1 min followed by 35 cycles of denaturation at 958C for 30 s, annealing at 608C for 1 min and elongation at 728C for 1 min, and then a final elongation step at 728C for 10 min. The primer sequences are showed in Table 1. 2.6. Sequencing of cDNA clones Plasmid DNA of 70 randomly picked independent clones was prepared by using a GFX Micro plasmid Prep Kit (Amersham Pharmacia Biotech) and partially sequenced by using a Perkin-Elmer Big-Dye reagent kit with an ABI 310 sequencer and T7 or SP6 primer. Sequence similarity of cDNA was tested against various sequence databases, including the GenBank non-redundant nucleotide library and dbEST (by
Table 1 Oligonucleotide primers used for gene-specific PCR amplification Gene
Sense primer (5 0 –3 0 )
Anti-sense primer (5 0 –3 0 )
CD59 MCP Quox-1 ZNF268 b-Actin
CCGAATTCTGTGGACAATCACAATGG CTGGTCTAGACTTAGGGATGAAGGC CACGGTCAAAATATGAGCTCTTCGTAA GCAGAATAGAGAAAGTCCTAG TCACCAACTGGGACGACATG
CTGGTCTAGACTTAGGGATGAAGGC CAGCTGCATTCATGAGAGTG CTTGTGCTCCTTCTTCCACTTCATCCG AGTTGCGATTTCTTATTGAC TTCGTGGATGCCACAGGACT
D.M. Gou et al. / Gene 278 (2001) 141–147
the BLAST program), accessed through the National Center for Biotechnology Information at the following http server: http://www.ncbi.nlm.nih.gov. Clones whose sequences exhibited similarities to database sequences, with BLASTN scores higher than 200, were operationally classified as an identified group. Subsequently, the DNA sequences of clones other than the identified groups were examined for similarities to non-redundant protein sequences in databases constructed from GenPept, GenPept-upd, PIR, PRF and Switt-Prot, using the BLASTX program mail server at the Human Genome Center. Clones with sequences showing similarities to database sequences, with BLASTX scores higher than 100, were operationally added to the identified groups. DNA sequences that were determined to be unknown by BLAST analysis were subjected to further analysis in the EST database. 3. Results 3.1. Construction of a human embryo cDNA library Using the SMART cDNA synthesis and long-distance PCR (LD-PCR) amplification strategy (Barnes, 1994), a cDNA library was constructed from mRNA of a 4-weekold chorion-free human embryo. The majority of the cDNA produced from LD-PCR was analyzed on a 1.0% agarose gel and a homogeneous smear of PCR product ranging from 200 to 2400 bp in size was observed (Fig. 1A). This PCR product was size-selected by column purification and used in a cloning reaction to establish 6.3 £ 10 6 primary recombinants. To determine the modal insert size, a number of cDNA clones were randomly isolated and inserts were excised by EcoRI and XbaI double digestion. The distribution of the insert length was between 0.4 and 1.8 kb (Fig. 1B). 3.2. Qualitative analysis of the library In conventional cDNA library construction, each clone represents an independent mRNA molecule that has been
143
converted into cDNA. This is not the case for a cDNA library generated by PCR amplification, since it might favor certain sequences over others (Corrick et al., 1996). It was therefore critical to ascertain whether the embryo library we had constructed was proportionally representative of the mRNA population present in the human embryo. To this end, we used three different approaches: (1) we screened the library with a variety of human DNA probes representing abundant and rare mRNAs as well as 18S ribosomal RNA to ensure the quality of the library; (2) the library was tested by PCR with specific primers for the presence of the following genes: CD59, MCP, Quox-1 and ZNF268; and (3) we sequenced a number of randomly selected clones to determine the sequence complexity of the library. The results showed that our library contains 0.24% of bactin clones, corresponding to the published data from several conventionally constructed mouse embryonic cDNA libraries that contain 0.06–2.2% of actin clones (Corrick et al., 1996; Revel et al., 1995). In humans, repetitive elements account for 5% of the genome, and the transposition of LINE-1 and Alu sequences is likely to have occurred during meiosis or in early embryonic development. The clone frequency of human LINE-1 repetitive sequences was present in our library at a frequency of 1.1%, corresponding with a PCR-based human preimplantation embryonic cDNA library (Adjaye et al., 1997). The presence of these repetitive sequences in the cDNA library might be related to instability of transposable elements in embryonic cells (Adjaye et al., 1997). Demonstrating that our library also contains rare transcripts, a low abundant sequence of the tPA gene was detected at a frequency of 0.003% in the screening of 100,000 colonies (Hua and Gou, 1999). This result indicates that rare transcripts expressed only at low levels in early human embryo are also represented in our cDNA library. In addition, there was no detectable contamination of the library with rRNA sequences. One of the primary reasons for constructing cDNA libraries from early human embryos is to clone developmentally important genes. The cDNA library was tested by PCR
Fig. 1. (A) Agarose gel electrophoresis of PCR-amplified cDNA sampler from 4-week-old human embryo. The numbers to the left indicate the position of the DNA size standards (l DNA/HindIII marker, Gibco BRL). (B) cDNA inserts were excised by EcoRI and XbaI double digestion of approximately 2 mg of plasmid DNA from 18 randomly selected clones. The numbers to the left indicate the position of the DNA size standards (1 kb ladder, Gibco BRL).
144
D.M. Gou et al. / Gene 278 (2001) 141–147
Table 2 Summary of EST sequence categories Characterization
No. of clones (%)
Known genes Anonymous sequences Novel ESTs Mitochondrial rRNA Vector only Short insert with long poly(A) Total
37 (53) 18 (26) 12 (17) 0 0 0 3 (4) 70 (100)
with several specific primers. Two primers, amplifying homologous restriction factor CD59 cDNA and membrane cofactor MCP cDNA, were designed and synthesized according to previous reports (Sugita et al., 1988; Lublin et al., 1988). CD59 cDNA (0.42 kb) and MCP cDNA (1.2 kb) with full encoding regions were obtained by PCR amplification from this cDNA library (Huang et al., 1998, 1999b). Quox-1 is a novel homeobox gene isolated from the cDNA library of 5-week-old quail embryo. It is the only gene in the Hox family that has been found to be expressed in both prosencephalon and mesencephalon and involved in the central and peripheral nerve cell differentiation (Xue et al., 1991). Human Quox-1 gene was amplified from this cDNA library by PCR using Quox-1-specific primers (Zhu and Li, unpublished data). Another development-related gene, ZNF268 (Gou et al., 2001), was also detected from this library by PCR using ZNF268-specific primers (Table 1). These results indicate that our cDNA library offers a good source for finding development-specific genes and should be able to contribute to the understanding of human embryogenesis. In order to test the contamination of the genomic DNA, PCR amplification of the cDNA library was performed with primers specific for exon 2 and exon 4 of the b-actin gene (Table 1) (Nakajima-Iijima et al., 1985). The PCR products were separated by electrophoresis in 1.2% agarose gel. As expected, only a 602 bp fragment of b-actin cDNA amplicon was detected from the PCR amplification while the control product of the human genomic fragment (1138 bp) was not present. The result indicated that there is no detectable contamination of genomic DNA sequences within our cDNA library. To further assay the quality of the cDNA library, singlepass sequencing of 70 clones was performed, and the results of BLAST analysis with the combined characterization of all inserts are shown in Table 2. Sequence analysis demonstrated that 96% of the inserts are derived from known genes, anonymous sequences, or novel transcript ESTs. All inserts were cloned directionally and sequencing with the T7 primer revealed the presence of a poly(A 1) stretch at the beginning of each sequence. No clones were found to contain mitochondrial/bacterial rRNA sequences. However, 4% (three of 70) of the clones contained inserts with long poly(A) (.100 bp), but were too short to contain analyzable sequence.
BLAST analysis indicated that 53% of clones contained inserts from 31 different known genes including a number of housekeeping genes, such as gamma-actin, translation initiation factor 2, glutathione S-transferase and several ribosomal proteins. The known genes identified from this library are listed in Table 3. Among them, one clone best matched Chinese hamster sterol regulatory element binding protein (SREBP) cleavage activating protein (SCAP), which is a membrane-bound glycoprotein that regulates the proteolytic activation of SREBPs. The human SCAP partial cDNA sequence was found in this library and its sequence was submitted to GenBank Nucleotide Database under Accession number BG154198. The Dlx3 protein, a putative transcriptional activator that has been implicated during development and differentiation of epithelial tissue (Beanan and Sargent, 2000), was detected by random sequencing of 70 clones. This evidence further supports the potential application of this library in isolating development-related genes. The high frequency (9%) of ribosomal proteins in this library corresponds well with the previous data showing that ribosomal protein mRNAs account for 8–15% of the total mRNA in mouse blastocyst (Corrick et al., 1996). Thus, gene activation and protein synthesis appear to proceed actively at this stage of development. Table 3 Known genes identified from the library Gene name
Accession no.
RNA-helicase p68 Gamma-actin (ACTG1) Ribosomal protein L4 Calumein Ribosomal protein L26 Ras suppressor protein 1 (RSU-1/RSP-1) T-cluster binding protein Translation initiation factor 2 (elF-2-beta) Kinesin-like DNA binding protein Translocon-associated protein TRAP delta Anti-oxidant protein 2 Colony stimulating factor 3 receptor (CSF3R) DLX3 Alpha-1-antitrypsin mRNA Hypothetical protein FLJ20542 Hemoglobin gamma-G (HBG2) NADH dehydrogenase mRNA Small nuclear ribonucleoprotein D2 (SNRPD2) Heat shock 70 kDa protein 1A (HSPA1A) Ribosomal protein S11 Alpha-2 globin (HBA1) Chinese hamster SREBP cleavage activating protein Kallistatin (PI4) Glutaredoxin (grx) GDP dissociation inhibitor 2 (GDI2) Myeloid precursor protein Glutathione S-transferase M2 (GSTM2) Ribosomal protein P1 Human P53-binding protein 2 (TP53BP2) Ribosomal protein S9 Trophinin
AF015812 NM_001614 NM_000968 D45887 XM_008492 L12535 D64015 NM_003908 AB017430 X90583 NM_004905 XM_002205 AF028233 K01396 AK021939 NM_000184 AF092131 NM_004597 NM_005345 X06617 AF097635 U67060 L28101 X76648 NM_001494 D87675 NM_000848 P05386 NM_005426 XM_008957 NM_016157
D.M. Gou et al. / Gene 278 (2001) 141–147
Further sequence analysis indicated that 26% of sequences are derived from anonymous sequences, i.e. sequences reported by ESTs and genomic sequencing projects with no identification or assigned function. Their sequences were submitted to GenBank under Accession numbers BG154170–BG154185, BG154199 and BG154200. Of those, 14 ESTs showed identity or a high degree of similarity to known ESTs that were previously identified in other human cDNA libraries. BG154170 shared a sequence identity with a mouse EST (AW046572), and the other three ESTs best matched sequences previously deposited in the GenBank only by the genomic sequencing projects. Thus, contributions from our EST sequences may provide useful information in determining open reading frames (ORFs) within the respective genomic clones. Finally, there are 12 clones (17%) for which no significant similarities are found in the current database. These novel genes were therefore designated as human early embryospecific ESTs and their sequences were deposited in GenBank under Accession numbers BG154186–BG154197. The extent of redundancy in clones originating from known genes, ESTs and novel sequences was also determined. Five known genes were identified more than once. HBG2 was isolated three times whereas heat shock 70 kDa, ribosomal protein S11, translation initiation factor 2 and HBA1 were each identified twice. There was very little redundancy of ESTs, as only one EST sequence was identified twice. These results demonstrate the sequence complexity and relatively low redundancy of this library. Another particularly important criterion for defining the quality of a cDNA library is the percentage of the clones with full ORF. Of 31 known genes, 20 clones were sequenced from the 5 0 -end of cDNAs. We found eight clones (including calumein, ribosomal protein L26, eIF-2beta, TRAP delta, HBG2, HBA1, ribosomal protein L11 and GSTM2) that had the first ATG codon of the ORF. Thus, we concluded that 40% of the clones in our library contain full encoding regions. In addition, all of those clones corresponding to known genes do not contain introns within their cDNA sequences, further demonstrating that the nucleic acid used for oligo(dT)-initiated RT was mRNA and not contaminating genomic DNA.
4. Discussion A rapidly growing area of genome research is the generation of ESTs in which randomly selected cDNA clones are partially sequenced (Ko et al., 2000). The identification and sequencing of human cDNA sequences play a synergistic role to complete genome determination and represent a direct link to functional genomics (Adams et al., 1992). In particular, cDNA sequences greatly aid exon identification and are essential for the determination of tissue- and pathologyspecific exon usage in the form of alternatively spliced variants. Furthermore, repeated partial sequencing of EST
145
has proved a powerful tool for identification of genetic polymorphisms and for determination of differential gene expression (Dias Neto et al., 2000). However, the integrity of the data and the place at which novel sequences can be identified largely depend on the specific cDNA libraries. cDNA libraries therefore play an indispensable role in the isolation and characterization of mammalian genes (Liew et al., 1997). To date, the single-pass partial sequencing technique has led to the production of more than 3,100,000 ESTs isolated from more than 300 cDNA libraries that represent a wide variety of human tissues at several different developmental stages (Okubo et al., 1992; Sudo et al., 1994; Yang et al., 1996). However, the analysis of early human embryos has been difficult, principally because of their small size and the inaccessibility of human embryonic specimens (Jay et al., 1997). Nonetheless, a considerable body of information has accumulated about the biochemistry of the earliest stages of human development (Adjaye et al., 1997). We know very little, however, about the genetic systems involved in the differentiation processes in early human development. In this regard, the availability of early human embryo cDNA libraries would circumvent these difficulties and facilitate the study of expression of known genes and allow for the isolation and identification of novel development-related genes. Jay et al. (1997) constructed a 5–6-week-old human embryo cDNA library and identified 53 novel genes. Adjaye et al. (1997, 1999) constructed cDNA libraries from human oocytes, and from four-cell, seven-cell and blastocyst-stage embryos. To acquire earlier stages of human embryo cDNA library, we constructed 3-, 4- and 5-week-old human embryo cDNA libraries (Gou et al., 1999). However, those original libraries contained a high proportion of cDNA colonies restricted to the genes expressed in chorionic tissues. In this paper, we described a new improved method for producing a cDNA library from a 4-week-old human embryo without the contamination of chorion. The important feature of the present work is the use of SMART PCR to construct a cDNA library from a very limited amount of mRNA. The use of the SMART primer tags the 5 0 -end of the first-strand cDNAs and enables PCR amplification of the cDNAs towards their 5 0 -ends and eliminates the need for conventional second-strand cDNA synthesis and troublesome time-consuming adaptor ligation prior to cloning to an appropriate vector. Using the described methodology, we constructed a cDNA library with insert sizes ranging from 0.4 to 1.8 kb. The complexities of the library are over 6.3 £ 10 6 and we may expect that the library is fully representative of genes transcribed in the embryonic stage, given that the human genome is estimated to consist of about 35,000 genes. Even though PCR allows the synthesis of cDNA libraries from a very small amount of RNA, employing PCR has some disadvantages, such as a high mutation rate and difficulty in amplifying long DNA. However, the introduction of the LDPCR method greatly improved both the fidelity of the reaction and the length of PCR products (Barnes, 1994). Fig. 1
146
D.M. Gou et al. / Gene 278 (2001) 141–147
shows that most of the cDNA inserts range from 0.4 kb to 1.8 kb in size, similar to the inserts of most cDNA libraries made by non-PCR methods. Based on 5 0 -end sequencing results, we estimate that approximately 35% of clones in this library have full-length ORF, demonstrating the high quality of the SMART PCR-based cDNA library. Another disadvantage of PCR is the preferential amplification of one sequence over another. Library screening with a variety of human DNA probes suggests that the abundance of most genes remained at the initial level and also shows that even rare transcripts can be detected from this library. Specific PCR amplification implies that the library is indeed a good resource for finding development-specific genes. Additionally, we also chose to characterize this library by sequencing a number of randomly selected independent clones. This proved to be a quick and efficient approach to assess library quality, for the quality of the data generated by the ESTs project is determined by the quality of the used library (Peterson et al., 1998). All analyzable clones were derived from known genes, anonymous ESTs, or novel ESTs, with no clones containing bacterial, rRNA, mitochondrial, or vector-only sequences. In addition, no chimeric clones were found with the sequence that we were able to analyze. Moreover, one noticeable feature of this library is the high ratio of novel sequences. In conclusion, we constructed a LD-PCR-amplified cDNA library from a 4-week-old chorion-free human embryo. This is, to our knowledge, the first description of a PCR-based cDNA library from a 4-week-old human embryo. The results show that the library contains clones for several mRNAs at expected frequencies. The demonstration of specific transcripts (CD59, MCP, Quox-1 and ZNF268) and novel sequences within this library makes it a valuable resource with high sequence complexity for studying gene expression and regulatory mechanisms in 4week-old embryos. Queries regarding the use of the library should be directed to Dr Wen-xin Li.
Acknowledgements We acknowledge the invaluable contribution of the Health Center of Hubei Women and Children’s Hospital which provided therapeutically terminated human embryo. This work was supported by grants from the National Natural Science Foundation of China to D.M. Gou (No. 39900082), from the Wuhan High-Tech Program to W.X. Li and D.M. Gou (No. 996005123G) and from the Zi-Qiang Foundation of Wuhan University to D.M. Gou.
References Adams, M.D., Dubnick, M., Kerlavage, A.R., Moreno, R., Kelley, J.M., Utterback, T.R., Nagle, J.W., Fields, C., Venter, J.C., 1992. Sequence identification of 2,375 human brain genes. Nature 355, 632–634.
Adjaye, J., Daniels, R., Bolton, V., Monk, M., 1997. cDNA libraries from single human preimplantation embryos. Genomics 46, 337–344. Adjaye, J., Bolton, V., Monk, M., 1999. Developmental expression of specific genes detected in high-quality cDNA libraries from single human preimplantation embryos. Gene 237, 373–383. Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220. Beanan, M.J., Sargent, T.D., 2000. Regulation and function of Dlx3 in vertebrate development. Dev. Dyn. 218, 545–553. Buraczynska, M.J., Van Keuren, M.L., Buraczynska, K.M., Chang, Y.S., Crombez, E., Kurnit, D.M., 1995. Construction of human embryonic cDNA libraries: HD, PKD1 and BRCA1 are transcribed widely during embryogenesis. Cytogenet. Cell Genet. 71, 197–202. Claudio, J.O., Liew, C.C., Dempsey, A.A., Cukerman, E., Stewart, A.K., Na, E., Atkins, H.L., Iscove, N.N., Hawley, R.G., 1998. Identification of sequence-tagged transcripts differentially expressed within the human hematopoietic hierarchy. Genomics 50, 44–52. Corrick, C.M., Silvestro, M.J., Lahoud, M.H., Allen, G.J., Tymms, M.J., Kola, I., 1996. Construction of a mouse blastocyst cDNA library by PCR amplification from total RNA. Mol. Reprod. Dev. 43, 7–16. Daniels, R., Lowell, S., Bolton, V., Monk, M., 1997. Transcription of tissue-specific genes in human preimplantation embryos. Hum. Reprod. 12, 2251–2256. Dias Neto, E., Garcia Correa, R., Verjovski-Almeida, S., Briones, M.R., Nagai, M.A., da Silva, W., Zago, M.A., Bordin, S., Costa, F.F., Goldman, G.H., Carvalho, A.F., Matsukuma, A., Baia, G.S., Simpson, D.H., Brunstein, A., de Oliveira, P.S., Bucher, P., Jongeneel, C.V., O’Hare, M.J., Soares, F., Brentani, R.R., Reis, L.F., de Souza, S.J., Simpson, A.J., 2000. Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. Proc. Natl. Acad. Sci. USA 97, 3491–3496. Fougerousse, F., Bullen, P., Herasse, M., Lindsay, S., Richard, I., Wilson, D., Suel, L., Durand, M., Robson, S., Abitbol, M., Beckmann, J.S., Strachan, T., 2000. Human-mouse differences in the embryonic expression patterns of developmental control genes and disease genes. Hum. Mol. Genet. 9, 165–173. Gou, D.M., Huang, J., Li, W.X., Mao, X., Jiang, D.H., Hua, W.J., Fan, J.H., 1999. Construction of early human cDNA libraries and screening objective genes. Acta Biochim. Biophys. Sinica 31, 643–647. Gou, D.M., Sun, Y., Gao, L., Chow, L.C., Huang, J., Feng, Y.D., Jiang, D.H., Li, W.X., 2001. Cloning and characterization of a novel Kruppellike zinc finger gene, ZNF268, expressed in early human embryo. Biochim. Biophys. Acta 1518, 306–310. Hua, W.J., Gou, D.M., 1999. Screening full-length cDNA clone of tPA gene from human early stage embryo. Biotechnology 9, 1–3. Huang, G.M., Ng, W.L., Farkas, J., He, L., Liang, H.A., Gordon, D., Yu, J., Hood, L., 1999a. Prostate cancer expression profiling by cDNA sequencing analysis. Genomics 59, 178–186. Huang, J., Gou, D.M., Zhen, C.Y., Xia, Z.P., Jiang, D.H., Li, W.X., 1998. Cloning, sequencing and expressing of Chinese CD59 cDNA. J. Wuhan Univ. (Natural Science Edition) 44, 773–776. Huang, J., Li, W.X., Gou, D.M., Xia, Z.P., Jiang, D.H., 1999b. Cloning, sequencing of human membrane cofactor protein (MCP) and comparison with other isoforms. Prog. Biochem. Biophys. 26, 355–358. Hwang, D.M., Fung, Y.W., Wang, R.X., Laurenssen, C.M., Ng, S.H., Lam, W.Y., Tsui, K.W., Fung, K.P., Waye, M., Lee, C.Y., 1995. Analysis of expressed sequence tags from a fetal human heart cDNA library. Genomics 30, 293–298. Jay, P., Diriong, S., Taviaux, S., Roeckel, N., Mattei, M.G., Audit, M., Berge-Lefranc, J.L., Fontes, M., Berta, P., 1997. Isolation and regional mapping of cDNAs expressed during early human development. Genomics 39, 104–108. Ko, M.S., Kitchen, J.R., Wang, X., Threat, T.A., Hasegawa, A., Sun, T., Grahovac, M.J., Kargul, G.J., Lim, M.K., Cui, Y., Sano, Y., Tanaka, T., Liang, Y., Mason, S., Paonessa, P.D., Sauls, A.D., DePalma, G.E., Sharara, R., Rowe, L.B., Eppig, J., Morrell, C., Doi, H., 2000. Large-
D.M. Gou et al. / Gene 278 (2001) 141–147 scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development. Development 127, 1737–1749. Liew, C.C., Hwang, D.M., Wang, R.X., Ng, S.H., Dempsey, A., Wen, D.H., Ma, H., Cukerman, E., Zhao, X.G., Liu, Y.Q., Qiu, X.K., Zhou, X.M., Gu, J.R., Tsui, S., Fung, K.P., Waye, M.M., Lee, C.Y., 1997. Construction of a human heart cDNA library and identification of cardiovascular based genes (CVBest). Mol. Cell. Biochem. 172, 81–87. Lublin, D.M., Liszewski, M.K., Post, T.W., Arce, M.A., Le Beau, M.M., Rebentisch, M.B., Lemons, L.S., Seya, T., Atkinson, J.P., 1988. Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168, 181–194. Nakajima-Iijima, S., Hamada, H., Reddy, P., Kakunaga, T., 1985. Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns. Proc. Natl. Acad. Sci. USA 82, 6133–6137. Okubo, K., Hori, N., Matoba, R., Niiyama, T., Fukushima, A., Kojima, Y., Matsubara, K., 1992. Large scale cDNA sequencing for analysis of quantitative and qualitative aspects of gene expression. Nat. Genet. 2, 173–179. Peterson, L.A., Brown, M.R., Carlisle, A.J., Kohn, E.C., Liotta, L.A., Emmert-Buck, M.R., Krizman, D.B., 1998. An improved method for
147
construction of directionally cloned cDNA libraries from microdissected cells. Cancer Res. 58, 5326–5328. Revel, F., Renard, J.P., Duranthon, V., 1995. PCR-generated cDNA libraries from reduced numbers of mouse oocytes. Zygote 3, 241–250. Sudo, K., Chinen, K., Nakamura, Y., 1994. 2058 expressed sequence tags (ESTs) from a human fetal lung cDNA library. Genomics 24, 276–279. Sugita, Y., Nakano, Y., Tomita, M., 1988. Isolation from human erythrocytes of a new membrane protein which inhibits the formation of complement transmembrane channels. J. Biochem. 104, 633–637. Tanaka, T.S., Jaradat, S.A., Lim, M.K., Kargul, G.J., Wang, X., Grahovac, M.J., Pantano, S., Sano, Y., Piao, Y., Nagaraja, R., Doi, H., Wood, W.H., Becker, K.G., Ko, M.S., 2000. Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray. Proc. Natl. Acad. Sci. USA 97, 9127– 9132. Xue, Z.G., Gehring, W.J., Le Douarin, N.M., 1991. Quox-1, a quail-homeobox gene expressed in the embryonic nervous system, including the forebrain. Proc. Natl. Acad. Sci. USA 88, 2427–2431. Yang, Y., Peterson, K.R., Stamatoyannopoulos, G., Papayannopoulou, T., 1996. Human CD34 1 cell EST database: single-pass sequencing of 402 clones from a directional cDNA library. Exp. Hematol. 24, 605– 612.