Construction of a cDNA library and identification of genes from Liaoning cashmere goat

Livestock Science 164 (2014) 26–34

Contents lists available at ScienceDirect

Livestock Science journal homepage: www.elsevier.com/locate/livsci

Construction of a cDNA library and identification of genes from Liaoning cashmere goat Mei Jin n, Nian Liu, Songxue Yuan, Jun Piao, Fengqin Zhao, Yangle Qu, Tingting Zhang, Yanjie Wang Department of Life Sciences, Liaoning Normal University, Liaoning Provincial Key Laboratory of Biotechnology and Drug Discovery, Dalian 116081, China

a r t i c l e in f o

abstract

Article history: Received 18 June 2013 Received in revised form 21 February 2014 Accepted 24 February 2014

We constructed a skin cDNA library of the Liaoning cashmere goat during follicle anagen. The recombination was over 89%. A total of 1986 expressed sequence tags (ESTs) were sequenced. After assembly, 1126 ESTs that were homologous to functionally characterized or hypothetical proteins were obtained. BLASTX searches found 904 ESTs that had strong matches to known proteins. More than 50% of the ESTs were similar to proteins that were annotated either as related to enzyme/catalytic activity (26.5%) or as being involved in cell activities, such as growth differentiation, proliferation, apoptosis, transportation, and signal transmission (25.9%). 1.2% of the ESTs were similar to proteins that were related to hair/hair follicle. By analyzing the structure of the unisequences, 81 full-length cDNA clones were identified, none of which had yet been identified in goat. We selected two full-length cDNA clones with predicted proteins, which were similar to dimethyladenosine transferase 1-like (DIMT1L) and coatomer protein complex, subunit zeta (ζ-COP). An analysis of the tertiary structure of the DIMT1L homolog showed that it had a methyltransferase domain. The ζ-COP was a short chain and had a simple tertiary structure. In order to study DIMT1L and ζ-COP genes expression, the semi-quantitative RT-PCR was used to detect whether DIMT1L and ζ-COP genes were expressed in heart, liver, spleen, lung, kidney tissues and in situ hybridization (ISH) to detect DIMT1L and ζ-COP genes expression location. Both DIMT1L and ζ-COP genes had high expression levels in heart and skin, and low levels in liver, kidney, lung and spleen. Moreover, DIMT1L and ζ-COP genes had a strong expression in the inner root sheath of the primary hair follicles (PF) and the secondary hair follicles (SF). The ζ-COP gene also had a strong expression in the surrounding tissue. In conclusion, we have successfully constructed a skin cDNA library from Liaoning cashmere goat during follicle anagen and characterized two genes. The cDNA library could become a valuable source to study the biology genetic characteristics of Liaoning cashmere goat and may provide an important platform for protecting genomic resources and improving the breed. & 2014 Elsevier B.V. All rights reserved.

Keywords: Liaoning cashmere goat Skin cDNA library DIMT1L ζ-COP

1. Introduction

n

Corresponding author. Tel.: þ86 15841161777. E-mail addresses: [email protected] (M. Jin), [email protected] (N. Liu). http://dx.doi.org/10.1016/j.livsci.2014.02.019 1871-1413/& 2014 Elsevier B.V. All rights reserved.

The Liaoning cashmere goat is well-known for its soft, pure and bright fleece that has a huge economic value. Therefore, much attention is paid to its fineness and quality. Li et al. (2005) studied the cycling of skin and hair

M. Jin et al. / Livestock Science 164 (2014) 26–34

follicles of Arbas and Liaoning cashmere goats. They illustrated the mechanism of cycling growth of the hair follicle. Zhang et al. (2007) examined skin paraffin sections of Inner Mongolian Arbas cashmere goats to observe the hair follicle structures and morphogenesis. In the mid1940s, Philpott et al. (1944) injected the insulin growth factors (IGF) into the medium of hair follicle cultivation to increase the quantity of hair. In the 1980s, researchers studied the endocrine regulators, thyroid hormone, growth hormone (GH) and prolactin, to find ways of improving the quantity and quality of the cashmere fiber (Choy et al., 1997; Wynn et al., 1988; Lincoln et al., 1980). With the development of new experimental techniques, McLaren et al. (1997) located two keratin genes (KRT type I and KRT type II) on chromosomes 11 and 3 respectively of goat. Sandra et al. (2008) used microsatellite markers to locate disease genes in the cashmere goat genome. However, until now, no skin cDNA library from Liaoning cashmere goat is available. In this study we generated a skin cDNA library from Liaoning cashmere goat during follicle anagen by SMART technology. Analysis and classification of the ESTs were used to help us find novel genes. We isolated full-length clones and studied their molecular characterization. Our results provide an important platform for future functional genomics of Liaoning cashmere goat. 2. Materials and methods 2.1. Liaoning cashmere goat selection and sample preparation Six adult Liaoning cashmere goats (Capra hircus), three bucks and three nannies, were selected randomly from a cashmere goat farm in Liaoning Province, China. All the animal experiments were approved by the animal care and use committee at the Life Science Department of Liaoning Normal University and authorizations from the Chinese Ministry of Agriculture. 2.2. Isolation of total RNA and mRNA Total RNA from Liaoning cashmere goat skin during follicle anagen was prepared using Trizol reagent following the manufacturer's protocol (Invitrogen, USA) and total mRNA was extracted with the mRNA purification kit according to the manufacturer's instructions (TaKaRa, Japan). The integrity of the RNA was evaluated by gel electrophoresis on denaturing formaldehyde agarose and the quantity of the RNA was estimated by ultraviolet spectroscopy. 2.3. cDNA library construction First strand cDNA and ds-cDNA were synthesized using the Creator SMART cDNA Library Construction kit following the manufacturer's protocol (Clontech, USA). Subsequently, ds-cDNA was prepared from mRNA. The ds-cDNA was digested with Sfi I restriction enzyme for 3–4 h. The first four peak fractions containing cDNA (4500 bp) were pooled together using a column chromatograph with CHROMA SPIN-400 medium. The cDNA fragments were

27

ligated directionally into Sfi I digested pDNR-LIB vector. The ligation mixture was transferred into the competent cells of Escherichia coli DH10B by electroporation. 2.4. Titration of the primary library To calculate the library titer, we calculated the number of clones according to the formula, cfu/ml ¼number of colonies  dilution factor  103 μl/ml (μl of diluted colony plated). Colony PCR was used to confirm the size of the insert fragment in the library. The recombination efficiency was identified by blue/white screening in E. coli XL1-Blue. 2.5. Sequencing, assembly and analysis The cDNA clones that were selected from the cDNA library were sequenced. The single-pass cDNA was sequenced from the 50 end on an ABI 3730 Genetic Analyzer (Applied Biosystems). Raw sequences were first trimmed to remove the vector and low-quality sequences using the cross_match program. The CAP3 program was used to identify overlaps between sequences and to assemble sequence fragments into longer sequences. The assembled cDNA sequences were used in BLAST searches against the nonredundant (nr) GenBank database and the dbEST database to compare them with all currently available ESTs and genes. The BLASTX results with bit scores 480 and E-values o10  10 were regarded as significant matches. 2.6. Bioinformatic analysis of the novel genes All ESTs were searched against the nonredundant nucleotide/protein databases in GenBank and Swiss-Prot by BLASTN/BLASTX to identify DNA/protein homologs and to assign possible functions. Open reading frames (ORFs) were identified using the NCBI ORF Finder. Multiple sequence alignments between the amino acid sequences of candidate clones and their homologs from other species were performed by using CLUSTALW. We used the PredictProtein server to predict the secondary structures, Pfam to analyze the structure domains, Predotar to locate the genes, and SignalP to predict the signal peptide of the candidate clone amino acid sequences (EXPASY http://ca. expasy.org/). 2.7. Semi-quantitative RT-PCR RT-PCR was performed on total RNA isolated from the skin, heart, liver, spleen, lung and kidney (as the method of isolation of total RNA) of the six Liaoning cashmere goats (three bucks and three nannies) following the manufacturer's instructions of RT-PCR (TIANGEN, Peking, China). The RNA was treated with DNase and purified by using RNeasy Mini Kit following the manufacturer's protocol (TIANGEN, Peking, China). 2 μg of purified total RNA was used for the first strand cDNA synthesis by using 50 pmol oligo-dT primer and 100 units of PrimeScript™ (TaKaRa, Japan). The first strand cDNA was used for PCR. Specific primers for two novel genes and β-actin (ACTB) were

28

M. Jin et al. / Livestock Science 164 (2014) 26–34

Table 1 Forward (F) and reverse (R) primers used for RT-PCR. Name of primer

Sequence(50 –30 )

Production length (bp)

Temp (1C)

ACTB (F) ACTB (R) ζ-COP (F) ζ-COP (R) DIMT1L (F) DIMT1L (R)

CAGATCATGTTCGAGACTTTC CCTTTAGCAGGCACTGTAG TTCAAGGCTGGAARAAGA CAGAAACGAAGGTCCTAA CGGGTTCGGGTCCTTCTT GGCGTGCCCTGAACTCTT

224

61.71 61.41 59.34 60.27 59.50 58.00

432 357

The sequences used for primer design were ACTB [GenBank: AF481157]; ζ-COP [GenBank: JN942972]; and DIMT1L [GenBank: JN942971].

designed by using Primer 5 (Table 1). The RT-PCR conditions were 74 1C predegeneration 10 s; 74 1C denaturation 5 s; 56 1C annealing 30 s; 72 1C extension, 40 cycles. 2.8. In situ hybridization After cloning and sequencing, RT-PCR products of DIMT1L and ζ-COP genes were repeatedly purified, and then used as digoxigenin labeled templates. Labeling was performed according to digoxigenin kit instruction (Roche, Germany), and the prepared probes were stored at  20 1C in a refrigerator. Tissue section of in situ hybridization was via dewaxing, rehydration, proteinase K digestion, PBS washing and drying, then 42 1C prehybridization for 1 h with 50% deionized formamide, 42 1C hybridization overnight, and the hybridizated section was placed in turn in 2  SSC wet box. Then the tissue was washed in 2  SSC, 1  SSC, and 0.25  SSC, after hybridization adding antibody dilution 1:5000, combined with antibodies for immunological detection, using NBT/BCIP color, and neutral resin Seal Sheet. Results were inspected by a microscope and photographed. 3. Results

Fig. 1. Agarose gel electrophoresis of total RNA, synthesized ds-cDNA and cloned ds-cDNA insert fragments. (a) Total RNA from the Liaoning cashmere goats and the ds-cDNA that was synthesized from it. Lane 1: total skin RNA; Lane 2: synthesized ds-cDNA; Lane M1: pHY marker; and Lane M2: λ-EcoT14 digest DNA marker. (b) PCR products of the cDNA insertion fragments from randomly selected clones. Lane M1: pHY marker; and Lane M2: λ-EcoT14 digest DNA marker.

Fig. 2. Distributions of ESTs in the contigs assembled using the CAP3 program.

3.1. Construction of the skin cDNA library The three clear bands that were seen on agarose gel (1%) electrophoresis indicated that the extracted RNA was of high quality. The OD260/OD280 ratio for the total RNA was 2.01. The RNA concentration was 1.67 μg/μl, suggesting that the RNA was suitable for use in the next step. The synthesized double-stranded cDNA (ds-cDNA) was between 0.4 kbp and 4 kbp long (Fig. 1a) indicating that ds-cDNA had been successfully synthesized. The capacity of the constructed cDNA library was 1.12  106 cfu/ml. The recombination rate of the cDNA library was 89%. The insert fragments were more than 1 kb in size (Fig. 1b). 3.2. EST assembly and unisequence analysis We sequenced 1986 ESTs in the skin library and after assembly obtained 1126 unisequences (243 contigs and 883 singletons) that were homologous to functionally characterized or hypothetical proteins. The ESTs ranged from 200 bp to 1500 bp; 904 of the ESTs had a high

similarity to known proteins, 138 had average similarity, and 84 had low similarity. The number of ESTs assembled into one contig was between 2 and 64; most contigs contained between 2 and 6 ESTs (Fig. 2). Analysis of the contigs provided some insight into gene expression in the sampled tissues. Several of the largest contigs are listed in Table 2. The contig with the highest number of ESTs (64) has only low homology with known sequences in the databases that were searched. Therefore, this contig is not listed in Table 2. One contig, which contained 40 ESTs, was identified as similar to the type I keratin intermediate filament IRSa1. The contig which contained 25 and 21 ESTs was similar to the type II keratin intermediate filament IRSa1 and to decorin. We randomly chose 10 of the potential full-length cDNA clones to investigate whether or not they were full-length sequences. By predicting the length of the ORF, we estimated the percentage of 50 UTR, ORF and 30 UTR in the sequences and predicted that 7 of the 10 clone sequences were full-length sequences. Because the 50 UTR

M. Jin et al. / Livestock Science 164 (2014) 26–34

29

Table 2 Contigs containing a high number of ESTs. No. Contig size

Annotation

Species

Capra hircus Ovis aries Bos taurus Bos taurus Ovis aries Capra hircus Capra hircus Bos taurus Bos taurus Bos taurus

1

40

2 3 4 5 6

40 35 30 29 25

7

21

Type I keratin intermediate filament IRSa1 Ubiquitin C Cytochrome b5 type B Methyltransferase like 6 Myosin regulatory light chain MRCL3 Type II keratin intermediate filament IRSa1 Decorin

8 9 10

20 16 13

Peroxiredoxin 2 Annexin A1 H3 histone, family 3B

Fig. 3. Functional categorization of the ESTs based on their matches to known proteins in public databases.

was truncated in sequence 2 and extra-long in sequence 9, and the 30 UTR was too long to fit the structural features in sequence 10, we inferred that these clones were not fulllength sequences. 3.3. Functional classification Of the 1126 ESTs, 4.5% were related to proteins annotated as participating in protein synthesis, packaging, modification and so on; 26.5% were related to enzyme/ catalytic activity; 25.9% were annotated as being involved in cell activities; 12.1% were related to nucleic acid; 4.3% were involved in metabolism/immunization; 5.9% were about catabolism/anabolism of energy and material; 1.2% were related to hair/hair follicle; 15.1% were involved in diseases including cancer; and 4.5% of them had no functional annotation (Fig. 3). The ESTs that related to hair/hair follicle were examined in detail and the results are shown in Fig. 4. There were 95 ESTs related to keratin-associated protein (KAP). There were 20 ESTs related to keratin. There were 2 ESTs associated with BMP, 3 ESTs associated with Runx, 4 ESTs associated with Hair disease, 4 ESTs associated with Scar and 10 ESTs were others. 3.4. The bioinformatics of two genes with full-length sequence In this study, we isolated two full-length cDNA clones, 1511 bp and 1457 bp in size. The unisequences possessed intact ORFs 941 bp and 533 bp long encoding proteins of 314 and 178 amino acids that were similar to the dimethyladenosine transferase DIMT1L and to the coat protein ζ-COP respectively. Comparison of amino acid sequences with homologous sequences from other mammals confirmed that the two unisequences were indeed DIMT1L and ζ-COP (Fig. 5). This is the first time that these two genes were identified in goat. The predicted physicochemical properties of the goat DIMT1L and ζ-COP are shown in Table 3. The predicted Pfam classification indicated that DIMT1L belongs to the ribosomal RNA adenine dimethylase (RrnaAD) family and the ζ-COP belongs to clathrin adapter

Fig. 4. The number of ESTs in the unisequences related to hair/hair follicle.

complex small chain (Clat adapter s) family. The search results of the Pfam structure domains of these two proteins were in accordance with their family classifications. The RrnaAD domain of DIMT1L was located at position 31–262 in the sequence (E-value ¼1.1e 60) and the Clat adapter s domain was located at position 12–151 in the ζ-COP sequence (E-value ¼1.1e 45). The predicted tertiary structures showed that all these genes of tertiary structure were loose and may be hydrophilic proteins. In addition, DIMT1L was predicted to have a methyltransferase structural domain that we assumed to form its catalytic site. The structure of ζ-COP was predicted to be a simple chain with no complex domain structure. We used the Predotar tool to predict the targeting of DIMT1L and found that it was likely to be located in the mitochondria and endoplasmic reticulum. Both DIMT1L and ζ-COP have no signal peptide which were predicted by TMHMM server v.2.0.

3.5. Semi-quantitative RT-PCR Agarose gel (1%) electrophoresis of the RNA isolated from skin, heart, liver, spleen, lung and kidney (six organs) of the Liaoning cashmere goats showed that it was of high quality. The OD260/OD280 ratios for each RNA sample were about 2.0. The two genes, ζ-COP and DIMT1L, were expressed at different levels in the skin and five other organs (heart, liver, spleen, lung and kidney). Both ζ-COP and DIMT1L were highly expressed in heart and skin (Fig. 6); however, DIMT1L was more highly expressed than ζ-COP in skin.

30

M. Jin et al. / Livestock Science 164 (2014) 26–34

Fig. 5. Multiple alignment of Liaoning cashmere goat DIMT1L and ζ-COP sequences with other mammals. (a) Comparison of various DIMT1L sequences. Although there were some differences at the N-terminus, the changes were conservative replacements. Sequences used Mus musculus [GenBank ID: AAH19799.1]; Rattus norvegicus [GenBank ID: AAI58730.1]; Bos Taurus [GenBank ID: AAI12887.1]; Homo sapiens [GenBank ID: AAH10874.1]. (b) Comparison of various ζ-COP sequences. There was only one difference at position 41. Sequences used Mus musculus [GenBank ID: AAH58524.1]; Bos Taurus [GenBank ID: AAI02359.1]; Homo sapiens [GenBank ID: AAH02849.1].

3.6. In situ hybridization The positive results of ISH were observed by microscopy, as a gray brown hybridization signal. ISH results showed that DIMT1L gene and ζ-COP gene had a strong signal in the inner root sheath (IRS) of primary and secondary hair follicles (Fig. 7). But no signal was found

in the outer root sheath (ORS), sebaceous glands, hair papilla and hair medulla. Moreover ζ-COP gene had a strong signal in surrounding tissues (Fig. 7bB, D, and E). Whereas DIMT1L gene was detected only as a weak signal in surrounding tissues (Fig. 7aA, C, and F). Each experiment had a separate control, in which no expression signal was found.

M. Jin et al. / Livestock Science 164 (2014) 26–34

Table 3 Predicted physicochemical properties of the two genes. Gene

MW

PI

GRAVY

II

AI

DIMT1L ζ-COP

35.2113 20.2563

10.01 4.77

 0.132  0.072

35.57 48.69

99.04 110.62

MW, Molecular weight (kDa); PI, isoelectric point; GRAVY, grand average of hydropathicity; II, instability index; AI, aliphatic index.

Fig. 6. The expression of actin, ζ-COP and DIMT1L in six organs. (a) Actin expression in six organs. (b) DIMT1L expression in six organs. (c) ζ-COP expression in six organs. M, marker.

4. Discussion The Liaoning cashmere goat is a valuable genetic resource because of the high economic value of its cashmere fiber. We have constructed a skin cDNA library of Liaoning cashmere goat during follicle anagen using SMART technology. We obtained 1986 ESTs that were assembled into 1126 unisequences that were homologous to functionally characterized or hypothetical proteins (Huang and Madden, 1999). The number of ESTs per contig can be considered to represent the expression of genes in the specific period (Jin et al., 2010). In general, the more

31

ESTs in one contig, the higher the expression of the genes represented by that contig. One contig, which contains 40 ESTs, was identified as similar to the type I keratin intermediate filament IRSa1 (Table 2). Keratin is the main structural protein in wool fiber (Wan and Du, 2004). Therefore, it is not surprising that the high expression of keratin during follicle anagen is required to produce the wool fiber. To obtain the skin sample, the skin on the goat was damaged. To reduce scarring (Rogers et al., 2004), the over-expression of decorin (Table 2, contig 7) which inhibits transforming growth factor (TGF-β) may have occurred. TGF-β plays a role in controlling hair follicle morphology and cell cycle (Boche et al., 2006); therefore, the over-expression of decorin indirectly has the same functions. These results indicate that the number of EST in a contig is an indicator of high expression levels in a particular period. The mRNA of most eukaryotes has three parts; the 50 UTR, the coding region and the 30 UTR (including a polyA tail). The 50 UTR and 30 UTR often contain regulatory sequences that control the expression of the gene in particular tissues and at different stages of development. In the goat, the 50 UTR, the ORF (the predicted coding region) and the 30 UTR were identified and found to cover almost the entire lengths of the sequence, indicating that they were potentially full-length clones (Zhou and Fan, 2008). Of the 1126 ESTs, more than 50% of the ESTs were similar to proteins. Other groups were related to nucleic acid, metabolism/immunization, catabolism/anabolism of energy and material, diseases, hair/hair follicle and so on (Fig. 3). All these groups are important for the growth and performance of the goat. The ESTs that were related to hair/hair follicle were examined in detail (Fig. 4). There were 95 ESTs related to keratin-associated protein (KAP), indicating that these genes were highly expressed in the skin samples. KAPs are a major component of the hair fiber, and play crucial roles in forming a strong hair shaft through a cross-linked network of the keratinintermediate filament proteins. The ESTs associated with BMP contained 2 ESTs. A recent study showed that the BMP signaling pathway played an important role in adjusting the epiblast progenitors of the size of the organ development, e.g. skin and changing of phenotypes. And also the BMP signaling pathway could control the genes related to the cell cycles of the hair corneous cell of matrix (including the p27kip1 cyclin-dependent protein kinase inhibitor). Further, the BMP signaling pathway can regulate cell proliferation and, to some extent, control the size of the nipple hair follicle, hair growth, hair types and fiber diameter (Purushothaman et al., 2010; Sharov et al., 2006). There were 3 ESTs associated with Runx and the studies have indicated that many Runx family members (Runx1 and Runx3) are related to hair types (Mou et al., 2006; Raveh et al., 2005). Many other signaling pathways such as the Hox family, the genes of TGF-β, EGF and FGF-5, and the Wnt signal pathways can influence hair follicle growth and wool quality. EST analysis is effective in discovering genes, profiling gene expressions and studying functional genomics (Raveh et al., 2006). In this study, we isolated two full-length cDNA clones. The two unisequences are similar to the dimethyladenosine

32

M. Jin et al. / Livestock Science 164 (2014) 26–34

Fig. 7. The expression of DIMT1L and ζ-COP genes in the cashmere goat primary and secondary hair follicle. (a) The expression of DIMT1L gene in the cashmere goat primary and secondary hair follicle. (A and B) The expression of DIMT1L gene in the PF (transverse line, respectively 100  ); (C) the expression of DIMT1L gene in the SF (transverse line, respectively 100  ); (D and E) the expression of DIMT1L gene in the PF (slitting section, 100  ); (F) the expression of DIMT1L gene in the SF (slitting section, 100  ). (b) The expression of ζ-COP in the cashmere goat primary and secondary hair follicle. (A) The expression of ζ-COP in the PF (slitting line, respectively 100  ); (B) the expression of ζ-COP in the SF (slitting line, respectively 100  ); (C and D) the expression of ζ-COP in the PF (transverse section, 100  ); (E) the expression of ζ-COP in the SF (transverse section, 100  ). ORS, outside root sheath; IRS, inner root sheath; CO, cortical layer; MED, medulla layer; DP, dermal papilla.

M. Jin et al. / Livestock Science 164 (2014) 26–34

transferase DIMT1L and to the coat protein ζ-COP respectively. Comparison of their amino acid sequences with homologous sequences from other mammals confirmed that the two unisequences were indeed DIMT1L and ζ-COP (Fig. 5). DIMT1L belongs to the ribosomal RNA adenine dimethylase (RrnaAD) family and the ζ-COP belongs to clathrin adapter complex small chain (Clat adapter s) family. Protein transport within the cell is controlled by the appropriate modification and folding of the protein chain. Methylation is a common modification and methyltransferases play important roles in this process. DIMT1L was S-adenosine-L-methionine methyl donors, setting methyl to zymolyte to completing methylation (Richon et al., 2011; Asamizu and Nakamura, 2004), so the location of DIMT1L was in mitochondrion and ER. Both DIMT1L and ζ-COP have no signal peptide. These also illustrated that two proteins which were encoded by DIMT1L and ζ-COP were located in cytoplasm matrix or organelles matrix, and were not the secretory proteins or membrane proteins. These results were in accordance with the orientation. While the results clearly show that the goat DIMT1L is involved in the methylation process, its exact function remains to be studied further. ζ-COP is one of the subunits in the coatomer made up of seven subunits (α, β, β0 , γ, δ, ε and ζ) (Richter et al., 2010). The ζ-COP subunit blocks the binding of the coatomer to Golgi membranes and prevents the assembly of COPIcoated transport vesicles on Golgi cisternae (Eugster et al., 2004). In order to study DIMT1L gene and ζ-COP gene expression, the semi-quantitative RT-PCR was used to detect that both DIMT1L gene and ζ-COP gene had high expression levels in heart and skin, and low levels in liver, kidney, lung and spleen. Methyltransferases are required for protein synthesis, packaging, folding and modification and COPI-coated transport vesicles are involved in protein transport. The high expression levels of the two proteins in skin may support the formation of the wool fiber by supporting the transport and modification of the keratins and KAPs. The bioinformatics predictions suggested that DIMT1L was in the mitochondria. Because mitochondria supply energy for the cell, the high expression of DIMT1L in the heart can be easily understood. In addition, the activity of hair follicles goes through three regular changes including anagen, catagen and telogen in a year cycle (Cui et al., 2008). In anagen, the villi rapidly grows and the expression of genes is the most active. The previous research demonstrated that the different expression locations are also associated with the different cashmere qualities. Therefore, this research used ISH to analyze the expression of DIMT1L gene and ζ-COP gene in hair follicles. The results showed that DIMT1L gene and ζ-COP gene had a strong signal in the inner root sheath of primary and secondary hair follicles (Fig. 7). These indicate that DIMT1L gene and ζ-COP gene are the structural components of inner root sheath, participating in the formation of inner root sheath of villi and shad, playing an important role in the cashmere growth and quality. But no signal in the outer root sheath (ORS), sebaceous glands, hair papilla and hair medulla, explained that DIMT1L gene and ζ-COP gene are not involved in the composition of ORS, sebaceous gland, hair papilla and hair medulla in hair follicle Anagen. Moreover ζ-COP gene has a strong signal in surrounding

33

tissues. These indicate that ζ-COP gene has a strong expression in surrounding tissues. However DIMT1L gene was detected as only a weak signal in surrounding tissues. These indicate that DIMT1L gene also has weak expression in surrounding tissues. These results have correspondence with the aforementioned ζ-COP gene which is a kind of membrane protein complex, mainly existing in the cytoplasm. The difference between DIMT1L gene and ζ-COP gene may be due to the proform different functions; the specific reasons remain to be researched in the future. 5. Conclusion The Liaoning cashmere goat is a valuable genetic resource because of the high economic value of its cashmere fiber. We have constructed a skin cDNA library of Liaoning cashmere goat during follicle anagen using SMART technology. We obtained 1986 ESTs that were assembled into 1126 unisequences. The recombination of the cDNA library was over 89% and the contig ratio was 21.6%. Classification of these 1126 unisequences indicated that 1.2% of ESTs were related to hair fiber. Screening of the skin cDNA library led to the isolation of two full-length cDNA clones which showed sequence similarity to DIMT1L and ζ-COP. Bioinformatic analyses indicated that one of the selected full-length cDNA clones was similar to DIMT1L, a member of the methyltransferase family of proteins; semiquantitative RT-PCR revealed that it was highly expressed in skin and heart and in situ hybridization result showed that DIMT1L gene has a strong signal in the inner root sheath which is associated with the growth of hair follicle. The other cDNA clone was similar to ζ-COP that blocks the binding of coatomer to Golgi membranes and prevents the assembly of COPI-coated transport vesicles on Golgi cisternae. Semi-quantitative RT-PCR revealed that ζ-COP was also highly expressed in the skin and heart although its expression in skin was less than that of DIMT1L. in situ hybridization result showed that ζ-COP gene has a strong signal in the inner root sheath and the surrounding tissues, and participates in the growth of skin and hair follicles. In this study, we indentified two genes, DIMT1L and ζ-COP that may be involved in wool fiber formation. These genes could form the basis for further studies. Construction of a skin cDNA library from Liaoning cashmere goat helped us to find genes, look for genetic relationships and provide effective methods for the further understanding of Liaoning cashmere goats. Conflict of interest statement The authors have declared that no conflict of interest exists.

Acknowledgments This study was funded by the Technical Plan Project of Dalian (No. 2013B12NC090), the Millions of Talents Fund of Liaoning Province, and the National Natural Science Foundation of China (No. 31172188).

34

M. Jin et al. / Livestock Science 164 (2014) 26–34

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.livsci. 2014.02.019.

References Asamizu, E., Nakamura, Y., 2004. System for expressed sequence tags (EST) analysis. Tanpakushitsu Kakusan 49 (11), 1847–1852. Boche, D., Cunningham, C., Docagne, F., Scott, H., Perry, V.H., 2006. TGFbeta1 regulates the inflammatory response during chronic neurodegeneration. Neurobiol. Dis. 22, 638–650. Choy, V.J., Nixon, A.J., Pearson, A.J., 1997. Distribution of prolactin receptor immunoreactivity in ovine skin and changes during the wool follicle growth cycle. J. Endocrinol. 155 (2), 265–275. Cui, Z.F., Zhao, J., Wang, H., 2008. Influences of different mediums on goat hair follicles cultured in vitro. J. Shandong Univ. (Nat. Sci.) 43 (5), 1–5. Eugster, A., Frigerio, G., Dale, M., Duden, R., 2004. The alpha- and beta'COP WD40 domains mediate cargo-selective interactions with distinct di-lysine motifs. Mol. Biol. Cell. 15 (3), 1011–1023. Huang, X., Madden, A., 1999. CAP3: a DNA sequence assembly program. Genome Res. 9 (9), 868–877. Jin, M., Xing, M.X., Li, S., 2010. Keratin 26, a novel member of the goat type I keratin gene family. Small Rumin. Res. 93, 24–30. Li, C.Q., Yin, J., Zhang, Y.J., 2005. The comparation of hair follicle cycling between Inner Monolian cashmere goat and Liaoning cashmere goat. Acta Vet. Zootech. Sin. 36 (7), 674–679. Lincoln, G.A., Klandorf, H., Anderson, N., 1980. Photoperiodic control of thyroid function and wool and horn growth in rams and the effect of cranial sympathectomy. Endocrinology 107 (5), 1543–1548. McLaren, R.J., Rogers, G.R., Davies, K.P., Maddox, J.F., Montgomrey, G.M., 1997. Linkage mapping of wool keratin and keratin-associated protein genes in sheep. Mamm. Genome 8 (12), 938–940. Mou, C., Jackson, B., Schneider, P., Overbeek, P.A., Headon, D.J., 2006. Generation of the primary hair follicle pattern. Proc. Natl. Acad. Sci. 103, 9075–9080.

Philpott, M.P., Sanders, D.A., Kesley, T., 1944. The isolation and maintenance of the human pilosebaceous unit. J. Investig. Dermatol. 102, 857–861. Purushothaman, N., Deepa, K., Gnanasekaran, G., Jasintha, P., Noopur, S., Priyanka, A.S., Kavita, K.S., Parani, M., 2010. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and fulllength enriched cDNA library from developing seeds. BMC Genomics 11, 606. Raveh, E., Cohen, S., Levanon, D., Negreanu, V., Groner, Y., Gat, U., 2006. Dynamic expression of Runx1 in skin affects hair structure. Mech. Dev. 123, 842–850. Raveh, E., Cohen, S., Levanon, D., Groner, Y., Gat, U., 2005. Runx3 is involved in hair shape determination. Dev. Dyn. 233, 1478–1487. Richon, V.M., Johnston, D., Sneeringer, C.J., Jin, L., Maeir, C.R., Elliston, K., Jerva, L.F., Scott, M.P., Copeland, R.A., 2011. Chemogenetic analysis of human protein methyltransferases. Chem. Biol. Drug Des. 78 (2), 199–210. Richter, U., Kuhn, K., Okada, S., Brennicke, A., Weihe, A., Borner, T., 2010. A mitochondrial rRNA dimethyladenosine methyltransferase in Arabidopsis. Plant J. 61, 558–569. Rogers, M.A., Winter, H., Langbein, L., Bleiler, R., Schweizer, J., 2004. The human type I keratin gene family: characterization of new hair follicle specific members and evaluation of the chromosome 17q21.2 gene domain. Differentiation 72, 527–540. Sandra, M.P., Ivar, V.K., Khalid, A.A., 2008. G protein-coupled receptor P2Y5 and its ligand LPA are involved in maintenance of human hair growth. Nat. Genet. 40 (3), 329–334. Sharov, A.A., Sharova, T.Y., Mardaryev, A.N., 2006. Bone morphogenetic protein signaling regulates the size of hair follicles and modulates the expression of cell cycle-associated genes. Proc. Natl. Acad. Sci. 103, 18166–18177. Wan, H.W., Du, L.X., 2004. The useful of expression sequence tags in genomics. Biotechnol. Bull. 1, 34–38. Wynn, P.C., Wallace, A.L.C., Kirby, A.C., Annison, E.F., 1988. Effects of growth hormone administration on wool growth in merino sheep. Biol. Sci. 41 (2), 177–188. Zhang, Y.J., Yin, J., Li, J.Q., 2007. The research of hair follicle structure and morphogenesis of Inner Monogolian Arbas cashmere goat. China Agric. Sci. 40 (5), 1017–1023. Zhou, N.H., Fan, W.X., 2008. The research of TGFbeta1 in hair follicle. J. Clin. Dermatol. 37 (1), 63–65.