- Email: [email protected]
Construction and characterization of a Xanthomonas oryzae pv. oryzae bacterial artificial chromosome library
FEMS Microbiology Letters 200 (2001) 59^65
www.fems-microbiology.org
Construction and characterization of a Xanthomonas oryzae pv. oryzae bacterial arti¢cial chromosome library Hirokazu Ochiai *, Yasuhiro Inoue, Akira Hasebe, Hisatoshi Kaku Department of Genetic Resources, National Institute of Agrobiological Sciences, Kannondai, Tsukuba 305-8602, Japan Received 26 January 2001; received in revised form 16 April 2001; accepted 18 April 2001 First published online 11 May 2001
Abstract Xanthomonas oryzae pv. oryzae is an important plant pathogen which causes bacterial blight of rice. To facilitate genome studies of this bacterium, we have constructed a bacterial artificial chromosome (BAC) library of strain MAFF 311018. It consisted of 750 clones representing 16 genome equivalents, and had an insert size ranging from 20 to 220 kb with an average size of 107 kb. This library is the first to be constructed from a X. oryzae pv. oryzae strain. The usefulness of this library was demonstrated through polymerase chain reaction screening of 11 genes and the 16S^23S rDNA spacer region in a 192-clone subset, representing five genome equivalents. The results obtained showed an average of 5.9 BAC clones per screening. This result is in good agreement with the estimated size of the test library, indicating that the constructed BAC library can be used to facilitate genome analysis of X. oryzae pv. oryzae. ß 2001 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies. Keywords : Xanthomonas oryzae pv. oryzae; Bacterial arti¢cial chromosome ; hrp gene cluster
1. Introduction Xanthomonas oryzae pv. oryzae [1] is a plant pathogen that causes bacterial blight on rice cultivars, one of the most destructive diseases of rice in Asia. The most promising method of controlling this disease is the use of resistant cultivars. However, most resistance genes provide effective and stable protection only against subpopulations of the pathogen [2]. In order to guide the selection and deployment of resistance genes, the population structure of this pathogen has been studied extensively [3^9]. X. oryzae pv. oryzae has been used as a model organism for studying various aspects of host^pathogen interactions. Although a few pathogenicity-related genes such as avirulence genes have been cloned and analyzed [10^ 12], information about their functions and knowledge of the molecular mechanisms involved are limited. Recently, physical maps of many bacterial genomes have been constructed using pulse-¢eld gel electrophoresis (PFGE) [13]. In xanthomonads, the physical maps of
* Corresponding author. Tel. : +81 (298) 38 7452; Fax: +81 (298) 38 7408; E-mail : [email protected]¡rc.go.jp
Xanthomonas campestris pv. campestris, Xanthomonas axonopodis pv. glycines and pv. phaseoli genomes have been reported [14^16]. However, little is known about the genome structure and genetic maps of pathogenicity-related genes in X. oryzae pv. oryzae. This prompted us to undertake the construction of a physical and genetic map of this pathogen. The development of bacterial arti¢cial chromosome (BAC) systems has allowed the construction of large insert-sized DNA libraries [17]. Compared with YAC and cosmid cloning, BAC has a lower rate of chimerism and higher e¤ciency of cloning. It is also easier to handle and is more stably maintained. To date, BAC libraries have been constructed in many kinds of organisms, e.g. human [18,19], plants [20,21], fungi [22,23], and bacteria [24^26], and have become a powerful tool for genome analysis. Because it employs large-sized DNA inserts, the BAC system o¡ers the following signi¢cant advantages for cloning and analysis of bacterial genomes: (i) it requires only a relatively small number of clones to provide complete coverage of the bacterial genome, and (ii) it facilitates cloning of clustered genes, such as those for certain metabolic processes, for secretion, or for pathogenicity (e.g. hrp genes). Therefore, we chose a BAC system and constructed a
0378-1097 / 01 / $20.00 ß 2001 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 1 9 4 - X
FEMSLE 9950 6-6-01
60
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
BAC library of the X. oryzae pv. oryzae MAFF 311018 genome as a ¢rst step in genome analysis of this pathogen. The constructed BAC library will facilitate genome studies, ¢ne mapping, and cloning of pathogenicity-related gene loci of X. oryzae pv. oryzae. 2. Materials and methods 2.1. Preparation of high molecular weight (HMW) DNA X. oryzae pv. oryzae strain MAFF 311018 (T7174), a Japanese representative strain of race I, was used in this study. The strain was grown in 15 ml of LB medium [27] to the late exponential phase at 28³C. Cells (2.5U109 CFU ml31 ) were washed in cell suspension bu¡er (10 mM Tris^ HCl, 20 mM NaCl, 50 mM EDTA, pH 7.2) and resuspended in 1 ml of a cell suspension bu¡er. An equal volume of an agarose solution (0.7 M sorbitol, 0.125 M EDTA, 2% (w/v) InCert agarose (FMC BioProducts)) was added to the washed cells. The mixture was poured into plastic plug molds (Bio-Rad) and solidi¢ed at 4³C for 10 min. The agarose plugs containing DNA (¢nal cell density: 1.25U108 per plug) were treated in 5 ml of a lysozyme solution (10 mM Tris^HCl, pH 7.2, 50 mM NaCl, 0.2% (w/v) sodium deoxycholate, 0.5% (w/v) sodium lauryl sarcosine, 1 mg ml31 lysozyme) at 37³C for 1 h without agitation, and then incubated in 5 ml of a proteinase K solution (100 mM EDTA, pH 8.0, 0.2% (w/v) sodium deoxycholate, 1.0% (w/v) sodium lauryl sarcosine, 1 mg ml31 proteinase K) at 50³C for 72 h without agitation. The latter solution was changed after 24 and 48 h. The plugs were washed six times in 25 ml of a wash bu¡er (20 mM Tris^HCl, pH 8.0, 50 mM EDTA) for 1 h each at 4³C with gentle agitation and stored at 4³C. Before the restriction enzyme reaction, the plugs were washed six times in 25 ml of TE bu¡er (10 mM Tris^HCl, pH 8.0, 1 mM EDTA) for 1 h each at 4³C with gentle agitation. 2.2. Partial digestion and size fractionation The plugs (about 50 mg) were equilibrated with 180 Wl of HindIII digestion bu¡er lacking MgCl2 (10 mM Tris^ HCl, pH 7.5, 50 mM NaCl, 1 mM dithiothreitol, 0.01% (w/v) bovine serum albumin, and 4.8 U of HindIII) at 4³C overnight. One hour before digestion, 20 Wl of 100 mM MgCl2 (¢nal concentration 10 mM) was added to the mixture which was then incubated on ice for 1 h. The reaction was started by elevating the temperature to 37³C for 10 min, and was stopped by adding 20 Wl of 0.5 M EDTA (pH 8.0) on ice. The partially digested DNA was fractionated in a 1% (w/v) SeaPlaque GTG agarose gel (FMC BioProducts) by CHEF electrophoresis in 0.5UTBE at 14³C, with a constant pulse time of 70 s for 5 h, followed by a constant pulse time of 6 s for 12 h at
6 V cm31 . Agarose slices containing fragments with sizes larger than 150 kb were excised from the gel and stored in 0.5 M EDTA (pH 8.0) at 4³C. 2.3. BAC library construction The gel slices (about 100 mg) were washed in 10 ml of TE bu¡er (10 mM Tris^HCl, pH 7.5, 1 mM EDTA) for 6 h at 4³C with a bu¡er change every hour. They were placed in a 1.5-ml tube, and NaCl was added to a ¢nal concentration of 50 mM. They were then melted at 68³C for 10 min and digested with 1 U of Gelase (Epicentre Technologies) at 42³C for 1.5 h. The DNA solution was directly used in the ligation reaction with the vector, pBeloBAC11 (Research Genetics) [19] that had been digested with HindIII and dephosphorylated with shrimp alkaline phosphatase (Boehringer-Mannheim). Ligation was carried out in a 100-Wl volume in which about 50 ng of the size-selected DNA (about 80 Wl) was ligated to 5 ng of pBeloBAC11 (1 Wl) with 40 U of T4 DNA ligase (New England Biolabs) at 16³C overnight. Before transformation, the ligation mixture was dialyzed against 0.2UTE bu¡er on a 0.025 Wm pore size ¢lter (VSWP 02500 (Millipore)) at 4³C for 2 h. Transformation of electrocompetent Escherichia coli DH10B (Gibco-BRL) was carried out by electroporation using a BTX Electro Cell Manipulator ECM395 at 12.5 kV cm31 , after which the cells were immediately transferred to 1 ml of SOC medium [27] and incubated at 37³C with agitation for 1 h. The cells were then spread on LB plates containing chloramphenicol (12.5 Wg ml31 ), X-gal (40 Wg ml31 ) and IPTG (12.5 Wg ml31 ), and then the plates were incubated at 37³C for 24 h. White colonies were picked out and transferred onto a new LB plate for a second color screening. The BAC clones were transferred to 96-well microtiter plates (Iwaki Glass) containing LB freezing bu¡er [20], incubated at 37³C for 24 h, and then stored at 380³C. 2.4. Preparation and analysis of BAC clones The BAC DNAs were prepared by the alkaline lysis method [27]. They were digested with HindIII or XbaI for 3 h before loading onto a 1% (w/v) agarose gel. The fragment sizes in each BAC clone were analyzed by CHEF electrophoresis in 0.5UTBE at 6 V cm31 with a switch time of 1 s for 12 h at 14³C. 2.5. BAC library screening The 192 BAC DNAs which have an average insert size of 107 kb (approximately ¢ve genome equivalents) were divided into 24 pools. PCRs were performed with a GeneAmp PCR System 2400 (PE Applied Biosystems) using the primers listed in Table 1. They were designed from sequences deposited in DDBJ and/or sequence data obtained in our laboratory. PCRs were carried out using
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65 Table 1 PCR primers used in this study Primera
5P^3P nucleotide sequence
Accession no./source
avrBs2F avrBs2R carBF carBR furF furR gumDF gumDR gyrBF gyrBR hrpB6F hrpB6R recAF recAR rpfCF rpfCR rpoBF rpoBR xpsFF xpsFR ITS F ITS R
TTCTTCAAGGCCAACGAC CTCGTTGGTGAGCTTTTG TGTATTCGACCTACGAGG ACGATTTCCAGCACGTCT ATGGAAACCCACGACCTG GCTTCTTGCGCACGTACA AAATGCACGCCACCTCTCGCCC AAATCAGTACGCGGTCTTCTGT ATCACATGGTGTTCGAGG TCGATCAGGGTGATCTTG AATGTGATCGTGCTGATCGG CAGCGTATTTTCGTAGGCAC CGCACTGAGCCAGATCGAAA TCTGGTTGCCGATGATCTCG TTGATCCTGGTTGGCGAA TCATCGCACGCAACAACG TGACATCGATCACCTGG AGGAAGCCGTACTGGTT TGTTGCGCAAGAAG CGTTGATCACCTTG TGAGCATGACGTCATC AGTTGCCTCGGAGCTA
AF114720
a
U81260 AF146830 X69956 laboratory
61
primer S and primer N (New England Biolabs). The nucleotide sequence was determined by the dideoxy chain termination method using an ABI Prism Big-Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems) and an ABI 310 Genetic Analyzer (PE Applied Biosystems). Comparisons of sequences with those deposited in the DNA Data Bank of Japan (DDBJ) were done using the FASTA programs. The DNA sequences of the hrpB region have been submitted to the DDBJ and were assigned accession numbers AB045311 and AB045312.
M99176 AF013600
3. Results
X97865
3.1. Construction of BAC library
laboratory
A BAC library of X. oryzae pv. oryzae MAFF 311018 was constructed by ligation of size-selected HindIII partially digested HMW DNA to the cloning vector pBeloBAC11, and was transformed into E. coli DH10B by elec-
AF190908 laboratory
F: forward primer; R: reverse primer.
an Expand High Fidelity PCR System (Boehringer-Mannheim) under the following protocol: an initial denaturation at 95³C for 5 min; 30 cycles of denaturation at 94³C for 1 min, annealing at 55³C for 1 min and extension at 72³C for 1 min; and a ¢nal extension at 72³C for 7 min. PCR products were electrophoresed in agarose and visualized after ethidium bromide staining. To con¢rm whether the BACs obtained were true positives or not, DNA from positive clones was digested with HindIII and separated by CHEF electrophoresis in 0.5UTBE at 6 V cm31 with a switch time of 1 s for 12 h at 14³C, followed by Southern hybridization analysis [5]. 2.6. Sequence of the hrp gene in a positive clone, 5A1 The hrp genes are known to be one of the more important sets of pathogenicity genes in bacteria. They encode proteins that show sequence similarity to putative components of various type III secretion systems [28]. Among the hrpB genes, hrpB6 is reported to be the most conserved [28]. To characterize the hrp gene region, the HindIII fragment in clone 5A1 (p5A1) that hybridized with the hrpB6 gene probe was digested with BamHI or EcoRI, subcloned into pUC19 (Takara Biomedicals), and then sequenced. A GPS-1 (Genome Priming System, New England Biolabs) was used to make DNA templates with randomly interspersed primer-binding sites. BAC or plasmid DNA preparations for sequencing were made using Qiawell8 plasmid kits (Qiagen). The sequencing primers for the 5P- and 3Pends of inserts in BACs and plasmids were 5P-CAGGAAACAGCTATGAC-3P and 5P-GTAAAACGACGGCCAGT-3P, respectively, and for the GPS-1 system were
Fig. 1. Analysis of insert size and insert size distribution in the X. oryzae pv. oryzae BAC library. A: Ethidium bromide-stained agarose gel showing 38 random BAC clones digested with HindIII and separated by CHEF electrophoresis. Lanes: 1 and 42, Gibco-BRL 5-kb ladder ; 2 and 41, Gibco-BRL 1-kb ladder ; 3^40, randomly selected BAC clones. Arrow indicates BAC vector. B: Two hundred and ¢fty randomly selected BAC clones were digested with HindIII and size separated using CHEF electrophoresis.
FEMSLE 9950 6-6-01
62
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
Table 2 Identi¢cation of BAC clones in the X. oryzae pv. oryzae MAFF 311018 library using PCR screening Gene/region
Function
No. of BACs identi¢ed
avrBs2 carB fur gumD gyrB hrpB6 recA rpfC rpoB xpsF 16S^23S spacer sequence
avirulence gene carbamoylphosphate synthetase (large subunit) ferric uptake regulator gene responsible for xanthan overproduction DNA gyrase (L subunit) hypersensitive reaction and pathogenicity gene recombination regulation of pathogenicity factor and virulence RNA polymerase (L subunit) membrane-associated protein 16S^23S rRNA gene transcribed spacer region (ITS)
7 9 3 2 3 6 8 9 2 5 17
troporation. Seven hundred and ¢fty clones were obtained, and were then transferred to eight 96-well plates for storage. The size of the cloned fragments in 250 of these BACs was determined by CHEF electrophoresis (Fig. 1A). The estimated insert size ranged from 20 to 220 kb, with an average size of 107 kb (Fig. 1B). Macrorestriction fragment analyses of MAFF 311018 genomes with rare-cutting enzymes PmeI and SwaI showed that genome size was approximately 4.8 Mb (unpublished data). Assuming a genome of this size, the 750-clone X. oryzae pv. oryzae MAFF 311018 BAC library should therefore correspond to about 16 genomic equivalents. Theoretically, the probability of ¢nding a particular clone in this library is greater than 99.9%. 3.2. BAC library screening We screened 192 BAC clones by PCR screening, representing more than ¢ve genome equivalents involving 10 genes and the 16S^23S rDNA spacer sequence. A total of 71 BAC putative positive clones were isolated with 2^17 BACs identi¢ed in each screening (Table 2). To determine whether these BACs were true positives or not, they were
digested with HindIII and analyzed by Southern hybridization. The results obtained with 10 of the 11 target genes showed similar banding patterns and the hybridizing bands were of the same size. In contrast, two di¡erent hybridizing bands (5.1 and 12.2 kb) were observed using the 16S^23S rDNA spacer probe in the 17 BAC clones (Fig. 2). To con¢rm this result, MAFF 311018 genomic DNA was digested with HindIII or BamHI and analyzed by Southern hybridization using the same probe. Similarly, two fragments were obtained, suggesting the presence of two rrn operons (data not shown). Based on these results, the average number of BAC clones isolated was found to be 5.9 per screening. This ¢gure is in good agreement with our estimate of 16 genome equivalents for the size of the library under study. 3.3. Comparison of overlapping hrp positive clones and analysis of p5A1 A total of six BAC clones were isolated by PCR screening of the library with the hrpB6 primer set. HindIII digestion of the clone DNAs showed that the clones had many similarly sized fragments (Fig. 3A). Each of the
Fig. 2. Analysis of BAC clones identi¢ed by PCR screening of the 16S^23S spacer sequence. A: Seventeen HindIII-digested BAC clones separated by CHEF electrophoresis. Lanes: 1 and 21, Gibco-BRL 5-kb ladder ; 2 and 20, Gibco-BRL 1-kb ladder; 3^19, HindIII-digested BAC clones. B: Southern hybridization of the gel in A with ECL-labeled 16S^23S spacer sequence.
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
63
Fig. 3. Comparison of HindIII digestion patterns of the BAC clones containing the hrpB6 gene and analysis of the HindIII fragment hybridized with the hrpB6 probe in p5A1. A: Ethidium bromide-stained agarose gel showing six BAC clones separated by CHEF electrophoresis. Lane 1, p5A1; lane 2, p1A7; lane 3, p6E9 ; lane 4, p6C10 ; lane 5, p5D9; lane 6, p5G2. A closed arrowhead indicates the BAC vector. B: Ethidium bromide-stained agarose gel showing the p5A1 and its subclones separated by CHEF electrophoresis. Lane 1, p5A1; lanes 2^5, subclones containing HindIII fragments from p5A1. A closed arrowhead indicates the BAC vector. C: Southern hybridization of the gel in B with ECL-labeled hrpB6 probe. An open arrowhead indicates the hybridized fragments.
fragments present in p5A1 was also found in at least one other clone, indicating that p5A1 was completely overlapped by other clones. A physical map of the 312-kb region surrounding the hrpB locus as shown in Fig. 4 was constructed based on the information from the HindIII restriction fragment pattern analysis. The order of HindIII fragments in clones other than p5A1, however, has not yet been determined. The p5A1 was composed of four HindIII fragments (11.5, 15.5, 17.5, and 32 kb), totaling 76.5 kb (Fig. 3B). To identify the fragment containing the hrpB6 gene, the p5A1 DNA was digested with HindIII and then religated to make a set of subclones containing a single HindIII fragment. Southern hybridization with the hrpB6 probe showed a signal which corre-
sponded to a 32-kb fragment (Fig. 3C). Partial sequence analysis of this fragment indicated that it covered the entire hrpB locus and a part of other hrp gene clusters (Fig. 4). 4. Discussion The use of BAC systems has greatly facilitated the construction of large insert-sized DNA libraries [17^26]. Such libraries are powerful tools for genome analysis, physical mapping, map-based cloning, and simple screening for speci¢c genomic sequences because of their low chimeric clone formation rates and high cloning e¤ciency. More-
Fig. 4. Construction of a BAC contig surrounding the hrpB6 gene and sequence analysis of the hrp region. Top: Six overlapping BAC clones forming the contig. Bottom: Restriction map and sequence region of the fragment containing hrpB6 gene. Two ¢lled bars indicate sequenced regions. The longer sequenced region (DDBJ accession number AB045311) contains the hrpA and hrpB gene clusters on its left-hand side and the other hrp gene clusters on its right, while the shorter sequenced region (DDBJ accession number AB045312) contains the hrpF gene. The vertical arrowheads indicate the location of hrpB6. The horizontal arrows indicate the directions of transcriptional units of the hrp genes.
FEMSLE 9950 6-6-01
64
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
over, they are easy to handle and can be stably maintained. For these reasons, we used a BAC system in the construction of the X. oryzae pv. oryzae MAFF 311018 BAC library. The average insert size of this BAC library is 107 kb. It is smaller than those of the majority of eukaryotic BAC libraries [18^21,23] but is quite comparable to or higher than other prokaryotic ones [24^26,29]. Assuming that the genome size of strain MAFF 311018 is 4.8 Mb, the present library represents approximately 16 genome equivalents. It indicates a 99.9% probability of ¢nding one speci¢c BAC clone when screening for a speci¢c sequence within the genome. The reliability of the constructed BAC library was con¢rmed by PCR screening analyses of 10 single copy genes and 16S^23S spacer region (ITS) using a set of 192 BAC clones representing approximately ¢ve genome equivalents. PCR screening and Southern hybridization with the ITS sequence as a probe revealed that there were two copies of rrn operons in the genome. This is consistent with previous reports for other Xanthomonas strains [15,16]. The average number of BAC clones isolated per screening, which was estimated to be 5.9, was only slightly higher than the expected library size, indicating that the quality of the constructed library was su¤cient to allow the isolation of BAC clones containing any speci¢c sequence of interest. The utility of the BAC library was also demonstrated by isolation of pathogenicity genes which are clustered in the genome such as hrp genes. The entire hrpB locus and a part of other hrp gene clusters were found to be covered by only one BAC clone. We believe that this library will serve as a good starting tool toward a more comprehensive analysis and understanding of the X. oryzae pv. oryzae genome. As a ¢rst step, we are now undertaking the construction of contigs of the whole genome using the constructed BAC library.
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13] [14]
[15]
Acknowledgements We thank M. Nishimura for technical advice about BAC library construction. We are grateful to E.G. Suto for a presubmission review of the manuscript. This work was supported by special coordination funds for promoting science and technology (from Ministry of Education, Culture, Sports, Science and Technology of Japan).
[16]
[17]
[18]
References [19] [1] Swings, J., Van den Moore, M., Vauterin, L., Hoste, B., Gillis, M., Mew, T.W. and Kersters, K. (1990) Reclassi¢cation of the causal agents of bacterial blight (Xanthomonas campestris pv. oryzae) and bacterial leaf streak (Xanthomonas campestris pv. oryzicola) of rice as pathovars of Xanthomonas oryzae (ex Ishiyama 1922) sp. nov., nom. rev. Int. J. Syst. Bacteriol. 40, 309^311. [2] Leung, H., Nelson, R.J. and Leach, J.E. (1993) Population structure
[20]
of plant pathogenic fungi and bacteria. Adv. Plant Pathol. 10, 157^ 250. Adhikari, T.A., Mew, T.W. and Leach, J.E. (1999) Genotypic and phenotypic diversity of Xanthomonas oryzae pv. oryzae in Nepal. Phytopathology 89, 687^694. Adhikari, T.A., Vera Cruz, C.M., Zhang, Q., Nelson, R.J., Skinner, D.Z., Mew, T.W. and Leach, J.E. (1995) Genetic diversity of Xanthomonas oryzae pv. oryzae in Asia. Appl. Environ. Microbiol. 61, 966^971. Ochiai, H., Horino, O., Miyajima, K. and Kaku, H. (2000) Genetic diversity of Xanthomonas oryzae pv. oryzae strains from Sri Lanka. Phytopathology 90, 415^421. George, M.L.C., Bustamam, M., Cruz, W.T., Leach, J.E. and Nelson, R.J. (1997) Movement of Xanthomonas oryzae pv. oryzae in Southeast Asia detected using PCR-based DNA ¢ngerprinting. Phytopathology 87, 302^309. Leach, J.E., Rhoads, M.L., Vera Cruz, C.M., White, F.F. and Mew, T.W. (1992) Assessment of genetic diversity and population structure of Xanthomonas oryzae pv. oryzae with a repetitive DNA element. Appl. Environ. Microbiol. 54, 2188^2195. Lee, S.W., Choi, S.H., Han, S.S., Lee, D.G. and Lee, B.Y. (1999) Distribution of Xanthomonas oryzae pv. oryzae strains virulent to Xa21 in Korea. Phytopathology 89, 928^933. Vera Cruz, C.M., Ardales, E.Y., Skinner, D.Z., Talag, J., Nelson, R.J., Louws, F.J., Leung, H., Mew, T.W. and Leach, J.E. (1996) Measurement of haplotypic variation in Xanthomonas oryzae pv. oryzae within a single ¢eld by rep-PCR and RFLP analyses. Phytopathology 86, 1352^1359. Hopkins, C.M., White, F.F., Choi, S.H., Guo, A. and Leach, J.E. (1992) A family of avirulence genes from Xanthomonas oryzae pv. oryzae. Mol. Plant-Microbe Interact. 5, 451^459. Zhu, W., Magbanua, M.M. and White, F.F. (2000) Identi¢cation of two novel hrp-associated genes in the hrp gene cluster of Xanthomonas oryzae pv. oryzae. J. Bacteriol. 182, 1844^1853. Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B. and White, F.F. (1998) AvrXA10 contains an acidic transcriptional activation domain in the functionally conserved C terminus. Mol. Plant-Microbe Interact. 11, 824^832. Cole, S.T. and Saint Girons, I. (1994) Bacterial genomics. FEMS Microbiol. Rev. 14, 139^160. Chan, J.W.Y.F. and Goodwin, P.H. (1999) A physical map of the chromosome of Xanthomonas campestris pv. phaseoli var. fuscans BXPF65. FEMS Microbiol. Lett. 180, 85^90. Tseng, Y.H., Choy, K.T., Hung, C.H., Lin, N.T., Liu, J.Y., Lou, C.H., Yang, B.Y., Wen, F.S., Weng, S.F. and Wu, J.R. (1999) Chromosome map of Xanthomonas campestris pv. campestris 17 with locations of genes involved in xanthan gum synthesis and yellow pigmentation. J. Bacteriol. 181, 117^125. Widjaja, R., Suwanto, A. and Tjahjono, B. (1999) Genome size and macrorestriction map of Xanthomonas campestris pv. glycines YR32 chromosome. FEMS Microbiol. Lett. 175, 59^68. Shizuya, H., Birren, B., Kim, U., Mancino, V., Slepak, T., Tachiiri, Y. and Simon, M. (1992) Cloning and stable maintenance of 300kilobase-pair fragment of human DNA in Escherichia coli using an Ffactor-based vector. Proc. Natl. Acad. Sci. USA 89, 8794^8797. Asakawa, S., Abe, I., Kudoh, Y., Kishi, N., Wang, Y., Kubota, R., Kudoh, J., Kawasaki, K., Minoshima, S. and Shimizu, N. (1997) Human BAC library : construction and rapid screening. Gene 191, 69^79. Kim, U., Birren, B., Slepak, T., Mancino, V., Boysen, C., Kang, H., Simon, M. and Shizuya, H. (1996) Construction and characterization of a human bacterial arti¢cial chromosome library. Genomics 34, 213^218. Nakamura, S., Asakawa, S., Ohmido, N., Fukui, K., Shimizu, N. and Kawasaki, S. (1997) Construction of an 800-kb contig in the near centromeric region of rice blast resistance gene Pi-ta2 using a highly representative rice BAC library. Mol. Gen. Genet. 254, 611^620.
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65 [21] Woo, S.S., Jiang, J., Gill, B., Paterson, A.H. and Wing, R.A. (1994) Construction and characterization of a bacterial arti¢cial chromosome library of Sorghum bicolor. Nucleic Acids Res. 22, 4922^4931. [22] Diaz-Perez, S.V., Crouch, V.W. and Orbach, M.J. (1996) Construction and characterization of a Magnaporthe grisea bacterial arti¢cial chromosome library. Fungal Genet. Biol. 20, 280^288. [23] Nishimura, M., Nakamura, S., Hayashi, N., Asakawa, S., Shimizu, N., Kaku, H., Hasebe, A. and Kawasaki, S. (1998) Construction of a BAC library of the rice blast fungus Magnaporthe grisea and ¢nding speci¢c genome regions in which its transposons tend to cluster. Biosci. Biotechnol. Biochem. 62, 1515^1521. [24] Brosch, R., Gordon, S.V., Billault, A., Garnier, T., Eiglmeier, K., Soravito, C., Barrell, B.G. and Cole, S.T. (1998) Use of a Mycobacterium tuberculosis H37Rv bacterial arti¢cial chromosome library for genome mapping, sequencing, and comparative genomics. Infect. Immun. 66, 2221^2229. [25] Dewar, K., Sabbagh, L., Cardinal, G., Veilleux, F., Sanschagrin, F., Birren, B. and Levesque, R.C. (1998) Pseudomonas aeruginosa PAO1 bacterial arti¢cial chromosomes : strategies for mapping, screening,
[26]
[27]
[28]
[29]
65
and sequencing 100 kb loci of the 5.9 Mb genome. Microb. Comp. Genomics 2, 105^117. Diaz-Perez, S.V., Alatriste-Mondragon, F., Hernandez, R., Birren, B. and Gunsalus, R.P. (1997) Bacterial arti¢cial chromosome (BAC) library as a tool for physical mapping of the archaeon Methanosarcina thermophila TM-1. Microb. Comp. Genomics 2, 275^286. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Fenselau, S. and Bonas, U. (1995) Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. PlantMicrobe Interact. 8, 845^854. Capela, D., Barloy-Hubler, F., Gatius, M.T., Gouzy, J. and Galibert, F. (1999) A high-density physical map of Sinorhizobium meliloti 1021 chromosome derived from bacterial arti¢cial chromosome library. Proc. Natl. Acad. Sci. USA 96, 9357^9362.
FEMSLE 9950 6-6-01
www.fems-microbiology.org
Construction and characterization of a Xanthomonas oryzae pv. oryzae bacterial arti¢cial chromosome library Hirokazu Ochiai *, Yasuhiro Inoue, Akira Hasebe, Hisatoshi Kaku Department of Genetic Resources, National Institute of Agrobiological Sciences, Kannondai, Tsukuba 305-8602, Japan Received 26 January 2001; received in revised form 16 April 2001; accepted 18 April 2001 First published online 11 May 2001
Abstract Xanthomonas oryzae pv. oryzae is an important plant pathogen which causes bacterial blight of rice. To facilitate genome studies of this bacterium, we have constructed a bacterial artificial chromosome (BAC) library of strain MAFF 311018. It consisted of 750 clones representing 16 genome equivalents, and had an insert size ranging from 20 to 220 kb with an average size of 107 kb. This library is the first to be constructed from a X. oryzae pv. oryzae strain. The usefulness of this library was demonstrated through polymerase chain reaction screening of 11 genes and the 16S^23S rDNA spacer region in a 192-clone subset, representing five genome equivalents. The results obtained showed an average of 5.9 BAC clones per screening. This result is in good agreement with the estimated size of the test library, indicating that the constructed BAC library can be used to facilitate genome analysis of X. oryzae pv. oryzae. ß 2001 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies. Keywords : Xanthomonas oryzae pv. oryzae; Bacterial arti¢cial chromosome ; hrp gene cluster
1. Introduction Xanthomonas oryzae pv. oryzae [1] is a plant pathogen that causes bacterial blight on rice cultivars, one of the most destructive diseases of rice in Asia. The most promising method of controlling this disease is the use of resistant cultivars. However, most resistance genes provide effective and stable protection only against subpopulations of the pathogen [2]. In order to guide the selection and deployment of resistance genes, the population structure of this pathogen has been studied extensively [3^9]. X. oryzae pv. oryzae has been used as a model organism for studying various aspects of host^pathogen interactions. Although a few pathogenicity-related genes such as avirulence genes have been cloned and analyzed [10^ 12], information about their functions and knowledge of the molecular mechanisms involved are limited. Recently, physical maps of many bacterial genomes have been constructed using pulse-¢eld gel electrophoresis (PFGE) [13]. In xanthomonads, the physical maps of
* Corresponding author. Tel. : +81 (298) 38 7452; Fax: +81 (298) 38 7408; E-mail : [email protected]¡rc.go.jp
Xanthomonas campestris pv. campestris, Xanthomonas axonopodis pv. glycines and pv. phaseoli genomes have been reported [14^16]. However, little is known about the genome structure and genetic maps of pathogenicity-related genes in X. oryzae pv. oryzae. This prompted us to undertake the construction of a physical and genetic map of this pathogen. The development of bacterial arti¢cial chromosome (BAC) systems has allowed the construction of large insert-sized DNA libraries [17]. Compared with YAC and cosmid cloning, BAC has a lower rate of chimerism and higher e¤ciency of cloning. It is also easier to handle and is more stably maintained. To date, BAC libraries have been constructed in many kinds of organisms, e.g. human [18,19], plants [20,21], fungi [22,23], and bacteria [24^26], and have become a powerful tool for genome analysis. Because it employs large-sized DNA inserts, the BAC system o¡ers the following signi¢cant advantages for cloning and analysis of bacterial genomes: (i) it requires only a relatively small number of clones to provide complete coverage of the bacterial genome, and (ii) it facilitates cloning of clustered genes, such as those for certain metabolic processes, for secretion, or for pathogenicity (e.g. hrp genes). Therefore, we chose a BAC system and constructed a
0378-1097 / 01 / $20.00 ß 2001 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 1 9 4 - X
FEMSLE 9950 6-6-01
60
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
BAC library of the X. oryzae pv. oryzae MAFF 311018 genome as a ¢rst step in genome analysis of this pathogen. The constructed BAC library will facilitate genome studies, ¢ne mapping, and cloning of pathogenicity-related gene loci of X. oryzae pv. oryzae. 2. Materials and methods 2.1. Preparation of high molecular weight (HMW) DNA X. oryzae pv. oryzae strain MAFF 311018 (T7174), a Japanese representative strain of race I, was used in this study. The strain was grown in 15 ml of LB medium [27] to the late exponential phase at 28³C. Cells (2.5U109 CFU ml31 ) were washed in cell suspension bu¡er (10 mM Tris^ HCl, 20 mM NaCl, 50 mM EDTA, pH 7.2) and resuspended in 1 ml of a cell suspension bu¡er. An equal volume of an agarose solution (0.7 M sorbitol, 0.125 M EDTA, 2% (w/v) InCert agarose (FMC BioProducts)) was added to the washed cells. The mixture was poured into plastic plug molds (Bio-Rad) and solidi¢ed at 4³C for 10 min. The agarose plugs containing DNA (¢nal cell density: 1.25U108 per plug) were treated in 5 ml of a lysozyme solution (10 mM Tris^HCl, pH 7.2, 50 mM NaCl, 0.2% (w/v) sodium deoxycholate, 0.5% (w/v) sodium lauryl sarcosine, 1 mg ml31 lysozyme) at 37³C for 1 h without agitation, and then incubated in 5 ml of a proteinase K solution (100 mM EDTA, pH 8.0, 0.2% (w/v) sodium deoxycholate, 1.0% (w/v) sodium lauryl sarcosine, 1 mg ml31 proteinase K) at 50³C for 72 h without agitation. The latter solution was changed after 24 and 48 h. The plugs were washed six times in 25 ml of a wash bu¡er (20 mM Tris^HCl, pH 8.0, 50 mM EDTA) for 1 h each at 4³C with gentle agitation and stored at 4³C. Before the restriction enzyme reaction, the plugs were washed six times in 25 ml of TE bu¡er (10 mM Tris^HCl, pH 8.0, 1 mM EDTA) for 1 h each at 4³C with gentle agitation. 2.2. Partial digestion and size fractionation The plugs (about 50 mg) were equilibrated with 180 Wl of HindIII digestion bu¡er lacking MgCl2 (10 mM Tris^ HCl, pH 7.5, 50 mM NaCl, 1 mM dithiothreitol, 0.01% (w/v) bovine serum albumin, and 4.8 U of HindIII) at 4³C overnight. One hour before digestion, 20 Wl of 100 mM MgCl2 (¢nal concentration 10 mM) was added to the mixture which was then incubated on ice for 1 h. The reaction was started by elevating the temperature to 37³C for 10 min, and was stopped by adding 20 Wl of 0.5 M EDTA (pH 8.0) on ice. The partially digested DNA was fractionated in a 1% (w/v) SeaPlaque GTG agarose gel (FMC BioProducts) by CHEF electrophoresis in 0.5UTBE at 14³C, with a constant pulse time of 70 s for 5 h, followed by a constant pulse time of 6 s for 12 h at
6 V cm31 . Agarose slices containing fragments with sizes larger than 150 kb were excised from the gel and stored in 0.5 M EDTA (pH 8.0) at 4³C. 2.3. BAC library construction The gel slices (about 100 mg) were washed in 10 ml of TE bu¡er (10 mM Tris^HCl, pH 7.5, 1 mM EDTA) for 6 h at 4³C with a bu¡er change every hour. They were placed in a 1.5-ml tube, and NaCl was added to a ¢nal concentration of 50 mM. They were then melted at 68³C for 10 min and digested with 1 U of Gelase (Epicentre Technologies) at 42³C for 1.5 h. The DNA solution was directly used in the ligation reaction with the vector, pBeloBAC11 (Research Genetics) [19] that had been digested with HindIII and dephosphorylated with shrimp alkaline phosphatase (Boehringer-Mannheim). Ligation was carried out in a 100-Wl volume in which about 50 ng of the size-selected DNA (about 80 Wl) was ligated to 5 ng of pBeloBAC11 (1 Wl) with 40 U of T4 DNA ligase (New England Biolabs) at 16³C overnight. Before transformation, the ligation mixture was dialyzed against 0.2UTE bu¡er on a 0.025 Wm pore size ¢lter (VSWP 02500 (Millipore)) at 4³C for 2 h. Transformation of electrocompetent Escherichia coli DH10B (Gibco-BRL) was carried out by electroporation using a BTX Electro Cell Manipulator ECM395 at 12.5 kV cm31 , after which the cells were immediately transferred to 1 ml of SOC medium [27] and incubated at 37³C with agitation for 1 h. The cells were then spread on LB plates containing chloramphenicol (12.5 Wg ml31 ), X-gal (40 Wg ml31 ) and IPTG (12.5 Wg ml31 ), and then the plates were incubated at 37³C for 24 h. White colonies were picked out and transferred onto a new LB plate for a second color screening. The BAC clones were transferred to 96-well microtiter plates (Iwaki Glass) containing LB freezing bu¡er [20], incubated at 37³C for 24 h, and then stored at 380³C. 2.4. Preparation and analysis of BAC clones The BAC DNAs were prepared by the alkaline lysis method [27]. They were digested with HindIII or XbaI for 3 h before loading onto a 1% (w/v) agarose gel. The fragment sizes in each BAC clone were analyzed by CHEF electrophoresis in 0.5UTBE at 6 V cm31 with a switch time of 1 s for 12 h at 14³C. 2.5. BAC library screening The 192 BAC DNAs which have an average insert size of 107 kb (approximately ¢ve genome equivalents) were divided into 24 pools. PCRs were performed with a GeneAmp PCR System 2400 (PE Applied Biosystems) using the primers listed in Table 1. They were designed from sequences deposited in DDBJ and/or sequence data obtained in our laboratory. PCRs were carried out using
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65 Table 1 PCR primers used in this study Primera
5P^3P nucleotide sequence
Accession no./source
avrBs2F avrBs2R carBF carBR furF furR gumDF gumDR gyrBF gyrBR hrpB6F hrpB6R recAF recAR rpfCF rpfCR rpoBF rpoBR xpsFF xpsFR ITS F ITS R
TTCTTCAAGGCCAACGAC CTCGTTGGTGAGCTTTTG TGTATTCGACCTACGAGG ACGATTTCCAGCACGTCT ATGGAAACCCACGACCTG GCTTCTTGCGCACGTACA AAATGCACGCCACCTCTCGCCC AAATCAGTACGCGGTCTTCTGT ATCACATGGTGTTCGAGG TCGATCAGGGTGATCTTG AATGTGATCGTGCTGATCGG CAGCGTATTTTCGTAGGCAC CGCACTGAGCCAGATCGAAA TCTGGTTGCCGATGATCTCG TTGATCCTGGTTGGCGAA TCATCGCACGCAACAACG TGACATCGATCACCTGG AGGAAGCCGTACTGGTT TGTTGCGCAAGAAG CGTTGATCACCTTG TGAGCATGACGTCATC AGTTGCCTCGGAGCTA
AF114720
a
U81260 AF146830 X69956 laboratory
61
primer S and primer N (New England Biolabs). The nucleotide sequence was determined by the dideoxy chain termination method using an ABI Prism Big-Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems) and an ABI 310 Genetic Analyzer (PE Applied Biosystems). Comparisons of sequences with those deposited in the DNA Data Bank of Japan (DDBJ) were done using the FASTA programs. The DNA sequences of the hrpB region have been submitted to the DDBJ and were assigned accession numbers AB045311 and AB045312.
M99176 AF013600
3. Results
X97865
3.1. Construction of BAC library
laboratory
A BAC library of X. oryzae pv. oryzae MAFF 311018 was constructed by ligation of size-selected HindIII partially digested HMW DNA to the cloning vector pBeloBAC11, and was transformed into E. coli DH10B by elec-
AF190908 laboratory
F: forward primer; R: reverse primer.
an Expand High Fidelity PCR System (Boehringer-Mannheim) under the following protocol: an initial denaturation at 95³C for 5 min; 30 cycles of denaturation at 94³C for 1 min, annealing at 55³C for 1 min and extension at 72³C for 1 min; and a ¢nal extension at 72³C for 7 min. PCR products were electrophoresed in agarose and visualized after ethidium bromide staining. To con¢rm whether the BACs obtained were true positives or not, DNA from positive clones was digested with HindIII and separated by CHEF electrophoresis in 0.5UTBE at 6 V cm31 with a switch time of 1 s for 12 h at 14³C, followed by Southern hybridization analysis [5]. 2.6. Sequence of the hrp gene in a positive clone, 5A1 The hrp genes are known to be one of the more important sets of pathogenicity genes in bacteria. They encode proteins that show sequence similarity to putative components of various type III secretion systems [28]. Among the hrpB genes, hrpB6 is reported to be the most conserved [28]. To characterize the hrp gene region, the HindIII fragment in clone 5A1 (p5A1) that hybridized with the hrpB6 gene probe was digested with BamHI or EcoRI, subcloned into pUC19 (Takara Biomedicals), and then sequenced. A GPS-1 (Genome Priming System, New England Biolabs) was used to make DNA templates with randomly interspersed primer-binding sites. BAC or plasmid DNA preparations for sequencing were made using Qiawell8 plasmid kits (Qiagen). The sequencing primers for the 5P- and 3Pends of inserts in BACs and plasmids were 5P-CAGGAAACAGCTATGAC-3P and 5P-GTAAAACGACGGCCAGT-3P, respectively, and for the GPS-1 system were
Fig. 1. Analysis of insert size and insert size distribution in the X. oryzae pv. oryzae BAC library. A: Ethidium bromide-stained agarose gel showing 38 random BAC clones digested with HindIII and separated by CHEF electrophoresis. Lanes: 1 and 42, Gibco-BRL 5-kb ladder ; 2 and 41, Gibco-BRL 1-kb ladder ; 3^40, randomly selected BAC clones. Arrow indicates BAC vector. B: Two hundred and ¢fty randomly selected BAC clones were digested with HindIII and size separated using CHEF electrophoresis.
FEMSLE 9950 6-6-01
62
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
Table 2 Identi¢cation of BAC clones in the X. oryzae pv. oryzae MAFF 311018 library using PCR screening Gene/region
Function
No. of BACs identi¢ed
avrBs2 carB fur gumD gyrB hrpB6 recA rpfC rpoB xpsF 16S^23S spacer sequence
avirulence gene carbamoylphosphate synthetase (large subunit) ferric uptake regulator gene responsible for xanthan overproduction DNA gyrase (L subunit) hypersensitive reaction and pathogenicity gene recombination regulation of pathogenicity factor and virulence RNA polymerase (L subunit) membrane-associated protein 16S^23S rRNA gene transcribed spacer region (ITS)
7 9 3 2 3 6 8 9 2 5 17
troporation. Seven hundred and ¢fty clones were obtained, and were then transferred to eight 96-well plates for storage. The size of the cloned fragments in 250 of these BACs was determined by CHEF electrophoresis (Fig. 1A). The estimated insert size ranged from 20 to 220 kb, with an average size of 107 kb (Fig. 1B). Macrorestriction fragment analyses of MAFF 311018 genomes with rare-cutting enzymes PmeI and SwaI showed that genome size was approximately 4.8 Mb (unpublished data). Assuming a genome of this size, the 750-clone X. oryzae pv. oryzae MAFF 311018 BAC library should therefore correspond to about 16 genomic equivalents. Theoretically, the probability of ¢nding a particular clone in this library is greater than 99.9%. 3.2. BAC library screening We screened 192 BAC clones by PCR screening, representing more than ¢ve genome equivalents involving 10 genes and the 16S^23S rDNA spacer sequence. A total of 71 BAC putative positive clones were isolated with 2^17 BACs identi¢ed in each screening (Table 2). To determine whether these BACs were true positives or not, they were
digested with HindIII and analyzed by Southern hybridization. The results obtained with 10 of the 11 target genes showed similar banding patterns and the hybridizing bands were of the same size. In contrast, two di¡erent hybridizing bands (5.1 and 12.2 kb) were observed using the 16S^23S rDNA spacer probe in the 17 BAC clones (Fig. 2). To con¢rm this result, MAFF 311018 genomic DNA was digested with HindIII or BamHI and analyzed by Southern hybridization using the same probe. Similarly, two fragments were obtained, suggesting the presence of two rrn operons (data not shown). Based on these results, the average number of BAC clones isolated was found to be 5.9 per screening. This ¢gure is in good agreement with our estimate of 16 genome equivalents for the size of the library under study. 3.3. Comparison of overlapping hrp positive clones and analysis of p5A1 A total of six BAC clones were isolated by PCR screening of the library with the hrpB6 primer set. HindIII digestion of the clone DNAs showed that the clones had many similarly sized fragments (Fig. 3A). Each of the
Fig. 2. Analysis of BAC clones identi¢ed by PCR screening of the 16S^23S spacer sequence. A: Seventeen HindIII-digested BAC clones separated by CHEF electrophoresis. Lanes: 1 and 21, Gibco-BRL 5-kb ladder ; 2 and 20, Gibco-BRL 1-kb ladder; 3^19, HindIII-digested BAC clones. B: Southern hybridization of the gel in A with ECL-labeled 16S^23S spacer sequence.
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
63
Fig. 3. Comparison of HindIII digestion patterns of the BAC clones containing the hrpB6 gene and analysis of the HindIII fragment hybridized with the hrpB6 probe in p5A1. A: Ethidium bromide-stained agarose gel showing six BAC clones separated by CHEF electrophoresis. Lane 1, p5A1; lane 2, p1A7; lane 3, p6E9 ; lane 4, p6C10 ; lane 5, p5D9; lane 6, p5G2. A closed arrowhead indicates the BAC vector. B: Ethidium bromide-stained agarose gel showing the p5A1 and its subclones separated by CHEF electrophoresis. Lane 1, p5A1; lanes 2^5, subclones containing HindIII fragments from p5A1. A closed arrowhead indicates the BAC vector. C: Southern hybridization of the gel in B with ECL-labeled hrpB6 probe. An open arrowhead indicates the hybridized fragments.
fragments present in p5A1 was also found in at least one other clone, indicating that p5A1 was completely overlapped by other clones. A physical map of the 312-kb region surrounding the hrpB locus as shown in Fig. 4 was constructed based on the information from the HindIII restriction fragment pattern analysis. The order of HindIII fragments in clones other than p5A1, however, has not yet been determined. The p5A1 was composed of four HindIII fragments (11.5, 15.5, 17.5, and 32 kb), totaling 76.5 kb (Fig. 3B). To identify the fragment containing the hrpB6 gene, the p5A1 DNA was digested with HindIII and then religated to make a set of subclones containing a single HindIII fragment. Southern hybridization with the hrpB6 probe showed a signal which corre-
sponded to a 32-kb fragment (Fig. 3C). Partial sequence analysis of this fragment indicated that it covered the entire hrpB locus and a part of other hrp gene clusters (Fig. 4). 4. Discussion The use of BAC systems has greatly facilitated the construction of large insert-sized DNA libraries [17^26]. Such libraries are powerful tools for genome analysis, physical mapping, map-based cloning, and simple screening for speci¢c genomic sequences because of their low chimeric clone formation rates and high cloning e¤ciency. More-
Fig. 4. Construction of a BAC contig surrounding the hrpB6 gene and sequence analysis of the hrp region. Top: Six overlapping BAC clones forming the contig. Bottom: Restriction map and sequence region of the fragment containing hrpB6 gene. Two ¢lled bars indicate sequenced regions. The longer sequenced region (DDBJ accession number AB045311) contains the hrpA and hrpB gene clusters on its left-hand side and the other hrp gene clusters on its right, while the shorter sequenced region (DDBJ accession number AB045312) contains the hrpF gene. The vertical arrowheads indicate the location of hrpB6. The horizontal arrows indicate the directions of transcriptional units of the hrp genes.
FEMSLE 9950 6-6-01
64
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65
over, they are easy to handle and can be stably maintained. For these reasons, we used a BAC system in the construction of the X. oryzae pv. oryzae MAFF 311018 BAC library. The average insert size of this BAC library is 107 kb. It is smaller than those of the majority of eukaryotic BAC libraries [18^21,23] but is quite comparable to or higher than other prokaryotic ones [24^26,29]. Assuming that the genome size of strain MAFF 311018 is 4.8 Mb, the present library represents approximately 16 genome equivalents. It indicates a 99.9% probability of ¢nding one speci¢c BAC clone when screening for a speci¢c sequence within the genome. The reliability of the constructed BAC library was con¢rmed by PCR screening analyses of 10 single copy genes and 16S^23S spacer region (ITS) using a set of 192 BAC clones representing approximately ¢ve genome equivalents. PCR screening and Southern hybridization with the ITS sequence as a probe revealed that there were two copies of rrn operons in the genome. This is consistent with previous reports for other Xanthomonas strains [15,16]. The average number of BAC clones isolated per screening, which was estimated to be 5.9, was only slightly higher than the expected library size, indicating that the quality of the constructed library was su¤cient to allow the isolation of BAC clones containing any speci¢c sequence of interest. The utility of the BAC library was also demonstrated by isolation of pathogenicity genes which are clustered in the genome such as hrp genes. The entire hrpB locus and a part of other hrp gene clusters were found to be covered by only one BAC clone. We believe that this library will serve as a good starting tool toward a more comprehensive analysis and understanding of the X. oryzae pv. oryzae genome. As a ¢rst step, we are now undertaking the construction of contigs of the whole genome using the constructed BAC library.
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13] [14]
[15]
Acknowledgements We thank M. Nishimura for technical advice about BAC library construction. We are grateful to E.G. Suto for a presubmission review of the manuscript. This work was supported by special coordination funds for promoting science and technology (from Ministry of Education, Culture, Sports, Science and Technology of Japan).
[16]
[17]
[18]
References [19] [1] Swings, J., Van den Moore, M., Vauterin, L., Hoste, B., Gillis, M., Mew, T.W. and Kersters, K. (1990) Reclassi¢cation of the causal agents of bacterial blight (Xanthomonas campestris pv. oryzae) and bacterial leaf streak (Xanthomonas campestris pv. oryzicola) of rice as pathovars of Xanthomonas oryzae (ex Ishiyama 1922) sp. nov., nom. rev. Int. J. Syst. Bacteriol. 40, 309^311. [2] Leung, H., Nelson, R.J. and Leach, J.E. (1993) Population structure
[20]
of plant pathogenic fungi and bacteria. Adv. Plant Pathol. 10, 157^ 250. Adhikari, T.A., Mew, T.W. and Leach, J.E. (1999) Genotypic and phenotypic diversity of Xanthomonas oryzae pv. oryzae in Nepal. Phytopathology 89, 687^694. Adhikari, T.A., Vera Cruz, C.M., Zhang, Q., Nelson, R.J., Skinner, D.Z., Mew, T.W. and Leach, J.E. (1995) Genetic diversity of Xanthomonas oryzae pv. oryzae in Asia. Appl. Environ. Microbiol. 61, 966^971. Ochiai, H., Horino, O., Miyajima, K. and Kaku, H. (2000) Genetic diversity of Xanthomonas oryzae pv. oryzae strains from Sri Lanka. Phytopathology 90, 415^421. George, M.L.C., Bustamam, M., Cruz, W.T., Leach, J.E. and Nelson, R.J. (1997) Movement of Xanthomonas oryzae pv. oryzae in Southeast Asia detected using PCR-based DNA ¢ngerprinting. Phytopathology 87, 302^309. Leach, J.E., Rhoads, M.L., Vera Cruz, C.M., White, F.F. and Mew, T.W. (1992) Assessment of genetic diversity and population structure of Xanthomonas oryzae pv. oryzae with a repetitive DNA element. Appl. Environ. Microbiol. 54, 2188^2195. Lee, S.W., Choi, S.H., Han, S.S., Lee, D.G. and Lee, B.Y. (1999) Distribution of Xanthomonas oryzae pv. oryzae strains virulent to Xa21 in Korea. Phytopathology 89, 928^933. Vera Cruz, C.M., Ardales, E.Y., Skinner, D.Z., Talag, J., Nelson, R.J., Louws, F.J., Leung, H., Mew, T.W. and Leach, J.E. (1996) Measurement of haplotypic variation in Xanthomonas oryzae pv. oryzae within a single ¢eld by rep-PCR and RFLP analyses. Phytopathology 86, 1352^1359. Hopkins, C.M., White, F.F., Choi, S.H., Guo, A. and Leach, J.E. (1992) A family of avirulence genes from Xanthomonas oryzae pv. oryzae. Mol. Plant-Microbe Interact. 5, 451^459. Zhu, W., Magbanua, M.M. and White, F.F. (2000) Identi¢cation of two novel hrp-associated genes in the hrp gene cluster of Xanthomonas oryzae pv. oryzae. J. Bacteriol. 182, 1844^1853. Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B. and White, F.F. (1998) AvrXA10 contains an acidic transcriptional activation domain in the functionally conserved C terminus. Mol. Plant-Microbe Interact. 11, 824^832. Cole, S.T. and Saint Girons, I. (1994) Bacterial genomics. FEMS Microbiol. Rev. 14, 139^160. Chan, J.W.Y.F. and Goodwin, P.H. (1999) A physical map of the chromosome of Xanthomonas campestris pv. phaseoli var. fuscans BXPF65. FEMS Microbiol. Lett. 180, 85^90. Tseng, Y.H., Choy, K.T., Hung, C.H., Lin, N.T., Liu, J.Y., Lou, C.H., Yang, B.Y., Wen, F.S., Weng, S.F. and Wu, J.R. (1999) Chromosome map of Xanthomonas campestris pv. campestris 17 with locations of genes involved in xanthan gum synthesis and yellow pigmentation. J. Bacteriol. 181, 117^125. Widjaja, R., Suwanto, A. and Tjahjono, B. (1999) Genome size and macrorestriction map of Xanthomonas campestris pv. glycines YR32 chromosome. FEMS Microbiol. Lett. 175, 59^68. Shizuya, H., Birren, B., Kim, U., Mancino, V., Slepak, T., Tachiiri, Y. and Simon, M. (1992) Cloning and stable maintenance of 300kilobase-pair fragment of human DNA in Escherichia coli using an Ffactor-based vector. Proc. Natl. Acad. Sci. USA 89, 8794^8797. Asakawa, S., Abe, I., Kudoh, Y., Kishi, N., Wang, Y., Kubota, R., Kudoh, J., Kawasaki, K., Minoshima, S. and Shimizu, N. (1997) Human BAC library : construction and rapid screening. Gene 191, 69^79. Kim, U., Birren, B., Slepak, T., Mancino, V., Boysen, C., Kang, H., Simon, M. and Shizuya, H. (1996) Construction and characterization of a human bacterial arti¢cial chromosome library. Genomics 34, 213^218. Nakamura, S., Asakawa, S., Ohmido, N., Fukui, K., Shimizu, N. and Kawasaki, S. (1997) Construction of an 800-kb contig in the near centromeric region of rice blast resistance gene Pi-ta2 using a highly representative rice BAC library. Mol. Gen. Genet. 254, 611^620.
FEMSLE 9950 6-6-01
H. Ochiai et al. / FEMS Microbiology Letters 200 (2001) 59^65 [21] Woo, S.S., Jiang, J., Gill, B., Paterson, A.H. and Wing, R.A. (1994) Construction and characterization of a bacterial arti¢cial chromosome library of Sorghum bicolor. Nucleic Acids Res. 22, 4922^4931. [22] Diaz-Perez, S.V., Crouch, V.W. and Orbach, M.J. (1996) Construction and characterization of a Magnaporthe grisea bacterial arti¢cial chromosome library. Fungal Genet. Biol. 20, 280^288. [23] Nishimura, M., Nakamura, S., Hayashi, N., Asakawa, S., Shimizu, N., Kaku, H., Hasebe, A. and Kawasaki, S. (1998) Construction of a BAC library of the rice blast fungus Magnaporthe grisea and ¢nding speci¢c genome regions in which its transposons tend to cluster. Biosci. Biotechnol. Biochem. 62, 1515^1521. [24] Brosch, R., Gordon, S.V., Billault, A., Garnier, T., Eiglmeier, K., Soravito, C., Barrell, B.G. and Cole, S.T. (1998) Use of a Mycobacterium tuberculosis H37Rv bacterial arti¢cial chromosome library for genome mapping, sequencing, and comparative genomics. Infect. Immun. 66, 2221^2229. [25] Dewar, K., Sabbagh, L., Cardinal, G., Veilleux, F., Sanschagrin, F., Birren, B. and Levesque, R.C. (1998) Pseudomonas aeruginosa PAO1 bacterial arti¢cial chromosomes : strategies for mapping, screening,
[26]
[27]
[28]
[29]
65
and sequencing 100 kb loci of the 5.9 Mb genome. Microb. Comp. Genomics 2, 105^117. Diaz-Perez, S.V., Alatriste-Mondragon, F., Hernandez, R., Birren, B. and Gunsalus, R.P. (1997) Bacterial arti¢cial chromosome (BAC) library as a tool for physical mapping of the archaeon Methanosarcina thermophila TM-1. Microb. Comp. Genomics 2, 275^286. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Fenselau, S. and Bonas, U. (1995) Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. PlantMicrobe Interact. 8, 845^854. Capela, D., Barloy-Hubler, F., Gatius, M.T., Gouzy, J. and Galibert, F. (1999) A high-density physical map of Sinorhizobium meliloti 1021 chromosome derived from bacterial arti¢cial chromosome library. Proc. Natl. Acad. Sci. USA 96, 9357^9362.
FEMSLE 9950 6-6-01