Construction and immune efficacy of recombinant Lactobacillus casei strains expressing Malt from Aeromonas veronii

Microbial Pathogenesis 141 (2020) 103918

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Construction and immune efficacy of recombinant Lactobacillus casei strains expressing Malt from Aeromonas veronii

T

An-Qi Ju, Shu-bao Yang, Hai-Peng Zhang, Xin Ma, Dong-Xing Zhang, Yuan-huan Kang, Qiu-mei Shi, Tong-lei Wu, Gui-Qin Wang, Ai-Dong Qian, Xiao-feng Shan∗, Wei-Min Luan∗∗ College of Animal Science and Technology, Jilin Agricultural University, Changchun, 130118, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Malt Common carp Aeromonas veronii Vaccine immune response Lactobacillus casei

Aeromonas veronii is an important zoonotic pathogen that causes significant economic losses in the aquaculture industry. The use of probiotics in aquaculture is a practical alternative to antibiotics to promote animal health and aid in disease prevention. In the present study, we aimed to construct a recombinant Lactobacillus casei (surface-displayed or secretory) strain containing Malt from A. veronii TH0426 and assess its potential as an oral vaccine. A 1314-bp Malt gene fragment was successfully amplified and cloned into a prokaryotic protein expression system. Protein expression in resulting recombinant strains Lc-MCS-Malt (surface-displayed) and LcpPG-Malt (secretory) was then verified by Western blotting and indirect immunofluorescence. A single band was observed on the Western blots, with the molecular weight of the corresponding protein shown to be 48 kDa. Furthermore, a fluorescent signal for Lc-MCS-Malt was observed by fluorescence microscopy. At 0, 7, 16, 25, and 34 days post-immunization, tissue and blood samples were collected from common carp orally administered with the recombinant L. casei strains for immune-related index analyses. Treatment of common carp with the recombinant vaccine candidate stimulated high serum or skin mucus specific antibody titers and induced a higher lysozyme, ACP, SOD activity, while fish fed with Lc-pPG or PBS had no detectable immobilizing immune responses. Expression of IL-10, IL-1β, TNF-α, and IFN-γ genes in the group immunized with recombinant L. casei were significantly (P < 0.05) up regulated as compared with control groups, indicating that inflammatory response and cell immune response were triggered. Results also showed that recombinant L. casei could stimulate the mucosa through colonization of the intestine, resulting in increased transcription of IL-10, IL-1β, TNF-α, and IFN-γ. Immunity and colonization assays also showed that after 34 days of fasting, recombinant L. casei were still present in the intestines of the immunized fish. Common carp that received Lc-MCS-Malt(53.3%) and Lc-pPGMalt (46.7%) exhibited higher survival rates than the controls after challenge with the pathogen A. veronii. Our findings suggested that recombinant L. casei can adequately protect fish and improve immunity, providing a theoretical basis for the future development of an oral Lactobacillus vaccine for use in aquaculture.

1. Introduction Aeromonas veronii is a conditional zoonotic pathogen that causes various illnesses in humans, including diarrhea, sepsis, and pneumonia [1]. It is spread from fish to animals and humans through contaminated water or food products. Aeromonas outer membrane proteins play a vital role in bacterial survival [2], and studies have investigated whether they could be used in genetically engineered vaccines targeting Aeromonas species [3]. In recent years, the Aeromonas Maltoporin outer membrane protein (Malt) has been shown to have good immunogenicity and cross-protective effects [4,5], with a release of

∗

inflammatory cytokines observed in different cells in response to treatment with Malt [6]. Thus, vaccines centered on Aeromonas Malt may provide protection against heterologous pathogens [7,8]. To date, many probiotic bacteria have been screened for their potential as animal feed additives to increase the nutritional value and provide additional health benefits [9,10]. More recently, probiotics have been developed for human use; however, these products must be rigorously tested to ensure their safety and efficacy. Both domestic and international studies have confirmed that probiotics can increase immunity, maintain intestinal health, and inhibit the colonization and proliferation of pathogens, thereby enhancing animal and human

Corresponding author. Tel.: 19990502555 Corresponding author. E-mail addresses: [email protected] (X.-f. Shan), [email protected] (W.-M. Luan).

∗∗

https://doi.org/10.1016/j.micpath.2019.103918 Received 11 November 2019; Received in revised form 29 November 2019; Accepted 9 December 2019 Available online 11 January 2020 0882-4010/ © 2020 Elsevier Ltd. All rights reserved.

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

CAAGCTTCTGCTTGAACA-3′ (BamHI and XhoI restriction sites underlined). The purified PCR product of the Malt gene was digested with SmaI/EcoRV or BamHI/XhoI restriction endonucleases and inserted into the corresponding sites of the MCS or pPG expression vector respectively, to obtain as MCS-Malt or pPG-Malt, respectively. The resulting Malt amplicons were then cleaved using the appropriate restriction endonucleases and inserted into the corresponding sites of pPG and MCS respectively, generating recombinant plasmids pPG-Malt and MCS-Malt. Finally, wild-type pPG and MCS and recombinant plasmids pPG-Malt and MCS-Malt were independently transformed into L. casei CC16 by electroporation, as previously described [22]. The presence and integrity of the plasmids in the L. casei CC16 transformants was verified by restriction analysis and DNA sequencing. L. casei containing wild-type pPG (Lc-pPG) was used as a vector control, while nontransformed wild-type L. casei was used as a negative control in all subsequent assays.

health. As such, oral probiotics have significant health and economic benefits [11,12]. Recombinant oral vaccines using lactic acid bacteria (LAB) as a carrier are currently a hot topic [13,14]. As normal inhabitants of the gut, LAB readily colonize the intestinal mucosa, making the vaccines simple to administer while stimulating a good immune response [15,16]. Studies have shown that antigen levels can be directly reduced by intranasal or oral administration of these vaccines. However, while the immunogenicity of the proteins used in a vaccine can be enhanced through genetic manipulation [17,18], digestive enzymes in the intestine rapidly degrade vaccine components. Thus, a major focus of oral vaccine research is optimizing the environmental stress tolerance of antigen-presenting vectors and enhancing antigen expression in the gut environment [19]. Interestingly, LAB have immunoadjuvant properties and readily express foreign antigens, making them excellent candidates as vaccine vectors. Indeed, recent studies of genetically-engineered LAB vaccines shows they have significant potential for use as oral vaccines [20]. In this study, Lactobacillus casei strain CC16, originally isolated from a fish intestine], was used as an oral vaccine vector to express Maltoporin-encoding gene Malt from zoonotic fish pathogen Aeromonas veronii TH0426. We then measured the immune response in common carp following oral administration of the resulting recombinant L. casei strains. The results of this study provide a theoretical basis for the future development of oral vaccines against Aeromonas.

2.4. Western blot analysis and immunofluorescence assay As described previously, expression of the recombinant Malt gene in L. casei strains was checked by Western blot analysis [23]. Concisely,LcpPG-Malt, Lc-MCS-Malt and Lc-pPG were grown in basal MRS medium containing 10 μg/ml of chloramphenicol. Xylose was added to the culture medium (final concentration, 10 g/l) to induce antigen expression. After induction at 30 °C for 10 h, pellets containing approximately 1 × 108 cells were analyzed by SDS-PAGE and the proteins were electrotransferred onto a nitrocellulose membrane. The immunoblots were blocked with PBS containing 5% skimmed milk and incubated with mouse anti-Malt serum (1:100 dilution), which was prepared in our laboratory, as a primary antibody, followed by HRP-conjugated goat anti-mouse IgG (Sigma, USA) at a dilution of 1:200 as a second antibody. Finally, the immune-complexes were detected using the Western ECL substrate (Thermo Scientific) in an Amersham Imager 600 (GE Healthcare, UK) [24]. The surface-localized Malt protein from LcMCS-Malt was detected by immunofluorescence as described previously [25]. Briefly, Lc-MCS-Malt cells were cultured and induced in MRS broth with xylose overnight at 37 °C. Pellets containing 1 × 105 LcpMCS-Malt cells were washed using PBS containing 1% bovine serum albumin (BSA) and then incubated with mouse anti-Malt serum (1:100) at 37 °C for 1 h. Subsequently, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Sigma, USA) secondary antibodies containing 1% Evans blue at 37 °C for 2 h and analyzed with a confocal microscope (Zeiss LSM710). Lc-pPG was used as a negative control.

2. Materials and methods 2.1. Fish Healthy common carp with an average weight of 65 ± 4 g were purchased from a commercial fish farm. Fish were maintained in 200-L tanks at 25 °C and fed a commercial diet twice a day at a feeding rate of 2% of their total body weight. All experimental animal procedures were carried out as per the Regulations for Animal Experimentation of Jilin Agriculture University (JLAU08201409) and the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publication no. 8023). 2.2. Bacterial strains and plasmids L. casei CC16 was originally isolated from the intestine of a common carp. A plasmid-free strain was cultured in De Man, Rogosa, and Sharpe (MRS) medium (Oxoid, UK) at 30 °C without shaking. The E. coliLactobacillus shuttle vector pPG a type of cell-surface expression plasmid containing an anchoring matrix-encoding pgsA gene derived from Bacillus subtilis behind the target gene, was used MCS is an improved pPG E. coli-Lactobacillus shuttle vector. The MCS and pPG contain a ssUSP secretion signal sequence before the target gene to ensure secretion of the target protein and in order to improve the Malt protein expression level. Several published reports indicated that the lactobacillus expression system is an effective vector for expressing antigens and induction of immune responses against pathogen infection [21].Competent E. coli MC1061 cells used for cloning were cultured in Luria-Bertani (LB) medium at 37 °C with shaking. Chloramphenicol (Cm; Sigma, USA) was added to culture medium where necessary at a final concentration of 10 μg/ml. A. veronii TH0426 was originally isolated from farmed yellow catfish (Pelteobagrus fulvidraco).

2.5. Vaccine preparation and oral immunization Oral administration of the vaccine was conducted as described previously [26]. Briefly, overnight cultures of recombinant L. casei cultured in MRS medium supplemented with chloramphenicol and xylose were thoroughly mixed with commercial basal diet and oven-dried at 40 °C for 6 h. The resulting feed contained the recombinant bacteria at a concentration of ~109 CFU/g. The inoculated feed was stored at 4 °C until use. Five groups (n = 80 per group) of common carp were then fed with the test baits (inoculated with Lc-pPG-Malt or Lc-MCSMalt) or control baits (inoculated with Lc-pPG, wild-type L. casei CC16, or PBS). Oral vaccination was conducted on days 0, 7, 14, 25, 34, according to the immune protocol, and the vaccine was administered on three consecutive days at days 0–2 (prime vaccination), 14–15(booster vaccination) and 34 (challenger). On days 0, 9, 16, 27, 34 after the first immunization, serum were prepared from the blood samples collected from the tail vein and the heart, liver, spleen, head kidney and intestine were rapidly collected from fish from each group. Heart, liver, spleen, head kidney, intestine, and blood samples were collected from each sacrificed fish and stored at −80 °C until further analysis. In addition, sections of the spleen, head kidney (HK), heart, liver, and intestine were

2.3. Generation of recombinant L. casei expression plasmids Malt (1314 bp) from A. veronii TH0426 (GenBank: CP012504.1) was amplified from pEasy-Malt using SmaI/EcoRV primers forward: 5′-CC CCCGGGATGAAAATGAAGTGGCTCCCG-3′ and reverse: 5′-AA GATAT CTTACCACCAAGCTTCTGCTTGAACA-3′ (SmaI and EcoRV restriction sites underlined) and BamHI/XhoI primers forward: 5′-CG GGATCCA TGAAAATGAAGTGGCTCCCG-3′ and reverse: 5′-CC CTCGAGTTACCAC 2

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

rapidly excised from each fish, frozen in liquid nitrogen, and stored at −80 °C for subsequent RNA extraction.

Table 1 The primer sequence of qRT-PCR.

2.6. Enzyme-linked immunosorbent assay (ELISA) Malt antibodies IgM titers in serum and skin mucus were determined by ELISA using recombinant Malt protein (5 μg/ml) as a coating antigen, as described previously [27]. Briefly, each well of a 96-well microtiter plate was blocked with 2% BSA for 2 h at 37 °C. Sera and mucus samples (5 μl per well) were added in triplicate and incubated for 1 h at 37 °C. Bound antibodies were detected using HRP-conjugated anticommon carp IgM monoclonal antibody (Stirling, Scotland), and absorbance was measured at 450 nm [28]. Endpoint titers were expressed as the highest dilution that yielded an optical density ≥2-fold higher than the mean value of the blank. ELISA kits (Nanjing Jiancheng Bioengineering Institute, China) were also used to determine serum concentrations of acid phosphatase (ACP), alkaline phosphatase (AKP), superoxide dismutase (SOD). Serum lysozyme activity was measured by the method of Ellis [29]with minor modifications. A lysozyme activity unit was defined as the amount of enzyme producing a decrease in absorbance of 0.001/min at 530 nm. All analyses were conducted in triplicates.

Gene

Sequence(5′-3′)

GenBank

IL-10

P1 P2 P1 P2 P1 P2 P1 P2 P1 P2

HQ258106.1

IL-1β TNF-α IFN-γ β-actin

AACTGATGACCCGAATGGAAAC CACCTTCTCCCAGTCGTCAAA CATCAAAGAAATCGCTCCTG GCAAGGTCTGCCTGGTCT TTATGTCGGTGCGGCCTTC AGGTCTTTCCGTTGTCGCTTT AACAGTCGGGTGTCGCAAG TCAGCAAACATACTCCCCAG CAAGATGATGGTGTGCCAAGTG TCTGTCTCCGGCACGAAGTA

AJ249137.1 EU909368.1 EU069818.1 AB039726.2

2.9. Hereditary stability of recombinant L.casei strains intestinal colonization The growth and hereditary stability of recombinant L. casei strains detection was conducted according to a published protocol [30]. Five groups of common carp (n = 35 per group) were respectively fed with the five different types of inoculated feed pellets for 7 days (as described in section 2.5.), after which they were fasted. Three carp were then randomly selected from each group and anesthetized using MS222. The entire gut was aseptically collected from each fish and sectioned into foregut, midgut, and hindgut. The gut sections were then opened longitudinally and agitated in PBS for 1 min. Dilutions of the resulting bacterial suspensions were plated on MRS agar containing chloramphenicol, and colonies were picked following incubation at 37 °C overnight for verification. Plasmid was extracted from the cells, and PCR was used to confirm the presence of Malt fragment in each strain using specific primers for the Malt gene.，and colony count.

2.7. Leukocyte phagocytosis assay Blood samples (2 ml) were collected from carp immunized with each of the different treatments as described above into tubes containing anticoagulant. Aliquots (100 μl) of a log-phase culture of Staphylococcus aureus were added to each blood sample and incubated at 22 °C for 1 h. Following incubation, the blood samples were centrifuged at 5000×g. for 15 min. The cells were dried, fixed with methanol for 10 min and stained for 30 min with Giermsa stain. Leukocytes were then examined under a light microscope, with 100 randomly selected white blood cells used to calculate the phagocytic percentage (PP) and phagocytic index (PI) for each sample. The formulas used were as follows:

2.10. Survival assays To assess the protective effects of the recombinant strains, we challenged immunized fish with A. veronii and measured survival over a 34-day period. For the assays, Lc-pPG-Malt, Lc-MCS-Malt, and Lc-pPG were cultured overnight and the cells collected by centrifugation. The resulting pellets were washed with 2% lactose MRS and induced for 10 h by the addition of xylose at a concentration of 10 g/l. Bacterial cell suspensions were then adjusted to a concentration of 1 × 109 CFU/ml and mixed with 1.5% alginate sodium. The bacteria were then added to fish feed as described in section 2.5. Common carp were fed the inoculated pellets (n = 15 carp per group) for 34 days before being fasted for 7 days prior to challenge. A. veronii TH0426 (LD50 of 1 × 106 CFU/ml) was cultured overnight and then adjusted to a concentration of 1 × 107 CFU/ml (10 × LD50). The immunized fish were then challenged with A. veronii by intraperitoneal injection of 200 μl of the bacterial cell suspension. Challenged fish were observed daily for 30 days and all deaths were recorded. The relative survival rate (RPS) of each treatment group was then calculated using the following formula:

PP = (leukocytes containing phagocytosed bacteria/total leukocytes) × 100% PI = total phagocytosed bacteria /total leukocytes containing phagocytosed bacteria

2.8. Gene expression analysis Total RNA was extracted from the different fish tissues using a High Pure RNA Tissue Kit (Takara, Japan) as per the manufacturer's instructions. RNA concentrations were then determined using a Nanodrop 2000c spectrophotometer (Thermo Scientific, USA). Reverse transcription was performed using a Reverse Transcriptase M-MLV Kit (Takara) as per the manufacturer's instructions. The resulting cDNA was used for quantitative reverse-transcriptase polymerase chain reaction (qPCR) assays using the Reverse Transcriptase M-MLV Kit (Takara, Japan) according to the manufacturer's instructions. qPCR was performed, with the THUNDERBIRD SYBR qPCR Mix Kit (TOYOBO, China), which were conducted using a Stratagene MxPro System (Stratagene, USA) in 96well reaction plates. Primers used to target immune-associated genes (IL-10, IL-1β, IFN-γ and TNF-α.)and β-actin, which was used as a housekeeping control, are shown in Table 1. Each 20-μl qPCR reaction volume contained 1 μg of cDNA, 2 × SYBR Green Master Mix (Takara), and specific primers at a final concentration of 1 μM. The specificity of the primers was verified by analysis of melting curves. All qPCR data were analyzed using Stratagene MxPro software. All samples were examined in triplicate.

RPS = (1–immunized group mortality/control mortality) × 100%

2.11. Statistical analysis Statistical analysis was performed using SPSS v22 software and GraphPad PRISM v7.0. For multiple comparisons one-way ANOVA were preformed, followed by Tukey's test. Data are presented as the mean ± standard deviation. Differences were considered statistically significant atp > 0.05,p < 0.05 or p < 0.01.

3

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 1a. The identification of recombinant L. casei(left:Lc.pPG-Malt; right: LcMCS-Malt) A: M: DL5000 DNA Marker； 1: The production of Lc-pPG-Malt digested by restriction enzymes； 2: The PCR amplification product of Lc-pPGMalt.

3. Results 3.1. Construction of the L. casei expression vectors Malt (1314 bp) was amplified using specific primer pairs from pEasy-Malt. The amplification of Malt and its ligation into expression vectors pPG and MCS is summarized in Fig. 1A, left and 1A,right. The recombinant plasmids were confirmed by restriction enzyme digestion and sequence analysis. The results demonstrated that recombinant plasmids pPG-Malt and MCS-Malt were constructed and introduced by electroporation into L. casei. As shown in Fig. 1B, recombinant plasmids were stably inherited over 50 generations. Bands shown in white (1314 bp) were observed by sequencing techniques and matched the target sequences. L: DNAladder (bp), lanes 1–5: PCR product of recombinant L. casei Malt gene after 50 generations.

Fig. 2. A The identification of recombinant L. casei by Western blotting(left: LcMCS-Malt；righr: Lc-pPG-Malt)A1: M:Blue Plus IV Protein Marker; 1: The expression of induced Lc-pPG；A2: The expression of induced Lc-MCS-Malt B: M:Blue Plus IV Protein Marker；1: The expression of induced Lc-pPG；2: The expression of induced Lc-pPG-Malt 2B The identification of induced Lc-MCSMalt by immunofluorescence and control.

the serum and skin mucus of fish orally inoculated with Lc-MCS-Malt compared with the PBS control and Lc-pPG (p < 0.05). In contrast, no significant increase in antibody titers was detected in the control groups. Furthermore, no significant difference (p > 0.05) was observed between treatments and controls prior to initial immunization. The effects of the recombinant L. casei on SOD concentrations in serum are shown in Fig. 4A. The SOD activity in all the groups increased at day 16 and increased gradually after booster immunization (at day 25). However, there was no significant difference between the Lc-pPG and PBS groups (p > 0.05). The highest serum SOD activity was observed in fish that received recombinant L. casei at day 34 compared to the controls (p < 0.05). Oral administration of Lc-pPG-Malt and LcMCS-Malt had no significant effect (p > 0.05) on ACP and AKP concentrations in immunized carp compared with the controls following booster immunization (at day 34), while significant increases (p < 0.05) in serum ACP and AKP activity (Fig. 4B and C) were observed in both treatment groups compared with the controls at day 34. The serum LZM activity (Fig. 4D) showed that Lc-pPG-Malt and Lc-MCSMalt induced a significant increase (p < 0.05) in LZM activity after the booster immunization (at day 16) compared with the controls, whereas there was no significant difference among groups at day 34.

3.2. Expression of Malt and immunofluorescence assays The recombinant plasmids pPG-Malt and MCS-Malt were constructed and introduced by electroporation into L. casei. The immunoreactive band corresponding to the Malt protein wash detected by Western blotting. A 48-kDa immunoreactive band of (Fig. 2A left and right)corresponding to the Malt protein was detected in the cell lysates of Lc-MCS-Malt and Lc-pPG-Malt, but this band was not detected in the Lc-pPG lysate Indirect immunofluorescence was then used to localize the expressed protein in the cells. Clear fluorescence signals were more observed in Lc-MCS-Malt (Fig. 2B, left)than Lc-pPG-Malt, making the morphology of L. casei faintly visible. There was no signal in cells containing the empty vector. Bacteria could be seen clearly under oil immersion (Fig. 2B, right). This finding suggested that Lc-pMCS-Malt cells could react with the polyclonal mouse anti-Malt antibody. 3.3. Humoral immune parameters

3.4. Expression of immune-related genes in serum

To evaluate the immunogenicity of the recombinant L. casei strains, common carp were orally vaccinated, and ELISA was used to determine the levels of IgM anti-Malt in the serum and skin mucus of immunized fish. Results showed significant increases (p < 0.05) in the levels of IgM antibodies in fish following vaccination with Lc-pPG-Malt or LcMCS-Malt compared with levels observed in the controls (Fig. 3A 3B). After booster immunization, higher antibodies titers were observed in

The effects of the recombinant L. casei strains on the expression of immune-related genes IL-10, IL-1β, IFN-γ, and TNF-α were examined by qPCR analysis (Fig. 5). In the Lc-pPG-Malt and Lc-MCS-Malt groups, rapid changes in IL-10 gene expression were observed. Lc-pPG-Malt induced significantly higher (p < 0.05) levels of IL-10 expression at day 34 compared with Lc-MCS-Malt. Likewise, higher serum IL-1β and TNF-α levels were observed at day 34 in fish immunized with Lc-pPGMalt or Lc-MCS-Malt compared with the controls. However, there was no significant difference (p > 0.05) in the expression of these genes between the PBS and Lc-pPG control groups. We also noted increases in the expression of IFN-γ in fish immunized with Lc-pPG-Malt or Lc-MCSMalt compared with the other groups, with a highly significant increase (p < 0.01) in expression observed in the Lc-pPG-Malt group at day 34.

Fig. 1b. Characteristics of recombinant L. casei expressing Malt antigen. (left: Lc-pPG-Malt right:Lc-MCS-Malt) hereditary stability of recombinant L. casei strains were subject to PCR with Malt-specific primer pairs confirming that cells were genetically stable after 50 generations. Bands indicated by white (1314 bp)were analyzed by DNA sequencing and were consistent with the putative sequences. L: DNA ladder (bp), Lane 1–5: PCR product of recombinant L. casei Malt gene after 50 generation ± standard deviation (SD).

3.5. Leukocyte phagocytosis test Following anticoagulation and incubation with S. aureus, the leukocyte layer was aspirated for Giemsa staining. Stained leukocytes were observed under a light microscope and 100 cells were randomly 4

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 2. (continued)

3.6. Expression of immune-related genes in serum The effects of the recombinant L. casei strains on the expression of immune-related genes (IL-10, IL-1β, IFN-γ, and TNF-α) were examined by qPCR analysis. In the Lc-pPG-Malt and Lc-MCS-Malt groups, rapid changes in the expression of immune-related genes were observed in heart, liver, spleen, HK, and intestinal tissues. 3.6.1. IL-10 gene expression In the liver, spleen, HK, and intestine, Lc-pPG-Malt and Lc-MCS-Malt significantly increased (p < 0.01) the expression of IL-10 by day 16 post-oral immunization. The expression of IL-10 at day 34 was significantly higher (p < 0.01) in the tissues of Lc-MCS-Malt treated carp compared with the other groups. Interestingly, there was little fluctuation in the expression of IL-10 in the heart, but the difference between treatment groups was significant (p < 0.05) (Fig. 7A). 3.6.2. IL-1β gene expression Increases were observed in the expression of IL-1β in intestinal, heart, liver, spleen, and HK tissues in all immunized groups, HK was no significant difference among the treatments (p > 0.05). In addition, there was significant difference (p < 0.05) in IL-1β transcription in liver, spleen, and heart tissues between the Lc-pPG-Malt and Lc-MCSMalt groups immediately after immunization(Fig. 7B). The expression of IL-1β in Lc-MCS-Malt group at day 25 was significantly higher (p < 0.01). 3.6.3. IFN-γ gene expression IFN-γ gene expression in the intestinal tissues of Lc-MCS-Malt treated carp increased after immunization, with the peak IFN-γ expression levels in intestinal tissues from these fish significantly higher than those observed in the PBS group (p < 0.01; day 34). IFN-γ expression in the heart and spleen tissues of Lc-pPG-Malt and Lc-MCS-Malt treated fish was no significantly higher (p > 0.05) than that of the controls, while expression levels in the liver and HK initially increased (peaking at day 25) before decreasing significantly at day 35. However, IFN-γ levels on day 35 in the Lc-pPG-Malt and Lc-MCS-Malt groups were significantly higher (p < 0.05) than those of the PBS control (Fig. 7C). Fig. 3. A IgM level in the serum of Common Carp after immunized 3B IgM level in the Skin of Common Carp after immunized.

3.6.4. TNF-α gene expression Following oral immunization with recombinant L. casei, the expression of TNF-α was significantly increased (p < 0.01) with the peak TNF-α expression levels in intestinal tissues from these fish significantly higher than those observed in the PBS group (p < 0.01; day 34). TNFα gene expression in the Lc-MCS-Malt group increased after continuous immunization (Fig. 7D).

selected and examined for phagocytosis. The phagocytic ratio and index were then calculated. The results showed that the percentage of phagocytic leukocytes was significantly higher (p < 0.01) among the LcpPG-Malt and Lc-MCS-Malt treated cells compared with the PBS and LcpPG-treated cells. The rate of phagocytosis continued to increase after continuous immunization. By day 16 post-initial immunization, the PI values for the Lc-pPG-Malt and Lc-MCS-Malt groups were significantly higher (p < 0.01) than those of the other two groups. However, the LcpPG group had a significantly higher (p < 0.05) PI than the PBS groups, and reached a maximum value at day 34 (Fig. 6).

3.7. Intestinal colonization Following immunization and fasting for 34 days, L. casei continued to be recovered from the gut, indicating that the recombinant L. casei strains readily colonized and persisted in the intestine of common carp. However, we noted that despite the high colonization rates, colonization was not consistent throughout the intestine(Fig. 8). 5

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 4. 4A SOD 4B ACP 4C AKP 4D LZM activity in the serum of Common carp after immunized.

Fig. 5. IL-10, IL-1β, IFN-γ and TNF-α level in serum of immunized Common carp. 6

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 6. A The percentage of Leukocytes phagocytic. B The index of Leukocytes phagocytic C Leukocytes phagocytic.

3.8. A. veronii challenge of immunized fish

Recent studies show that Maltoporin is an important adhesion molecule in Aeromonas and is highly immunogenic. It has been used to increase resistance against bacterial invasion of host cells and serum and to enhance the mucosal immune response, which plays an important role in humoral, complement-mediated, and cellular immunity. Vazquez et al. [7] found that A. veronii binds to Malt in diarrheal patients, while Quinn et al. [8] showed that the pore-forming proteins of A. veronii play a role in adhesion, effectively adhering to the surface of host cells. In this study, the strains of L. casei expressing Malt of A. veronii with two xylose-induced expression systems were developed for the first time and immunogenicity as a vaccine delivery vehicle to induce immune responses against A. veronii in fish was evaluated. The detection of Malt in both the supernatant fluid and cell pellet indicated that the expression system also enabled the L. casei to secrete or surface-display the Malt antigen. In the current study, common carp were selected to test the efficacy of L. casei as a delivery vehicle for oral immunization against A. veronii [35,36]. We periodically measured serum and skin mucus IgM levels to assess the immune response of the immunized fish [37]. IgM is an essential component of the humoral immune response in fish. In the present study, we constructed two expression vectors for use in L. casei. Our analyses revealed that Lc-MCS-Malt induced higher levels of IgM compared with the other treatments, and that the antigen may be expressed on the surface of L. casei, enhancing adhesion. While L. casei colonization directly stimulates the mucosal immune response, compared with the recombinant strains, wild-type L. casei was more easily dispersed in the intestinal environment, resulting in decreased antigen

An A. veronii TH0426 challenge experiment was performed to evaluate the protective immunity provided by the recombinant L. casei strains. As shown in Fig. 9, fish immunized with Lc-pPG-Malt or LcMCS-Malt exhibited survival rates of 53.3% and 46.7%, respectively, following challenge with a lethal dose of A. veronii. In comparison, fish inoculated with Lc-pPG, L. casei CC16, or PBS exhibited lower survival rates and underwent an extended period of severe skin ulceration following A. veronii infection. 4. Discussion Lactobacilli are beneficial members of the normal gut microflora, helping to resist the colonization of foreign pathogens [31]. Recently, the use of LAB as delivery vehicles for foreign antigens has been the focus of numerous research studies. The pathogenicity of Aeromonas is the result of multiple virulence-associated factors, including biologically-active substances, adhesion factors, and extracellular proteins such as enzymes and toxins [32,33]. These different toxins and enzymes include lipase (lip), serine protease (ser), temperature-sensitive protease (eprCAI), aerolysin (aer), ompAI, ompAII, collagenase (acg), elastase (ela), cytotoxic enterotoxins (act, ast, alt), and glycerophospholipids such as cholesterol acyltransferase (gcaT), elastase (ahyB), and DNases (exu) [34]. Maltoporin is a specialized outer membrane protein that is quickly identified by the host immune system, resulting in an immune response. As such, it is an excellent protective antigen. 7

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 7a. IL-10 level in the different organism of Common carp after immunized Heart；Live；Spleen；Kidney; Gut.

8

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 7b. IL-1β level in the different organism of Common carp after immunized Heart；Live；Spleen；Kidney; Gut.

9

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 7c. IFN-γ level in the different organism of Common carp after immunize Heart；Live；Spleen；Kidney; Gut.

10

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 7d. TNF-α level in the different organism of Common carp after immunize Heart；Live；Spleen；Kidney; Gut.

11

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

Fig. 8. The distribution of recombinant L. casei in the intestine.

as functions associated with damaged tissue repair, adaptive immunity and cell growth. In our study, immunization with recombinant L. casei were found by qRT-PCR to strongly induce the expression of IL-1β, IFNγ, and TNF-α in the heart,liver, spleen, kidney and gut after booster immunization, which is consistent with previous report of up-regulation was observed in response to administration of Lactobacillus rhamnosus and Lactococcus lactis in turbot [46]. In our study, the recombinant L. casei groups displayed high anti-in-flammatory cytokine IL-10 gene expression in the spleen, kidney and gut of fish. Overall, IL-10 levels increased by day 16 post-oral immunization. and the production of IL10 prevented body damage and weakened the inflammatory response. Our results showed a significant upregulation of TNF-α in spleen, heart, liver, gut and kidney, which triggered an early pro-inflammatory response. Moreover, TNF-α is plays an essential role in response to bacterial and viral invasion IL-10 is an anti-inflammatory factor that is effective at relieving inflammation. IL-1β is widely accepted as a proinflammatory factor, which is used as a reference gene in studies of immune regulation. In our study, the recombinant L. casei groups displayed high anti-inflammatory cytokine IL-1β gene expression in the heart, liver and spleen of fish. Overall, Our results showed a significant upregulation of IFN-γ in intestine. IFN-γ can play a defensive role in response to invasion by pathogens and serves as the first line of defence against viral infection. previous studies already showed that the immune responses at early time-points were crucial to the resistance of fish infections with pathogens. These data coupled with those of earlier reports indicated that pro-inflammatory response was enhanced in lactobacillus treated fish. To sum up, the upregulated cytokine could provide early protective immunity after challenge, indicating the capability of L. casei expressing Malt to elicit an immuonostimulatory response. The results of plate counting showed that the colonization capability of recombinant L. casei was good, which may be associated with the function of the Malt protein, and may explain the significant increase in various immune indexes in the intestine [47]. The immunoprotective effects of the recombinant L. casei were evaluated using an immunoprotection assay. At the end of the 34-day experimental period, the survival rates of Lc-pPG-Malt and Lc-MCS-Malt immunized carp following infection with a lethal dose of A. veronii were 46.7% and 53.3%, respectively. These findings confirmed that the recombinant L. casei strains had a protective effect in the immunized carp. Common carp in the PBS control group that died during the experimental period showed a dulling of the body surface, ascites, and signs of internal bleeding. Intestinal redness was observed following dissection of abdominal swelling[48]. In the group immunized with wild-type L. casei, ulcers were observed on the body surface but death did not occur until the later stages of the experiment. In comparison, ulcers observed on recombinant L. casei-immunized fish began to heal after 20 days,

Fig. 9. The relative percent survival.

activity. Furthermore, while the two recombinant L. casei strains equally induced an antibody response in vitro in the absence of induction, Malt is no longer continuously expressed by Lc-pPG-Malt. In comparison, Lc-MCS-Malt directly anchors the protein to the cell surface, reducing the loss of antigenic activity and increasing IgM levels. This can also reduce antigen stimulation, resulting in continued low levels of immune tolerance. Other studies using recombinant LAB have resulted in similar immune responses [38]. For example, Hao et al. used the GCRV vp7 protein to display viral antigens on the surface of Escherichia coli for the development of a live oral vaccine [39]. Fish serum contains various antibacterial substances, with LZM, ACP, SOD, and AKP all playing a role in protection against pathogen invasion [40]. Our current results show that the recombinant L. casei strains increase concentrations of ACP, AKP, SOD, and LZM, thus enhancing humoral immunity. ACP and SOD concentration peaked at 34 days post-immunization, while LZM concentrations initially increased before decreasing steadily after 16 days. Non-specific immune parameters were significantly higher in tissues from the Lc-MCS-Malt group compared with the Lc-pPG-Malt group, suggesting that Lc-MCS-Malt may encourage the production of higher levels of antibacterial substances, thereby improving immunity. Similar to the current findings, immunization with Lactobacillus has been shown to enhance immune activity in vivo [41]. LZM has antibacterial effects, especially in the early stages of bacterial infection [42]. The increase in LZM concentrations following oral administration of the recombinant L. casei strains in carp confirms the ability of L. casei to modulate immunity [43]. Serum IL-10, IL-1β, TNF-α, and IFN-γ levels also reflect the effects of recombinant L. casei on the immune response [44,45]. When the body is stimulated by the external environment, a variety of cytokines, are produced that have various biological functions, such 12

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

with no further deaths occurring during the experimental period. Therefore, the recombinant L. casei may delay bacterial infection and the onset of acute symptoms, protecting the intestinal mucosa from inflammation. A study conducted in grouper confirmed that after 40 days of continuous immunization, the survival rate of Aeromonaschallenged immunized fish was significantly improved, which supports the findings of the current study.

[15]

[16] [17]

5. Conclusions

[18]

In conclusion, we successfully constructed two recombinant L. casei strains (Lc-MCS-Malt and Lc-pPG-Malt) expressing the Malt protein from A. veronii. Following oral immunization, a humoral immune response and high levels of IgM were induced in carp, with significant increases in immune-related enzymes also observed. Furthermore, immunization promoted leukocyte differentiation and enhanced phagocytic activity. The transcriptional levels of various cytokines were also increased in all tissues of immunized fish. Finally, challenge assays showed that the recombinant L. casei strains effectively protected crucian carp from A. veronii infection. These results provide a theoretical basis for the development of oral LAB-based vaccines for use in aquaculture.

[19]

[20]

[21]

[22] [23]

Funding [24]

This work was supported by the National Key Research and Development Program of China (Project No. 2017YFD0501001), the earmarked fund for Modern Agro-industry Technology Research System (CARS-46), the National Natural Science Foundation of China (No. 31372540) and the Jilin Agricultural University Ph.D. Startup Fund (No. 201801) (Construction and Recombinant Lactic Acid Bacteria of Aeromonas Vickers Protective Antigen), the Natural Science Foundation of Science and Technology Department of Jilin Province (project No. 20170101016JC), and the Project of Jilin Provincial Education Department (Project No. JJKH20180694KJ).

[25]

[26]

[27]

[28]

References [29] [1] M. Zhao, K.Y. Wang, J. Wang, et al., Tetracycline antibiotics resistance and its genetic determinants in Aeromonas veronii isolated from channel catfish (Ictalurus punctatus), Acta Hydrobiol. Sin. 38 (2) (2014) 386–392 (in Chinese). [2] A.C. Parte, LPSN-list of prokaryotic names with standing in nomenclature, Nucleic Acids Res. 42 (D1) (2014) D613–D616 gkt1111 https://doi.org/10.1093/nar/ gkt1111. [3] A.K. Dhar, S.K. Manna, F.C.T. Allnutt, Viral vaccines for farmed finfish, Virus Disease 25 (1) (2014) 1–17. [4] R. An, P.V. Gelder, Maltoporin:sugar for physics and biology, Res. Microbiol. 155 (8) (2004) 611–616. [5] J. Lun, C. Xia, C. Yuan, et al., The outer membrane protein, Lam B (Maltoporin)，is a versatile vaccine candidate among the Vibrio species, Vaccine 32 (7) (2013) 809–815. [6] S. Chatterjee, E. Rothenberg, Interaction of bacteriophage with its E. coli receptor, lam B[J], Viruses 4 (11) (2012) 3162–3178. [7] R.C. Vazquez-Juarez, M.J. Romero, F. Ascencio, Adhesive properties of a LamB like outer-membrane protein and its contribution to Aeromonas veronii adhesion, J. Appl. Microbiol. 96 (4) (2004) 700–708. [8] D.M. Quinn, H.M. Atkinson, A.H. Bretag, et al., Carbohydrate-reactive, poreforming outer membrane proteins of Aeromonas hydrophila, Infect. Immun. 62 (9) (1994) 4054–4058. [9] O. Cano-Garrido, J. Seras-Franzoso, E. Garcia-Fruits, Lactic acid bacteria: reviewing the potential of a promising delivery live vector for biomedical purposes, Microb. Cell Factories 14 (1) (2015) 137. [10] S.S. Giri, S.S. Sen, C. Chi, et al., Effect of cellular products of potential probiotic bacteria on the immune response of Labeo rohita and susceptibility to Aeromonas hydrophila infection, Fish Shellfish Immunol. 46 (2) (2015) 716–722. [11] L. Chen, Ø. Evensen, S. Mutoloki, IPNV antigen uptake and distribution in Atlantic salmon following oral administration, Viruses 7 (5) (2015) 2507–2517. [12] N.A. Ballesteros, S.R. Saint-Jean, S.I. Perez-Prieto, Food pellets as an effective delivery method for a DNA vaccine against infectious pancreatic necrosis virus in rainbow trout (Oncorhynchus mykiss, Walbaum), Fish Shellfish Immunol. 37 (2) (2014) 220–228. [13] L. Min, Z. Li-Li, G. Jun-Wei, et al., Immunogenicity of Lactobacillus-expressing VP2 and VP3 of the infectious pancreatic necrosis virus (IPNV) in rainbow trout, Fish Shellfish Immunol. 32 (1) (2012) 196–203. [14] Q. Jiang, I. Stamatova, K. Kari, et al., Inhibitory activity in vitro of probiotic

[30]

[31] [32]

[33]

[34]

[35] [36] [37]

[38]

[39]

[40]

[41]

13

lactobacilli against oral Candida under different fermentation condi-tions, Benef. Microbes 6 (3) (2015) 361–368. M. Firdaus-Nawi, M. Zamri-Saad, N.Y. Nik-Haiha, et al., Histological assessments of intestinal immuno-morphology of tiger grouper juvenile, Epinephelus fuscoguttatus, Springer Plus 2 (1) (2013) 611. R. Lowry, S. Balboa, J.L. Parker, et al., Aeromonas flagella and colonisation mechanisms, Adv. Microb. Physiol. 65 (2014) 203–256. N.A. Ballesteros, S.R. Saint-Jean, S.I. Perez-Prieto, Food pellets as an effective delivery method for a DNA vaccine against infectious pancreatic necrosis virus in rainbow trout (Oncorhynchus mykiss, Walbaum), Fish Shellfish Immunol. 37 (2) (2014) 220–228. S. Xu, D. Wang, P. Zhang, et al., Oral administration of Lactococcus lactis‐expressed recombinant porcine epidermal growth factor stimulates the development and promotes the health of small intestines in early weaned piglets, J. Appl. Microbiol. 119 (1) (2015) 225–235. X. Jiang, X. Hou, L. Tang, et al., A phase trial of the oral Lactobacillus casei vaccine polarizes Th2 cell immunity against transmissible gastroenteritis coronavirus infection, Appl. Microbiol. Biotechnol. 100 (17) (2016) 7457–7469. A. Wyszyńska, et al., Erratum to: lactic acid bacteria-20 years exploring their potential as live vectors for mucosal vaccination, Appl. Microbiol. Biotechnol. 99 (10) (2015) 4531-4531. S. Xu, et al., Oral administration of Lactococcus lactis-expressed recombinant porcine epidermal growth factor (rpEGF) stimulates the development and promotes the health of small intestines in early-weaned piglets, J. Appl. Microbiol. 119 (1) (2015) 225–235. X.L. Hou, L.Y. Yu, J. Liu, G.H. Wang, Surface-displayed porcine epidemic diarrhea viral (PEDV) antigens on Lactic acid bacteria, Vaccine 26 (2007) 24–31. J. Rieger, P. Janczyk, H. Hnigen, et al., Intraepithelial lymphocyte numbers and histomorphological parameters in the porcine gut after Enterococcus faecium NCIMB 10415 feeding in a Salmonella Ty-phimurium challenge, Veterinary Immunology and Immunopathology 164 (1–2) (2015) 40–50. S. Nikoskelainen, A. Ouwehand, G. Bylund, et al., Immune enhancement in rainbow trout (Oncorhynchus mykiss) by potential probiotic bacteria (Lactobacillus rhamnosus), Fish Shellfish Immunol. 15 (2003) 443–452. Y.G. Xu, et al., Immunogenicity in swine of orally administered recombinant lactobacillus plantarum 593 expressing classical swine fever virus E2 protein in conjunction with thymosin α-1 as an adjuvant, Appl. Environ. Microbiol. 81 (11) (2015) 3745. M.S. Hassaan, M.A. Soltan, M.M.R. Ghonemy, Effect of syn-biotics between Bacillus licheniformis and yeastextract on growth， hematological and biochemicalindices of the Nile tilapia (Oreochromis niloticus), Egyptian Journal of Aquatic Research 40 (2) (2014) 199–208. S.K. Yadav, et al., Recombinant outer membrane protein C of Aeromonas hydrophila elicits mixed immune 600 response and generates agglutinating antibodies, Immunol. Res. 64 (4) (2016) 1087–1099. A.E. Ellis, Innate host defense mechanisms of fish against viruses and bacteria, Developmental & 601 Comparative Immunology 25 (8–9) (2001) 827–839. B.F. Song, et al., Chromosomal insertions in the Lactobacillus casei upp gene that are useful for vaccine expression, Appl. Environ. Microbiol. 80 (11) (2014) 3321–3326. B.R. Beck, J.H. Song, B.S. Park, et al., Distinct immune tones are established by Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 in the gut of olive flounder (Paralichthys olivaceus), Fish Shellfish Immunol. 55 (2016) 434–443. J.M. Janda, S.L. Abbott, The genus Aeromonas: taxonomy, pathogenicity, and infection[J], Clin. Microbiol. Rev. 23 (1) (2010) 35–73. M. Roberts, D. Enoch, K. Harris, et al., Aeromonas veronii biovar sobria bacteraemia with septic arthritis confirmed by 16S r DNA PCR in an immunocompetent adult, J. Med. Microbiol. 55 (2) (2006) 241–243. Sinclair HA, Heney C, Sidjabat HE, et al. Genotypic and Phenotypic Identification of Aeromonas Species and Cph A-Mediated Carbapenem Resistance in Queensland, (Australia[J]). Balvinder Mohan, Nandini Sethuraman, Ritu Verma, Neelam Taneja, Speciation, clinical profile & antibiotic resistance in Aeromonas species isolated from choleralike illnesses in a tertiary care hospital in north India, Indian J. Med. Res. 146 (7) (2017) 53–58. Q.F. Meng, Z. Xu, L.W. Wang, Research progress of the live vector vaccine, Heilongjiang Anim. Sci. Vet. Med. 19 (2013) 28–31. B. Magnadottir, Immunological control of fish diseases, Mar. Biotechnol. 12 (4) (2010) 361–379. M.S. Hassaan, M.A. Soltan, M.M.R. Ghonemy, Effect of syn-biotics between Bacillus licheniformis and yeastextract on growth，hematological and biochemicalindices of the Nile tilapia (Oreochromis niloticus), Egyptian Journal of Aquatic Research 40 (2) (2014) 199–208. Kai Hao, Xiao-Hui Chen, Xiao-Zhou Qi, Bin Zhu, Gao-Xue Wang, Fei Ling, Display of GCRV Vp7 Protein on the surface of escherichia coli and its immunoprotective effects in grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. (2018) 199–209. X.M. Chen, H.M. Lu, X.T. Niu, et al., Enhancement of secondary metabolites from Bacillus Licheniformis XY-52 on immune response and expression of some immunerelated genes in common carp, Cyprinus carpio, Fish Shellfish Immunol. 45 (1) (2015) 124–131. A. Rodriguez, M.A. Esteban, J. Meseguer, Phagocytosis andperoxidase release by seabream ( Sparus aurata L) leucocytes in response to yeast cells, Anat Rec A Discov Mol Cell Evol Biol 272 (1) (2003) 415–423. S.S. Giri, et al., Effect of Cellular Products of potential probiotic bacteria on the immune response of 637 Labeo Rohita and Susceptibility to Aeromonas Hydrophila

Microbial Pathogenesis 141 (2020) 103918

A.-Q. Ju, et al.

(2003) 23–40. [45] C. Low, S. Wadsworth, C. Burrells, et al., Expression of immune genes in turbot (Scophthalmus maximus) fed a nucleotide-supplemented diet, Aquaculture 221 (1) (2003) 23–40. [46] G. Biswas, H. Korenaga, R. Nagamine, et al., Cytokine responses in the Japanese pufferfish (Takifugu rubripes) head kidney cells induced with heat-killed probiotics isolated from the Mongolian dairy products, Fish Shellfish Immunol. 34 (5) (2013) 1170–1177. [47] J.H.W.M. Rombout, G. Yang, V. Kiron, Adaptive immune responses at mucosal surfaces of teleost fish, Fish Shellfish Immunol. 40 (2) (2014) 634–643.

Infection, Fish Shellfish Immunol. (2015). [42] J.M. Hawkridge, R.K. Pipe, B.E. Brown, Localization of anti oxidant enzymes in the cnidarians Anemonia viridis and Gonioporastokesi, Mar. Biol. (Berl.) 137 (1) (2000). [43] H.K. Miandare, S. Farvardin, A. Shabani, et al., The effects of galactooligosaccharide on systemic and mucosal immune response, growth performance and appetite related gene transcript in goldfish (Carassius auratus gibelio), Fish Shellfish Immunol. 55 (2016). [44] C. Low, S. Wadsworth, C. Burrells, et al., Expression of immune genes in turbot (Scophthalmus maximus) fed a nucleotide-supplemented diet, Aquaculture 221 (1)

14