- Email: [email protected]
Construction of Marek's Disease Virus Serotype 814 Strain as an Infectious Bacterial Artificial Chromosome
CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 4, April 2008 Online English edition of the Chinese language journal RESEARCH PAPER
Cite this article as: Chin J Biotech, 2008, 24(4), 569í575.
Construction of Marek’s Disease Virus Serotype 814 Strain as an Infectious Bacterial Artificial Chromosome Hongyu Cui1, 2, Yunfeng Wang1, Xingming Shi1, Guangzhi Tong1, Desong Lan1, Lai He1, Huaji Qiu 1, Changjun Liu1, and Mei Wang1 1
Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, China
2
Department of Animal Medicine, College of Animal Science and Veterinary Medicine, Hebei North University, Hebei Zhangjiakou 075131, China
Abstract: The aim of this study was to construct the complete genome of Marek’s Disease Virus Serotype 1 814 strain as an infectious bacterial artificial chromosome (BAC). Using self-designed selection marker Eco-gpt (1.3 kb) and BAC vector pBeloBAC11 (7.5 kb), we constructed the transfer plasmid pUAB-gpt-BAC11. The plasmid pUAB-gpt-BAC11 and MDV TotalDNA were cotransfected into secondary CEFs; we passaged the virus-containing cells eight rounds in selection medium and obtained purified recombinant viruses. Recombinant viral genomes were extracted and electroporated into E. coli, BAC clones were identified by restriction enzyme digestion and PCR analysis. Finally, we obtained thirty-eight BAC clones, DNA from various MDV-1 BACs was transfected into CEFs, and recombinant virus was reconstituted by transfection of MDV-BAC2 DNA. In this study, we successfully cloned the complete genome of MDV-1814 strain as an infectious bacterial artificial chromosome. With these cloned genomes in hand, A revolutionary MDV-DNA engineering platform utilizing RED/ET recombination system was constructed successfully, which acclerate the understanding of MDV gene functions and promote the using of MDV as a vector for expressing foreign genes. In addition, it may be possible to generate novel MDV-1 vaccines based on the BACs. Keywords: Marek’s disease virus; bacterial artificial chromosome; molecular cloning virus; infectious clone
Introduction Marek’s disease virus (MDV) is a member of the Alphaherpesvirinae subfamily of the Herpesviridae, which is a representative oncogenic alpha herpes virus that induces T-cell lymphomas in poultry. There are three serotypes of MDV[1–7], and MDV-1 include all virulent and very virulent oncogenic viruses. Although the genomes of many MDV strains have been sequenced completely in recent years, our knowledge about the function of the majority of MDV genes is still quite insufficient. This is especially true for MDV-1
viruses, because their strict cell-associated nature and large genome size (170 kb) made the construction of viral mutants a difficult and tedious procedure. Fortunately, a novel approach for the construction of herpesvirus mutants that is based on cloning of the virus genome as a bacterial artificial chromosome (BAC) in Escherichia coli has been developed. If the target gene is cloned from BAC, mutagenesis can be done by homologous recombination in E. coli which is mainly based on RED/ET mutagenesis system. The novel
Tab. 1 Primers used to amplify different regions in this study Received: September 4, 2007; Accepted: November 23, 2007 Supported by: Open Fund of Key Laboratory of Veternary Biotechnology (No. NKLVB2005-05) Corresponding author: Yunfeng Wang and Guangzhi Tong. Tel: +86-451-8593-5058; Fax: +86-451-8593-5059; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575 Primer
Sequence (5'-3')
A-upper
ACAGGATCCGTGTTTGAATACTGG
A-lower
ATATTAATTAATGTCGACCCGGTAGTCATTAGC
B-upper
ATCTTAATTAAGCATGCTTTGGCAAAACGGAATAG
B-lower
CGCAAGCTTAATATGAATCTCTAAAACTTCTCGGC
gpt-upper
ATGGTCGACGGATCCCGCCATGCATTAG
gpt-lower
ATGGTCGACGGATCCCGCTTACAATTTACGC
US2-upper
ATATTAATTAAGCTAATGACTACCGG
US2-lower
ATCTTAATTAACTATTCCGTTTTGCCAA
repA-upper
CAT GGC GGA AAC AGC GGT TAT C
repA-lower
ATG TAT GAG AGG CGC ATT GGA G
sopB-upper
ATT CGT TAA TTG CGC GCG TAG G
sopB-lower
GAA TAT TCA GGC CAG TTA TGC T
approach has many advantages and the powerful methods of bacterial genetics allow the rapid and efficient introduction of any kind of mutation (deletion, insertion, and point mutation) into the cloned viral genome[3,5,8–22]. The aim of this study was to clone full-length genome of Marek’s disease virus serotype 1 (MDV-1) China Harbin814 strain (natural attenuated strain) as an infectious BAC. Using self-designed positive selection marker of gpt and BAC functional regions, recombinant viruses are enriched with mycophenolic acid and xanthine. Once the MDV-1 genome is cloned as a BAC and can be stably maintained in E. coli, generation of mutants and analyses of essential genes should be very easy utilizing RED/ET recombination system. a detailed assessment of genes expressed in the lytic, latent, and tumor phases of MDV-1 infection should be possible. In addition, it may be possible to generate a novel generation of MDV-1 vaccines based on BACs.
1
Materials and methods
1.1 Virus and cells Chicken embryo fibroblasts (CEFs) were generated from 10-day-old specific-pathogen-free (SPF) embryos and maintained in Dulbecco’s modified essential medium (DMEM) supplemented with 10 % fetal calf serum (Invitrogen); MDV-814 strain was reserved by Avian Infectious Diseases Laboratory of Harbin Veterinary Research Institute, China. E.coli DH10B strain and pBeloBAC11 vector was pursued from Invitrogen. Plasmid pEco-gpt was constructed by Avian Infectious Diseases Laboratory of Harbin Veterinary Research Institute; Mycophenolic acid, Xanthine and Hypoxanthine (Sigama, Germany); LipofectamineTM2000 Transfection reagent (Invitrogen); Qiagen plasmid Midi kit (Qiagen). Other standard equipments and materials for molecular biology were bought from TaKaRa. 1.2 Construction of the Recombination Plasmid In order to construct recombination viruses, a transfer
Description 2.1 kb fragment of left side homologies 3.0 kb fragment of right side homologies Primers used to identify 1.3 kb gpt gene. Primers used to identify 8.9 kb BAC-gpt Primers used to identify BAC essential genes (repA) Primers used to identify BAC essential genes (sopB)
plasmid pUAB-gpt-BAC11 has to be constructed, first, MDV-814 total DNA was purified from infected cells by sodium dodecyl sulfate-proteinase K extraction as described earlier[23]. Briefly, infected cells from a 75 cm2 tissue culture flask were lysed in 5 mL of lyse-buffer (0.2 mg/mL proteinase K, 0.6 % SDS, 100 mM NaCl, 10 mM Tris-Cl, 1 mM EDTA), after incubation at 37°C for 4 h cellular DNA and proteins were precipitated by centrifugation at 15 000 g and 4°C for 30 min, the supernatant was extracted with phenol/chloroform and DNA was precipitated with ethanol. This wild type MDV DNA was isolated from virions and total cell DNA. For constructing of BAC transfer vector, two fragments (2.1 kb and 3.0 kb) on either side of the MDV-814 US2 gene, which act as the left and right side homologies, were amplified by PCR using primers containing appropriate restriction enzyme sites (Tab. 1). Both fragments were subsequently cloned into pUC119 to generate plasmid pUAB. Then a Eco-gpt gene was amplified by PCR using primers containing Sal I restriction enzyme sites (Tab. 1) from plasmid pEco-gpt (constructed by ourselves, in which the E. coli guanine phosphoribosyl transferase (gpt) was under the control of the HCMV immediate-early promoter) and inserted into the Sal I sites of the 2.1-and 3.0-kb fragment cloned in pUAB to obtain plasmid pUAB-gpt. Finally, a BAC vector pBeloBAC11 was cut by a Sph I site and inserted into the Sph I site of the plasmid pUAB-gpt to obtain recombination plasmid pUAB-gpt-BAC11 (Fig. 1), in which the aim fragment of 8.8 kb was named BAC-gpt (Figs. 2 and 3). pUAB-gpt-BAC11 was achieved by silica-based affinity chromatography using commercially available kits (Qiagen plasmid Midi kit). 1.3 Generation of Recombinant Virus MDV-814 total DNA was purified from infected cells as described earlier. Briefly, Primary CEF cells were cotransfected by Lipofectamine TM 2000 with approximately 4 µg of
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
Fig. 1 Schematic Map of plasmid pUAB-gpt-BAC11
Fig. 2 Schematic illustration of the cloning procedure of the transfer plasmid to introduce the 8.8 kb fragment into MDV 814 genome 1: organization of MDV 814 genome; 2: schematic map of the transfer plasmid pUAB-gpt-BAC11; 3: 8.8 kb BAC-gpt fragment containing the Eco-gpt (1.3 kb) and the BAC11 sequence (the essential genes of BAC vector) was inserted into US2 gene to obtain recombinant virus
Fig. 3 Plasmid pUAB-gpt-BAC11 agarose gel electrophoresis by restriction Enzyme digestion BamHĉ: 11kb, 6.2 kb; Hind III: 10.5 kb, 6.7 kb; Pstĉ: 9.3 kb, 3.2 kb, 3 kb, 1.5 kb; Salĉ: 8.2 kb, 6.5 kb, 1.3 kb, 0.8 kb, 0.3 kb
plated on primary CEF cells in the presence of 300 µg of MDV-814 DNA and 4 µg of pUAB-gpt-BAC11 in a 60 mm dish. At 5 or 6 days after cotransfection, infected cells which cytopathic effect had completely developed were mycophenolic acid (MPA) per mL, 65 µg of xanthine per mL, and 100 µg of hypoxanthine per ml. To avoid death of actively dividing CEF, cells were seeded at a density of 5×106 cells per 60-mm dish and grown overnight, and selection medium was applied 1 h before addition of virus-containing cells. The MPA-xanthine-hypoxanthine selection was replaced at 1-day intervals. Incubate until the cells show complete special viral plaque of MDV-1 (takes 5 to 8 days). For Enrichment of Recombinant Viruses, after complete cytopathic effect (CPE) had developed, the virus-containing cells were passaged five or eight rounds in the selection medium till no CPE cells suspend in the selection medium. Finally, total DNA was purified from infected cells and the 8.8 kb fragment inserted into US2 gene was amplified by PCR using primers which frank US2 gene (Tab. 1). The recombinant virus was named rv-MDV 814. 1.4 Preparation electrocompetent cells of DH10B Competent cells were prepared by the procedure supplied with the electroporation device (BIO-RAD Gene Pulser Xcell System, Germany), with modifications to the protocol. First, Inoculate a colony of DH10B from a LB plate into 5 mL of LB, inoculate at 37°C overnight, shaking at 220 rpm, 2 mL of fresh overnight culture was inoculated into 200 mL of LB, grow the cells at 37°C shaking at 220 rpm to an OD600 of approximately 0.4–0.5 chill the cells on ice for 30 min. for all subsequent steps, keep the cells as close to 0oC as possible (in an ice/water bath) and chill all contains in ice before adding cells. Transfer the cells to a sterile, cold 500 mL centrifuge bottle and centrifuge at 5500 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold ddH2O, then resuspended all pellet in 500 mL of ice-cold ddH2O, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold ddH2O, then resuspended all pellet in 500 mL of ice-cold ddH2O, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold 10% glycerol, then resuspended all pellet in 500 mL of ice-cold 10% glycerol, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Resuspended the pellet in 100 mL of ice-cold 10% glycerol, then centrifuge at 5000 rpm for 5 minutes at 4oC, carefully pour off and discard the supernatant. Finally, gently resuspended the pellet in a final 1–2 mL of ice-cold 10% glycerol, transfer the suspension to some cold polypropylene tube on ice and immediately prepare electroporation. 1.5 Generation of BAC clones containing complete MDV genome To a cold, 1.5 mL polypropylene microfuge tube, add 25 µL fresh electrocompetent bacteria DH10B in 0.1 cm
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
cuvettes, then add 5 µL to 10 µL of infected-cell DNA, gently mix well and incubate on ice for 3 to 5 minutes, and electroporation was performed in 0.1-cm-wide cuvettes at 2000 V, a resistance of 200 ȍ, and a capacitance of 25 µF. Transformed bacteria were immediately incubated in 1 mL of Luria-Bertani (LB) medium supplemented with 0.2 mM glucose, 0.1 mM MgSO4, 0.1 mM MgCl2 for 1 h at 37°C, and then plated on LB agar containing 30 µg of chloramphenicol per mL. Single colonies were picked and placed in liquid LB medium, and small-scale preparations of BAC DNA were performed by alkaline lysis of E. coli. Large-scale preparation of BAC DNA was achieved by silica-based affinity chromatography using commercially available kits (Qiagen). The integrity of the BAC DNA was checked by digestion with three different restriction enzymes (BamH I, EcoR I and Pst I). The MDV-BAC clones were also validated by PCR with several pairs of primers (Tab. 1) specifically for the essential genes of MDV replication in vitro and/or in vivo. 1.6 Determination virus growth curves of BAC-derived MDV 814 For preparation Circular Viral Genomes, total DNA was purified from infected cells (80% CPE) using Qiagen plasmid Midi kit, MDV-BAC DNA were transfected into primary CEFs, with LipofectamineTM 2000. After 5 days by transfection, MDV-1-specific viral plaques clearly appeared in the dish which was named BAC-derived MDV 814. To determine whether growth of the recombinant viruses of BAC-derived MDV 814 was comparable to that of parental virus (wt-MDV814) and recombinant virus (rv-MDV814), plaque sizes and virus growth curves were respectively measured. Briefly, the BAC-derived viruses were co-seeded with fresh CEF and sizes of plaques were compared to those induced by parental MDV 814 at the same time. In case of growth curves, 1×10-3 PFU/cell of virus was used to infect fresh CEF and seeded on six-well plates in the same way. At various times p.i (post-infection, 24 h, 48 h, 96 h, 120 h, 144 h), virus-infected CEF were harvested and titrated by co-seeding 10-fold virus dilutions with fresh CEF on sixwell plates, titer were counted 5 days post-infection and the mean number of plaques were determined. Growth curves were carried out at 37oC.
2
Results
2.1 Generation recombination Plasmid The recombinant plasmid, pUAB-gpt-BAC was constructed (Fig. 1, total 17156 bp), in which contain the BAC functional fragments (7521 bp) and Eco-gpt selectively expressional cassette (1372 bp) flanked by sequences homologous to the desired integration site (US2 gene, 890 bp) in the viral genome (left and right side homologies). There is a 34 bp loxP site in the terminal sequences of BAC-gpt (8.8 kb fragment), it is an available homologous
recombinant site in the future. The results that restriction enzymes analysis of Sal I, Pst I, BamH I and Hind III and sequencing of the recombinant plasmid pUAB-gpt-BAC were all correct (Fig. 3). 2.2 Enrichment and purification of Recombinant Virus For Enrichment of Recombinant Viruses, after complete cytopathic effect (CPE) had developed, the virus-containing cells were passaged eight rounds in the selection medium till no CPE cells suspend in the selection medium. Total DNA from the eighth-round infected cells was extracted as described previously, using the total DNA as template, the 8.8 kb fragment replaced the US2 gene can be correctly amplified by PCR with primers flanked US2 gene, at the same time, the US2 gene sequences (890 bp) of the wt-MDV could not be able to amplified (Fig. 4-3). This PCR test indicated that we obtained purified recombinant viruses after eight-round selection. 2.3 Identification of BACs containing complete MDV-1 814 genomes Total of 52 BAC clones were obtained from the electroporated E. coli DH10B, and the BAC DNA was isolated for each clone. After validated by digestion with different restriction enzymes and PCR with special primers for the essential genes of MDV replication in vitro and/or in vivo, 38 clones were found to be positive (Fig. 4-1), in which the complete MDV-814 genome was harbored. The results of MDV-BAC2 agarose gel electrophoresis after restriction Enzyme digestion accord with restriction Enzyme fragments of MDV GA strain analyzed by DNASTAR software (Fig. 4-2), MDV-BAC2 DNA contain the BAC functional fragments and Eco-gpt selectively expressional cassette (Fig. 4-3). The genes and gene products essential for Marek’s disease virus (MDV) replication in vitro and/or in vivo were correctly amplified by PCR. (Fig. 4). 2.4 Reconstitution of MDV from BAC DNA According to methods previously described, DNA from MDV-814-BAC2 was transfected into CEFs with LipofectamineTM 2000 transfection reagent. We successfully reconstituted the recombinant virus (BAC2-redrived MDV-814). This assay indicated that MDV-BAC2 is an infectious BAC. MDV-BAC2 was permitted to comparative analysis the growth dynamics and plaque size with the parental virus (wt-MDV-814) and recombinant virus (v-MDV-814). Plaque size of BAC2-derived MDV-814 was similar with parental MDV 814 (wt-MDV-814) plaques at 96 h post-infected fresh CEF cells (Fig. 5). It was demonstrated that BAC2-redrived MDV814 exhibited growth characteristics that were virtually identical to those of parental wt-MDV 814 and recombinant virus (v-MDV-814) (Fig. 6). From the plaque sizes and growth characteristics, we concluded that the biological properties of MDV-1 BACs in vitro were indistinguishable from those of the parental strain.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
Fig. 4 Schematic map of MDV 814-BAC, restriction enzyme digestion and PCR analysis 1: schematic map of MDV 814-BAC, in which the BAC-gpt fragment was inserted into US2 gene to obtain recombinant virus; 2: MDV-BAC2 agarose gel electrophoresis after restriction enzyme digestion; 3: some essential genes of BAC-gpt fragment and repeat regions of MDV were analyzed by PCR (BAC-gpt, 8946 bp; gH, 2437 bp; gpt, 1372 bp; gpt-ORF, 462 bp; repA, 681 bp; 132 bp region, 432 bp; Meq, 1104 bp; pp38, 532 bp; ICP4, 1022 bp; vIL-8, 672 bp); 4: some essential genes in UL and US regions of MDV were analyzed by PCR (gB, 1100 bp; gK, 1003 bp; gL, 582 bp; gM, 1270 bp; UL31, 815 bp; UL34, 836 bp; gD, 1163 bp; gE, 1486 bp; gI, 1056 bp; US3, 1212 bp)
Fig. 5 Comparison of plaque sizes and growth characteristics of wt-MDV 814, rv-MDV 814 and BAC2-derived MDV 814 1: plaque produced by wt-MDV814 (96 h, ×200); 2: plaque produced by rv-MDV814 (96 h, ×200); 3: plaque produced by BAC2-derived MDV814 (96 h, ×200)
3
Fig. 6
Growth curves of BAC2-derived MDV 814, rv-MDV 814 and wt-MDV 814
Discussion
3.1 Key factor of selection marker In this study, the main emphasis was placed on the construction of Eco-gpt expression cassette, as obtaining and purifying recombinant viruses rely heavily on strongly and correctly expression of the Eco-gpt gene. Actually, we can use any selectable marker for the selection of recombinant viruses such as LacZ and green fluorescent protein (eGFP). If utilizing a non-positive selectable marker for enrichment of recombinant viruses, however, there will be more and more laborious works to be done. Moreover, the chance for
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
generation of recombinant viruses is very low, especially comes down to selection of strict cell-associated recombinant viruses like MDV. Because wild type viruses live in the same cell as recombinant viruses, separation recombinant viruses from wild type viruses will be laborious and time- consuming. On the contrary, utilizing positive selectable marker like gpt, recombinant viruses are enriched by selection with Mycophenolic acid and Xanthine utilizing the E. coli enzyme guanosine phosphoribosyl transferase (gpt). Selection is performed essentially according to described previously in this paper. The E. coli enzyme gpt is able to synthesize and provide Purine precursors from Xanthine in order to support replication of recombinant viruses under conditions in which the cellular Purine synthesis is blocked by Mycophenolic acid. Not withstanding, the proliferation of cells is impaired under these conditions, ultimately, we successfully enriched the completely purified recombinant viruses. During the procedure for construction of the transfer plasmid, the E. coli guanine phosphoribosyl transferase (gpt) was under the control of the HCMV immediate-early promoter and had a SV40-ploy (A) tails. For strongly and correctly expression of Eco-gpt gene, we optimized the corresponding promoter sequences of the Eco-gpt gene, according to KOZAK sequences 5'-GCCGCCACCATGG-3', KOZAK sequences were modified as 5'-CTCGAGTAC CATGA-3', which ensure the gpt can be translated correctly and strongly. This Eco-gpt gene play important role in enriching recombinant viruses. 3.2 Vital role of BAC gene integrity During the procedure for construction of the transfer plasmid, BAC plasmid were cut by appropriate restriction enzyme site (Sph I), which ensure the integrity of BAC gene sequences. Otherwise, we will fail to gaining BAC-cloned viral genome after electroporation because of the error BAC gene sequences. The transfer plasmid was constructed using the fragment Eco-gpt (1.3 kb) and the BAC vector (7.5 kb), not using selection marker LacZ or green fluorescent protein (eGFP). This shortened the target fragment that should be inserted into the US2 gene. Otherwise, huge target fragment will result in failure of generation recombination viruses. 3.3 Modifying selection and electroporation conditions Xanthine, Mycophenolic acid (MPA) and Hypoxanthine were dissolved in sodium hydroxide solutions (1 M NaOH), Filter sterilized and add 1 mL in 200 mL of DMEM, adjust pH to 7.5. Selection recombination virus conditions were modified as follow: present 300 µg of Mycophenolic acid (MPA) per ml and 65 µg of Xanthine per ml instead of 250 µg of Mycophenolic acid (MPA) per ml and 50 µg of Xanthine per ml. In addition, 25 µL fresh electro-competent bacteria DH10B instead of 20 µL was add in 0.1 cm cuvettes, in which the cells concentration should be about 2 to 3×1010 / mL. Under this electroporation condition, 1 to
5 BAC-cloned viral genomic sequences can be gained from each electroporation. 3.4 Identification BAC-cloned viral genome In this study, PCR primers were designed according to the sequences of MDV-1 GA strain (GenBank Accession No. AF147806), which is homologous 99 percent with other MDV-1 strains[24]. However, foreign scholar identified BAC-coned viral genome mainly using agarose gel electrophoresis after restriction Enzyme digestion and Southern blotting[3,5,7,24–26], which is more accuracy than our methods. But using reconstitution of MDV from BAC DNA in vitro and PCR analysis to identify BAC-coned viral genome is also useful.
4
Conclusions
In this study, the MDV-1 814 genome was cloned as a BAC and it can be stably maintained in E. coli, generation of virus mutants and analyses of essential genes should be relatively easy by utilizing Red/ET recombination system, a detailed assessment of genes expressed in the lytic, latent, and tumor phases of MDV-1 infection should be possible. In addition, it may be possible to generate a novel generation of MDV-1 vaccines based on BACs.
REFERENCES [1]
Cantello JL, Anderson AS, Francesconi A, Morgan RW. Isolation of a Marek’s disease virus (MDV) recombinant containing the lacZ gene of Escherichia coli stably inserted within the MDV US2 gene. J Virol, 1991, 65: 1584–1588.
[2]
Lee LF, Wu P, Sui D, Ren D, Kamil J, Kung HJ, Witter RL. The complete unique long sequence and the overall genomic organization of the GA strain of Marek’s disease virus. Proce Natl Acad Sci USA, 2000, 97: 6091–6096.
[3]
Schumacher D, Tischer BK, Fuchs W, Osterrieder N. Reconstitution of Marek’s disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein Bnegative MDV-1 mutant. J Virol, 2000, 74: 11088–11098.
[4]
Borst EM, Hahn G, Koszinowski UH, Messerle M. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol, 1999, 73: 8320–8329.
[5]
Messerle M, Crnkovic I, Hammerschmidt W, Ziegler H, Koszinowski UH. Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proce Natl Acad Sci USA, 1997, 94: 14759–14763.
[6]
Osterrieder N, Kamil JP, Schumacher D, Tischer BK, Trapp S. Marek’s disease virus: from miasma to model, Nat Rev Microbiol, 2006, 4: 283–294.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
[7]
Yin Z, Liu JH. Animal virology, 2nd ed, Beijing: Science
Glycoproteins E and I of Marek’s disease virus serotype 1
Press, 1997.
are essential for virus growth in cultured cells. J Virol, 2001,
[8]
Smith GA, Enquist LW. Construction and transposon
[9]
75: 11307–11318.
mutagenesis in Escherichia coli of a full-length infectious
[18] Tischer BK, Schumacher D, Messerle M, Wagner M,
clone of pseudorabies virus, an alphaherpesvirus. J Virol,
Osterrieder N. The products of the UL10 (gM) and the
1999, 73: 6405–6414.
UL49.5 genes of Marek’s disease virus serotype 1 are
Smith GA, Enquist LW. A self-recombining bacterial
essential for virus growth in cultured cells. J Gener Virol,
artificial chromosome and its application for analysis of herpesvirus pathogenesis. Proce Natl Acad Sci USA, 2000, 97: 4873–4878.
2002, 83: 997–1003. [19] Muyrers JP, Zhang Y, Testa G, Stewart AF. Rapid modification of bacterial artificial chromosomes by ET-
[10] Petherbridge L, Howes K, Baigent SJ, Sacco MA, Evans S,
recombination. Nucl Acids Res. 1999, 27: 1555–1557.
Osterrieder N, Nair V. Replication-competent bacterial
[20] Narayanan K, Williamson R, Zhang Y. Efficient and precise
artificial chromosomes of Marek’s disease virus: novel tools
engineering of a 200 kb beta-globin human/ bacterial
for generation of molecularly defined herpesvirus vaccines. J
artificial chromosome in E. coli DH10B using an inducible
Virol, 2003, 77: 8712–8718.
homologous recombination system. Gene Ther, 1999, 6:
[11] Reddy SM, Lupiani B, Gimeno IM. Rescue of a pathogenic Marek’s disease virus with overlapping cosmid DNAs: use
442–447. [21] Zhang Y, Buchholz F, Muyrers JP, Stewart AF. A new logic
of a pp38 mutant to validate the technology for the study of
for
gene function. Proce Natl Acad Sci USA, 2002, 99:
Escherichia coli. Nature Genetics, 1998, 20: 123–128.
7054–7059.
DNA
engineering
using
recombination
in
[22] Brune W, Menard C, Hobom U, Odenbreit S, Messerle M,
[12] Petherbridge L, Brown AC, Baigent SJ, Howes K, Sacco MA,
Koszinowski UH. Rapid identification of essential and
Osterrieder N, Nair1 VK. Oncogenicity of virulent Marek’s
nonessential
disease virus cloned as bacterial artificial
mutagenesis. Nature Biotechnol, 1999, 17: 360–364.
chromosomes.
J Virol, 2004, 78: 13376–13380. [13] Parcells MS, Anderson AS, Cantello JL, Morgan RW. Characterization of Marek’s disease virus insertion and deletion
herpesvirus
genes
by
direct
transposon
[23] Morgan RW, Cantello JL, McDermott CH. Transfection of chicken embryo fibroblasts with Marek’s disease virus DNA. Avian Disease, 1990, 34: 345–351.
mutants that lack US1, US10, and /or US2 and neibouring
[24] Schumacher D, Tischer BK, Trapp S, Osterrieder N. The
short-compent open reading frames. J Virol, 1994, 68:
protein encoded by the US3 orthologue of Marek’s disease
8239–8253.
virus is required for efficient de-envelopment of perinuclear
[14] Baigent SJ, Petherbridge LJ, Smith LP, Yg Zhao, Chesters PM, Nair VK. Herpesvirus of turkey reconstituted from bacterial artificial chromosome clones induces protection against Marek’s disease. J Gener Virol, 2006, 87: 769–776.
virions and involved in actin stress fiber breakdown. J Virol, 2005, 79: 3987–3997. [25] Suter M, Lew AM, Grob P, Adema GJ, Ackermann M, Shortman K, Fraefel C. BAC-VAC, a novel generation of
[15] Dorange F, Tischer BK, Vautherot JF, Osterrieder N.
(DNA) vaccines: a bacterial artificial chromosome (BAC)
Characterization of Marek’s disease virus serotype 1
containing a replication-competent, packaging-defective
(MDV-1) deletion mutants that lack UL46 to UL49 genes:
virus genome induces protective immunity against herpes
MDV-1 UL49, encoding VP22, is indispensable for virus
simplex virus 1. Proce Natl Acad Sci USA, 1999, 96:
growth. J Virol, 2002, 76: 1959–1970.
12697–12702.
[16] Osterrieder N, Schumacher D, Trapp S, Beer M, von Einem J,
[26] Delecluse HJ, Hilsendegen T, Pich D, Zeidler R,
Tischer K. Generation and exploitation of infectious bacterial
Hammerschmidt W. Propagation and recovery of intact,
artificial chromosome (BAC) clones of animal herpesviruses.
infectious Epstein-Barr virus from prokaryotic to human
Berl. Munch. Tierarztl. Wochenschr, 2003, 116, 373–380.
cells. Proce Natl Acad Sci USA, 1998, 95: 8245–8250.
[17] Schumacher D, Tischer BK, Reddy SM, Osterrieder N.
Cite this article as: Chin J Biotech, 2008, 24(4), 569í575.
Construction of Marek’s Disease Virus Serotype 814 Strain as an Infectious Bacterial Artificial Chromosome Hongyu Cui1, 2, Yunfeng Wang1, Xingming Shi1, Guangzhi Tong1, Desong Lan1, Lai He1, Huaji Qiu 1, Changjun Liu1, and Mei Wang1 1
Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, China
2
Department of Animal Medicine, College of Animal Science and Veterinary Medicine, Hebei North University, Hebei Zhangjiakou 075131, China
Abstract: The aim of this study was to construct the complete genome of Marek’s Disease Virus Serotype 1 814 strain as an infectious bacterial artificial chromosome (BAC). Using self-designed selection marker Eco-gpt (1.3 kb) and BAC vector pBeloBAC11 (7.5 kb), we constructed the transfer plasmid pUAB-gpt-BAC11. The plasmid pUAB-gpt-BAC11 and MDV TotalDNA were cotransfected into secondary CEFs; we passaged the virus-containing cells eight rounds in selection medium and obtained purified recombinant viruses. Recombinant viral genomes were extracted and electroporated into E. coli, BAC clones were identified by restriction enzyme digestion and PCR analysis. Finally, we obtained thirty-eight BAC clones, DNA from various MDV-1 BACs was transfected into CEFs, and recombinant virus was reconstituted by transfection of MDV-BAC2 DNA. In this study, we successfully cloned the complete genome of MDV-1814 strain as an infectious bacterial artificial chromosome. With these cloned genomes in hand, A revolutionary MDV-DNA engineering platform utilizing RED/ET recombination system was constructed successfully, which acclerate the understanding of MDV gene functions and promote the using of MDV as a vector for expressing foreign genes. In addition, it may be possible to generate novel MDV-1 vaccines based on the BACs. Keywords: Marek’s disease virus; bacterial artificial chromosome; molecular cloning virus; infectious clone
Introduction Marek’s disease virus (MDV) is a member of the Alphaherpesvirinae subfamily of the Herpesviridae, which is a representative oncogenic alpha herpes virus that induces T-cell lymphomas in poultry. There are three serotypes of MDV[1–7], and MDV-1 include all virulent and very virulent oncogenic viruses. Although the genomes of many MDV strains have been sequenced completely in recent years, our knowledge about the function of the majority of MDV genes is still quite insufficient. This is especially true for MDV-1
viruses, because their strict cell-associated nature and large genome size (170 kb) made the construction of viral mutants a difficult and tedious procedure. Fortunately, a novel approach for the construction of herpesvirus mutants that is based on cloning of the virus genome as a bacterial artificial chromosome (BAC) in Escherichia coli has been developed. If the target gene is cloned from BAC, mutagenesis can be done by homologous recombination in E. coli which is mainly based on RED/ET mutagenesis system. The novel
Tab. 1 Primers used to amplify different regions in this study Received: September 4, 2007; Accepted: November 23, 2007 Supported by: Open Fund of Key Laboratory of Veternary Biotechnology (No. NKLVB2005-05) Corresponding author: Yunfeng Wang and Guangzhi Tong. Tel: +86-451-8593-5058; Fax: +86-451-8593-5059; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575 Primer
Sequence (5'-3')
A-upper
ACAGGATCCGTGTTTGAATACTGG
A-lower
ATATTAATTAATGTCGACCCGGTAGTCATTAGC
B-upper
ATCTTAATTAAGCATGCTTTGGCAAAACGGAATAG
B-lower
CGCAAGCTTAATATGAATCTCTAAAACTTCTCGGC
gpt-upper
ATGGTCGACGGATCCCGCCATGCATTAG
gpt-lower
ATGGTCGACGGATCCCGCTTACAATTTACGC
US2-upper
ATATTAATTAAGCTAATGACTACCGG
US2-lower
ATCTTAATTAACTATTCCGTTTTGCCAA
repA-upper
CAT GGC GGA AAC AGC GGT TAT C
repA-lower
ATG TAT GAG AGG CGC ATT GGA G
sopB-upper
ATT CGT TAA TTG CGC GCG TAG G
sopB-lower
GAA TAT TCA GGC CAG TTA TGC T
approach has many advantages and the powerful methods of bacterial genetics allow the rapid and efficient introduction of any kind of mutation (deletion, insertion, and point mutation) into the cloned viral genome[3,5,8–22]. The aim of this study was to clone full-length genome of Marek’s disease virus serotype 1 (MDV-1) China Harbin814 strain (natural attenuated strain) as an infectious BAC. Using self-designed positive selection marker of gpt and BAC functional regions, recombinant viruses are enriched with mycophenolic acid and xanthine. Once the MDV-1 genome is cloned as a BAC and can be stably maintained in E. coli, generation of mutants and analyses of essential genes should be very easy utilizing RED/ET recombination system. a detailed assessment of genes expressed in the lytic, latent, and tumor phases of MDV-1 infection should be possible. In addition, it may be possible to generate a novel generation of MDV-1 vaccines based on BACs.
1
Materials and methods
1.1 Virus and cells Chicken embryo fibroblasts (CEFs) were generated from 10-day-old specific-pathogen-free (SPF) embryos and maintained in Dulbecco’s modified essential medium (DMEM) supplemented with 10 % fetal calf serum (Invitrogen); MDV-814 strain was reserved by Avian Infectious Diseases Laboratory of Harbin Veterinary Research Institute, China. E.coli DH10B strain and pBeloBAC11 vector was pursued from Invitrogen. Plasmid pEco-gpt was constructed by Avian Infectious Diseases Laboratory of Harbin Veterinary Research Institute; Mycophenolic acid, Xanthine and Hypoxanthine (Sigama, Germany); LipofectamineTM2000 Transfection reagent (Invitrogen); Qiagen plasmid Midi kit (Qiagen). Other standard equipments and materials for molecular biology were bought from TaKaRa. 1.2 Construction of the Recombination Plasmid In order to construct recombination viruses, a transfer
Description 2.1 kb fragment of left side homologies 3.0 kb fragment of right side homologies Primers used to identify 1.3 kb gpt gene. Primers used to identify 8.9 kb BAC-gpt Primers used to identify BAC essential genes (repA) Primers used to identify BAC essential genes (sopB)
plasmid pUAB-gpt-BAC11 has to be constructed, first, MDV-814 total DNA was purified from infected cells by sodium dodecyl sulfate-proteinase K extraction as described earlier[23]. Briefly, infected cells from a 75 cm2 tissue culture flask were lysed in 5 mL of lyse-buffer (0.2 mg/mL proteinase K, 0.6 % SDS, 100 mM NaCl, 10 mM Tris-Cl, 1 mM EDTA), after incubation at 37°C for 4 h cellular DNA and proteins were precipitated by centrifugation at 15 000 g and 4°C for 30 min, the supernatant was extracted with phenol/chloroform and DNA was precipitated with ethanol. This wild type MDV DNA was isolated from virions and total cell DNA. For constructing of BAC transfer vector, two fragments (2.1 kb and 3.0 kb) on either side of the MDV-814 US2 gene, which act as the left and right side homologies, were amplified by PCR using primers containing appropriate restriction enzyme sites (Tab. 1). Both fragments were subsequently cloned into pUC119 to generate plasmid pUAB. Then a Eco-gpt gene was amplified by PCR using primers containing Sal I restriction enzyme sites (Tab. 1) from plasmid pEco-gpt (constructed by ourselves, in which the E. coli guanine phosphoribosyl transferase (gpt) was under the control of the HCMV immediate-early promoter) and inserted into the Sal I sites of the 2.1-and 3.0-kb fragment cloned in pUAB to obtain plasmid pUAB-gpt. Finally, a BAC vector pBeloBAC11 was cut by a Sph I site and inserted into the Sph I site of the plasmid pUAB-gpt to obtain recombination plasmid pUAB-gpt-BAC11 (Fig. 1), in which the aim fragment of 8.8 kb was named BAC-gpt (Figs. 2 and 3). pUAB-gpt-BAC11 was achieved by silica-based affinity chromatography using commercially available kits (Qiagen plasmid Midi kit). 1.3 Generation of Recombinant Virus MDV-814 total DNA was purified from infected cells as described earlier. Briefly, Primary CEF cells were cotransfected by Lipofectamine TM 2000 with approximately 4 µg of
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
Fig. 1 Schematic Map of plasmid pUAB-gpt-BAC11
Fig. 2 Schematic illustration of the cloning procedure of the transfer plasmid to introduce the 8.8 kb fragment into MDV 814 genome 1: organization of MDV 814 genome; 2: schematic map of the transfer plasmid pUAB-gpt-BAC11; 3: 8.8 kb BAC-gpt fragment containing the Eco-gpt (1.3 kb) and the BAC11 sequence (the essential genes of BAC vector) was inserted into US2 gene to obtain recombinant virus
Fig. 3 Plasmid pUAB-gpt-BAC11 agarose gel electrophoresis by restriction Enzyme digestion BamHĉ: 11kb, 6.2 kb; Hind III: 10.5 kb, 6.7 kb; Pstĉ: 9.3 kb, 3.2 kb, 3 kb, 1.5 kb; Salĉ: 8.2 kb, 6.5 kb, 1.3 kb, 0.8 kb, 0.3 kb
plated on primary CEF cells in the presence of 300 µg of MDV-814 DNA and 4 µg of pUAB-gpt-BAC11 in a 60 mm dish. At 5 or 6 days after cotransfection, infected cells which cytopathic effect had completely developed were mycophenolic acid (MPA) per mL, 65 µg of xanthine per mL, and 100 µg of hypoxanthine per ml. To avoid death of actively dividing CEF, cells were seeded at a density of 5×106 cells per 60-mm dish and grown overnight, and selection medium was applied 1 h before addition of virus-containing cells. The MPA-xanthine-hypoxanthine selection was replaced at 1-day intervals. Incubate until the cells show complete special viral plaque of MDV-1 (takes 5 to 8 days). For Enrichment of Recombinant Viruses, after complete cytopathic effect (CPE) had developed, the virus-containing cells were passaged five or eight rounds in the selection medium till no CPE cells suspend in the selection medium. Finally, total DNA was purified from infected cells and the 8.8 kb fragment inserted into US2 gene was amplified by PCR using primers which frank US2 gene (Tab. 1). The recombinant virus was named rv-MDV 814. 1.4 Preparation electrocompetent cells of DH10B Competent cells were prepared by the procedure supplied with the electroporation device (BIO-RAD Gene Pulser Xcell System, Germany), with modifications to the protocol. First, Inoculate a colony of DH10B from a LB plate into 5 mL of LB, inoculate at 37°C overnight, shaking at 220 rpm, 2 mL of fresh overnight culture was inoculated into 200 mL of LB, grow the cells at 37°C shaking at 220 rpm to an OD600 of approximately 0.4–0.5 chill the cells on ice for 30 min. for all subsequent steps, keep the cells as close to 0oC as possible (in an ice/water bath) and chill all contains in ice before adding cells. Transfer the cells to a sterile, cold 500 mL centrifuge bottle and centrifuge at 5500 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold ddH2O, then resuspended all pellet in 500 mL of ice-cold ddH2O, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold ddH2O, then resuspended all pellet in 500 mL of ice-cold ddH2O, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Gently resuspended the pellet in little of ice-cold 10% glycerol, then resuspended all pellet in 500 mL of ice-cold 10% glycerol, centrifuge at 4000 rpm for 10 minutes at 4oC, carefully pour off and discard the supernatant. Resuspended the pellet in 100 mL of ice-cold 10% glycerol, then centrifuge at 5000 rpm for 5 minutes at 4oC, carefully pour off and discard the supernatant. Finally, gently resuspended the pellet in a final 1–2 mL of ice-cold 10% glycerol, transfer the suspension to some cold polypropylene tube on ice and immediately prepare electroporation. 1.5 Generation of BAC clones containing complete MDV genome To a cold, 1.5 mL polypropylene microfuge tube, add 25 µL fresh electrocompetent bacteria DH10B in 0.1 cm
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
cuvettes, then add 5 µL to 10 µL of infected-cell DNA, gently mix well and incubate on ice for 3 to 5 minutes, and electroporation was performed in 0.1-cm-wide cuvettes at 2000 V, a resistance of 200 ȍ, and a capacitance of 25 µF. Transformed bacteria were immediately incubated in 1 mL of Luria-Bertani (LB) medium supplemented with 0.2 mM glucose, 0.1 mM MgSO4, 0.1 mM MgCl2 for 1 h at 37°C, and then plated on LB agar containing 30 µg of chloramphenicol per mL. Single colonies were picked and placed in liquid LB medium, and small-scale preparations of BAC DNA were performed by alkaline lysis of E. coli. Large-scale preparation of BAC DNA was achieved by silica-based affinity chromatography using commercially available kits (Qiagen). The integrity of the BAC DNA was checked by digestion with three different restriction enzymes (BamH I, EcoR I and Pst I). The MDV-BAC clones were also validated by PCR with several pairs of primers (Tab. 1) specifically for the essential genes of MDV replication in vitro and/or in vivo. 1.6 Determination virus growth curves of BAC-derived MDV 814 For preparation Circular Viral Genomes, total DNA was purified from infected cells (80% CPE) using Qiagen plasmid Midi kit, MDV-BAC DNA were transfected into primary CEFs, with LipofectamineTM 2000. After 5 days by transfection, MDV-1-specific viral plaques clearly appeared in the dish which was named BAC-derived MDV 814. To determine whether growth of the recombinant viruses of BAC-derived MDV 814 was comparable to that of parental virus (wt-MDV814) and recombinant virus (rv-MDV814), plaque sizes and virus growth curves were respectively measured. Briefly, the BAC-derived viruses were co-seeded with fresh CEF and sizes of plaques were compared to those induced by parental MDV 814 at the same time. In case of growth curves, 1×10-3 PFU/cell of virus was used to infect fresh CEF and seeded on six-well plates in the same way. At various times p.i (post-infection, 24 h, 48 h, 96 h, 120 h, 144 h), virus-infected CEF were harvested and titrated by co-seeding 10-fold virus dilutions with fresh CEF on sixwell plates, titer were counted 5 days post-infection and the mean number of plaques were determined. Growth curves were carried out at 37oC.
2
Results
2.1 Generation recombination Plasmid The recombinant plasmid, pUAB-gpt-BAC was constructed (Fig. 1, total 17156 bp), in which contain the BAC functional fragments (7521 bp) and Eco-gpt selectively expressional cassette (1372 bp) flanked by sequences homologous to the desired integration site (US2 gene, 890 bp) in the viral genome (left and right side homologies). There is a 34 bp loxP site in the terminal sequences of BAC-gpt (8.8 kb fragment), it is an available homologous
recombinant site in the future. The results that restriction enzymes analysis of Sal I, Pst I, BamH I and Hind III and sequencing of the recombinant plasmid pUAB-gpt-BAC were all correct (Fig. 3). 2.2 Enrichment and purification of Recombinant Virus For Enrichment of Recombinant Viruses, after complete cytopathic effect (CPE) had developed, the virus-containing cells were passaged eight rounds in the selection medium till no CPE cells suspend in the selection medium. Total DNA from the eighth-round infected cells was extracted as described previously, using the total DNA as template, the 8.8 kb fragment replaced the US2 gene can be correctly amplified by PCR with primers flanked US2 gene, at the same time, the US2 gene sequences (890 bp) of the wt-MDV could not be able to amplified (Fig. 4-3). This PCR test indicated that we obtained purified recombinant viruses after eight-round selection. 2.3 Identification of BACs containing complete MDV-1 814 genomes Total of 52 BAC clones were obtained from the electroporated E. coli DH10B, and the BAC DNA was isolated for each clone. After validated by digestion with different restriction enzymes and PCR with special primers for the essential genes of MDV replication in vitro and/or in vivo, 38 clones were found to be positive (Fig. 4-1), in which the complete MDV-814 genome was harbored. The results of MDV-BAC2 agarose gel electrophoresis after restriction Enzyme digestion accord with restriction Enzyme fragments of MDV GA strain analyzed by DNASTAR software (Fig. 4-2), MDV-BAC2 DNA contain the BAC functional fragments and Eco-gpt selectively expressional cassette (Fig. 4-3). The genes and gene products essential for Marek’s disease virus (MDV) replication in vitro and/or in vivo were correctly amplified by PCR. (Fig. 4). 2.4 Reconstitution of MDV from BAC DNA According to methods previously described, DNA from MDV-814-BAC2 was transfected into CEFs with LipofectamineTM 2000 transfection reagent. We successfully reconstituted the recombinant virus (BAC2-redrived MDV-814). This assay indicated that MDV-BAC2 is an infectious BAC. MDV-BAC2 was permitted to comparative analysis the growth dynamics and plaque size with the parental virus (wt-MDV-814) and recombinant virus (v-MDV-814). Plaque size of BAC2-derived MDV-814 was similar with parental MDV 814 (wt-MDV-814) plaques at 96 h post-infected fresh CEF cells (Fig. 5). It was demonstrated that BAC2-redrived MDV814 exhibited growth characteristics that were virtually identical to those of parental wt-MDV 814 and recombinant virus (v-MDV-814) (Fig. 6). From the plaque sizes and growth characteristics, we concluded that the biological properties of MDV-1 BACs in vitro were indistinguishable from those of the parental strain.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
Fig. 4 Schematic map of MDV 814-BAC, restriction enzyme digestion and PCR analysis 1: schematic map of MDV 814-BAC, in which the BAC-gpt fragment was inserted into US2 gene to obtain recombinant virus; 2: MDV-BAC2 agarose gel electrophoresis after restriction enzyme digestion; 3: some essential genes of BAC-gpt fragment and repeat regions of MDV were analyzed by PCR (BAC-gpt, 8946 bp; gH, 2437 bp; gpt, 1372 bp; gpt-ORF, 462 bp; repA, 681 bp; 132 bp region, 432 bp; Meq, 1104 bp; pp38, 532 bp; ICP4, 1022 bp; vIL-8, 672 bp); 4: some essential genes in UL and US regions of MDV were analyzed by PCR (gB, 1100 bp; gK, 1003 bp; gL, 582 bp; gM, 1270 bp; UL31, 815 bp; UL34, 836 bp; gD, 1163 bp; gE, 1486 bp; gI, 1056 bp; US3, 1212 bp)
Fig. 5 Comparison of plaque sizes and growth characteristics of wt-MDV 814, rv-MDV 814 and BAC2-derived MDV 814 1: plaque produced by wt-MDV814 (96 h, ×200); 2: plaque produced by rv-MDV814 (96 h, ×200); 3: plaque produced by BAC2-derived MDV814 (96 h, ×200)
3
Fig. 6
Growth curves of BAC2-derived MDV 814, rv-MDV 814 and wt-MDV 814
Discussion
3.1 Key factor of selection marker In this study, the main emphasis was placed on the construction of Eco-gpt expression cassette, as obtaining and purifying recombinant viruses rely heavily on strongly and correctly expression of the Eco-gpt gene. Actually, we can use any selectable marker for the selection of recombinant viruses such as LacZ and green fluorescent protein (eGFP). If utilizing a non-positive selectable marker for enrichment of recombinant viruses, however, there will be more and more laborious works to be done. Moreover, the chance for
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
generation of recombinant viruses is very low, especially comes down to selection of strict cell-associated recombinant viruses like MDV. Because wild type viruses live in the same cell as recombinant viruses, separation recombinant viruses from wild type viruses will be laborious and time- consuming. On the contrary, utilizing positive selectable marker like gpt, recombinant viruses are enriched by selection with Mycophenolic acid and Xanthine utilizing the E. coli enzyme guanosine phosphoribosyl transferase (gpt). Selection is performed essentially according to described previously in this paper. The E. coli enzyme gpt is able to synthesize and provide Purine precursors from Xanthine in order to support replication of recombinant viruses under conditions in which the cellular Purine synthesis is blocked by Mycophenolic acid. Not withstanding, the proliferation of cells is impaired under these conditions, ultimately, we successfully enriched the completely purified recombinant viruses. During the procedure for construction of the transfer plasmid, the E. coli guanine phosphoribosyl transferase (gpt) was under the control of the HCMV immediate-early promoter and had a SV40-ploy (A) tails. For strongly and correctly expression of Eco-gpt gene, we optimized the corresponding promoter sequences of the Eco-gpt gene, according to KOZAK sequences 5'-GCCGCCACCATGG-3', KOZAK sequences were modified as 5'-CTCGAGTAC CATGA-3', which ensure the gpt can be translated correctly and strongly. This Eco-gpt gene play important role in enriching recombinant viruses. 3.2 Vital role of BAC gene integrity During the procedure for construction of the transfer plasmid, BAC plasmid were cut by appropriate restriction enzyme site (Sph I), which ensure the integrity of BAC gene sequences. Otherwise, we will fail to gaining BAC-cloned viral genome after electroporation because of the error BAC gene sequences. The transfer plasmid was constructed using the fragment Eco-gpt (1.3 kb) and the BAC vector (7.5 kb), not using selection marker LacZ or green fluorescent protein (eGFP). This shortened the target fragment that should be inserted into the US2 gene. Otherwise, huge target fragment will result in failure of generation recombination viruses. 3.3 Modifying selection and electroporation conditions Xanthine, Mycophenolic acid (MPA) and Hypoxanthine were dissolved in sodium hydroxide solutions (1 M NaOH), Filter sterilized and add 1 mL in 200 mL of DMEM, adjust pH to 7.5. Selection recombination virus conditions were modified as follow: present 300 µg of Mycophenolic acid (MPA) per ml and 65 µg of Xanthine per ml instead of 250 µg of Mycophenolic acid (MPA) per ml and 50 µg of Xanthine per ml. In addition, 25 µL fresh electro-competent bacteria DH10B instead of 20 µL was add in 0.1 cm cuvettes, in which the cells concentration should be about 2 to 3×1010 / mL. Under this electroporation condition, 1 to
5 BAC-cloned viral genomic sequences can be gained from each electroporation. 3.4 Identification BAC-cloned viral genome In this study, PCR primers were designed according to the sequences of MDV-1 GA strain (GenBank Accession No. AF147806), which is homologous 99 percent with other MDV-1 strains[24]. However, foreign scholar identified BAC-coned viral genome mainly using agarose gel electrophoresis after restriction Enzyme digestion and Southern blotting[3,5,7,24–26], which is more accuracy than our methods. But using reconstitution of MDV from BAC DNA in vitro and PCR analysis to identify BAC-coned viral genome is also useful.
4
Conclusions
In this study, the MDV-1 814 genome was cloned as a BAC and it can be stably maintained in E. coli, generation of virus mutants and analyses of essential genes should be relatively easy by utilizing Red/ET recombination system, a detailed assessment of genes expressed in the lytic, latent, and tumor phases of MDV-1 infection should be possible. In addition, it may be possible to generate a novel generation of MDV-1 vaccines based on BACs.
REFERENCES [1]
Cantello JL, Anderson AS, Francesconi A, Morgan RW. Isolation of a Marek’s disease virus (MDV) recombinant containing the lacZ gene of Escherichia coli stably inserted within the MDV US2 gene. J Virol, 1991, 65: 1584–1588.
[2]
Lee LF, Wu P, Sui D, Ren D, Kamil J, Kung HJ, Witter RL. The complete unique long sequence and the overall genomic organization of the GA strain of Marek’s disease virus. Proce Natl Acad Sci USA, 2000, 97: 6091–6096.
[3]
Schumacher D, Tischer BK, Fuchs W, Osterrieder N. Reconstitution of Marek’s disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein Bnegative MDV-1 mutant. J Virol, 2000, 74: 11088–11098.
[4]
Borst EM, Hahn G, Koszinowski UH, Messerle M. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol, 1999, 73: 8320–8329.
[5]
Messerle M, Crnkovic I, Hammerschmidt W, Ziegler H, Koszinowski UH. Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proce Natl Acad Sci USA, 1997, 94: 14759–14763.
[6]
Osterrieder N, Kamil JP, Schumacher D, Tischer BK, Trapp S. Marek’s disease virus: from miasma to model, Nat Rev Microbiol, 2006, 4: 283–294.
Hongyu Cui et al. / Chinese Journal of Biotechnology, 2008, 24(4): 569–575
[7]
Yin Z, Liu JH. Animal virology, 2nd ed, Beijing: Science
Glycoproteins E and I of Marek’s disease virus serotype 1
Press, 1997.
are essential for virus growth in cultured cells. J Virol, 2001,
[8]
Smith GA, Enquist LW. Construction and transposon
[9]
75: 11307–11318.
mutagenesis in Escherichia coli of a full-length infectious
[18] Tischer BK, Schumacher D, Messerle M, Wagner M,
clone of pseudorabies virus, an alphaherpesvirus. J Virol,
Osterrieder N. The products of the UL10 (gM) and the
1999, 73: 6405–6414.
UL49.5 genes of Marek’s disease virus serotype 1 are
Smith GA, Enquist LW. A self-recombining bacterial
essential for virus growth in cultured cells. J Gener Virol,
artificial chromosome and its application for analysis of herpesvirus pathogenesis. Proce Natl Acad Sci USA, 2000, 97: 4873–4878.
2002, 83: 997–1003. [19] Muyrers JP, Zhang Y, Testa G, Stewart AF. Rapid modification of bacterial artificial chromosomes by ET-
[10] Petherbridge L, Howes K, Baigent SJ, Sacco MA, Evans S,
recombination. Nucl Acids Res. 1999, 27: 1555–1557.
Osterrieder N, Nair V. Replication-competent bacterial
[20] Narayanan K, Williamson R, Zhang Y. Efficient and precise
artificial chromosomes of Marek’s disease virus: novel tools
engineering of a 200 kb beta-globin human/ bacterial
for generation of molecularly defined herpesvirus vaccines. J
artificial chromosome in E. coli DH10B using an inducible
Virol, 2003, 77: 8712–8718.
homologous recombination system. Gene Ther, 1999, 6:
[11] Reddy SM, Lupiani B, Gimeno IM. Rescue of a pathogenic Marek’s disease virus with overlapping cosmid DNAs: use
442–447. [21] Zhang Y, Buchholz F, Muyrers JP, Stewart AF. A new logic
of a pp38 mutant to validate the technology for the study of
for
gene function. Proce Natl Acad Sci USA, 2002, 99:
Escherichia coli. Nature Genetics, 1998, 20: 123–128.
7054–7059.
DNA
engineering
using
recombination
in
[22] Brune W, Menard C, Hobom U, Odenbreit S, Messerle M,
[12] Petherbridge L, Brown AC, Baigent SJ, Howes K, Sacco MA,
Koszinowski UH. Rapid identification of essential and
Osterrieder N, Nair1 VK. Oncogenicity of virulent Marek’s
nonessential
disease virus cloned as bacterial artificial
mutagenesis. Nature Biotechnol, 1999, 17: 360–364.
chromosomes.
J Virol, 2004, 78: 13376–13380. [13] Parcells MS, Anderson AS, Cantello JL, Morgan RW. Characterization of Marek’s disease virus insertion and deletion
herpesvirus
genes
by
direct
transposon
[23] Morgan RW, Cantello JL, McDermott CH. Transfection of chicken embryo fibroblasts with Marek’s disease virus DNA. Avian Disease, 1990, 34: 345–351.
mutants that lack US1, US10, and /or US2 and neibouring
[24] Schumacher D, Tischer BK, Trapp S, Osterrieder N. The
short-compent open reading frames. J Virol, 1994, 68:
protein encoded by the US3 orthologue of Marek’s disease
8239–8253.
virus is required for efficient de-envelopment of perinuclear
[14] Baigent SJ, Petherbridge LJ, Smith LP, Yg Zhao, Chesters PM, Nair VK. Herpesvirus of turkey reconstituted from bacterial artificial chromosome clones induces protection against Marek’s disease. J Gener Virol, 2006, 87: 769–776.
virions and involved in actin stress fiber breakdown. J Virol, 2005, 79: 3987–3997. [25] Suter M, Lew AM, Grob P, Adema GJ, Ackermann M, Shortman K, Fraefel C. BAC-VAC, a novel generation of
[15] Dorange F, Tischer BK, Vautherot JF, Osterrieder N.
(DNA) vaccines: a bacterial artificial chromosome (BAC)
Characterization of Marek’s disease virus serotype 1
containing a replication-competent, packaging-defective
(MDV-1) deletion mutants that lack UL46 to UL49 genes:
virus genome induces protective immunity against herpes
MDV-1 UL49, encoding VP22, is indispensable for virus
simplex virus 1. Proce Natl Acad Sci USA, 1999, 96:
growth. J Virol, 2002, 76: 1959–1970.
12697–12702.
[16] Osterrieder N, Schumacher D, Trapp S, Beer M, von Einem J,
[26] Delecluse HJ, Hilsendegen T, Pich D, Zeidler R,
Tischer K. Generation and exploitation of infectious bacterial
Hammerschmidt W. Propagation and recovery of intact,
artificial chromosome (BAC) clones of animal herpesviruses.
infectious Epstein-Barr virus from prokaryotic to human
Berl. Munch. Tierarztl. Wochenschr, 2003, 116, 373–380.
cells. Proce Natl Acad Sci USA, 1998, 95: 8245–8250.
[17] Schumacher D, Tischer BK, Reddy SM, Osterrieder N.