Crack cocaine addiction, early life stress and accelerated cellular aging among women

    Crack cocaine addiction, early life stress and accelerated cellular aging among women Mateus Luz Levandowski, Saulo Gantes Tractenberg, Lucas Ara´ujo de Azeredo, Tatiana De Nardi, Diego L. Rovaris, Claiton H.D. Bau, Lucas B. Rizzo, Pawan Kumar Maurya, Elisa Brietzke, Audrey R. Tyrka, Rodrigo Grassi-Oliveira PII: DOI: Reference:

S0278-5846(16)30094-X doi: 10.1016/j.pnpbp.2016.06.009 PNP 8937

To appear in:

Progress in Neuropsychopharmacology & Biological Psychiatry

Received date: Revised date: Accepted date:

19 April 2016 19 June 2016 19 June 2016

Please cite this article as: Levandowski Mateus Luz, Tractenberg Saulo Gantes, de Azeredo Lucas Ara´ ujo, De Nardi Tatiana, Rovaris Diego L., Bau Claiton H.D., Rizzo Lucas B., Maurya Pawan Kumar, Brietzke Elisa, Tyrka Audrey R., GrassiOliveira Rodrigo, Crack cocaine addiction, early life stress and accelerated cellular aging among women, Progress in Neuropsychopharmacology & Biological Psychiatry (2016), doi: 10.1016/j.pnpbp.2016.06.009

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Title: Crack Cocaine Addiction, Early Life Stress and Accelerated Cellular Aging among Women

T

Author names:

IP

Mateus Luz Levandowski1*, Saulo Gantes Tractenberg1*, Lucas Araújo de Azeredo1, Tatiana De Nardi1, Diego L. Rovaris2, Claiton H. D. Bau2, Lucas B. Rizzo3, Pawan Kumar Maurya3,

* These authors contributed equally to this work.

NU

Author affiliations:

SC R

Elisa Brietzke3, Audrey R. Tyrka4, Rodrigo Grassi-Oliveira1

1. Developmental Cognitive Neuroscience Lab (DCNL), Biomedical Research Institute

MA

(IPB), Pontifical Catholic University of Rio Grande do Sul (PUCRS), Brazil; 2. Department of Genetics, Instituto de Biociências, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, Brazil;

D

3. Research Group in Behavioral Neuroscience of Bipolar Disorder, Departament of

TE

Psychiatry, Federal University of São Paulo (Unifesp), São Paulo, SP, Brazil. 4. Mood Disorders Research Program and Laboratory for Clinical and Translational

USA.

CE P

Neuroscience, Department of Psychiatry and Human Behavior, Brown University,

Corresponding author:

AC

Dr. Rodrigo Grassi-Oliveira, Faculdade de Psicologia, Psychology Department, Pontifical Catholic University of Rio Grande do Sul, Avenida Ipiranga, 6681, Prédio 11, Sala 936, Partenon, Porto Alegre.

ACCEPTED MANUSCRIPT

Abstract

T

Background: Early life stress (ELS) and addiction are related to age-related diseases and

IP

telomere shortening. However, the role of telomere length (TL) in crack cocaine addiction

SC R

remains unknown. The purpose of this study was to investigate the TL in a sample of crack cocaine dependent-women who reported an ELS history and in a community-based sample of elderly women as a reference group for senescence. Methods: This study included treatment

NU

seeking crack cocaine dependents women (n = 127) and elderly women without a psychiatric

MA

diagnosis (ELD, n = 49). The crack cocaine sample was divided in two groups according to their Childhood Trauma Questionnaire (CTQ) scores: presence of history of childhood abuse and neglect (CRACK-ELS) and absence of ELS history (CRACK). TL was assessed by T/S

TE

D

ratio obtained from peripheral blood DNA using quantitative PCR assay. Results: CRACK and CRACK-ELS subjects exhibited shortened TL in comparison to the ELD group, despite

CE P

their younger age. Among crack cocaine sample, CRACK-ELS group had significantly shorter telomeres than the CRACK group. Correlation analysis within crack cocaine group

AC

indicated that TL was negatively correlated with emotional abuse scores. Conclusions: These results support previous findings associating telomere shortening with both ELS and drug addiction. This study suggests new evidence of a distinct biological phenotype for drugdependent women with ELS. The results support the biological senescence hypothesis underpinning ELS experience. Keywords: Aging, Child abuse, Cocaine, Senescence, Substance-related disorders, Telomere.

1. Introduction The burden of cocaine addiction is estimated to be around 16 disability adjusted life years (DALYs) per 100.000 individuals (Degenhardt, Whiteford, & Hall, 2014), and an

ACCEPTED MANUSCRIPT increased mortality rate of up to 8 times higher than that expected in a similar population without drug abuse history (Barrio et al., 2013). Long-term cocaine use contributes to

T

important health problems, including coronary artery disease (Degenhardt et al., 2011), major

IP

depressive disorder (Herrero, Domingo-Salvany, Torrens, Brugal, & Investigators, 2008),

SC R

cognitive decline (Verdejo-Garcia, Perez-Garcia, Sanchez-Barrera, Rodriguez-Fernandez, & Gomez-Rio, 2007; Viola et al., 2015), and. In addition, cocaine use has been associated with increased peripheral inflammatory mediators (Araos et al., 2015; Fox et al., 2012;

NU

Levandowski et al., 2014) and age-related atrophy in grey matter volume (Ersche, Jones,

MA

Williams, Robbins, & Bullmore, 2013) both of which are commonly seen in association with aging and age-related disorders (Sander et al., 2008). Prior reports have linked cocaine abuse and other substances (i.e., alcohol and heroin)

TE

D

with acceleration of normal aging, suggesting a role for immunoscenecense and accelerated telomere shortening (Beach, Lei, Brody, Yu, & Philibert, 2014; Cheng et al., 2013; Pavanello

CE P

et al., 2011; Reece, 2007; Yang et al., 2013). Telomeres are long nucleotide repeats located at the end of chromosomes that preserve genetic information by mitigating nonhomologous

AC

recombination and nucleolytic degradation (Blackburn, 2005). Telomere shortening is a natural physiologic process that occurs in aging (Harley, Futcher, & Greider, 1990), and is also associated with several age-related diseases, such as Alzheimer Disease (Panossian et al., 2003), major depression (K. K. Ridout, Ridout, Price, Sen, & Tyrka, 2016), cardiovascular (Yang et al., 2009) and autoimmune disorders (Hohensinner, Goronzy, & Weyand, 2011). Recently, two studies found accelerated cellular aging in heroin addicts. One study found lower telomerase activity, a reverse transcriptase that limits telomere shortening, in abstinent heroin addicts compared with healthy controls without a history of substance abuse (Cheng et al., 2013). Moreover, this finding was inversely correlated with structural integrity of gray and white matter of the prefrontal cortex. The second study found reduced leukocyte

ACCEPTED MANUSCRIPT telomere length (TL) in heroin users in comparison to controls (Yang et al., 2013). Considering that both heroin (Zhou et al., 2000) and crack cocaine (Zaparte et al., 2015)

T

addiction are associated with increased oxidative stress, and this could lead to damage to

IP

telomere DNA and accelerated telomere shortening (Kawanishi & Oikawa, 2004), it is

SC R

reasonable to hypothesize that crack cocaine addiction could also accelerate telomere shortening processes. However, to our knowledge, there is no previous study investigating TL in crack cocaine users.

NU

Early life stress (ELS) is another important factor that has been associated with

MA

accelerated telomere shortening (Price, Kao, Burgers, Carpenter, & Tyrka, 2013; S. J. Ridout et al., 2015). Moreover, high rates of early life trauma have been described among women with crack cocaine dependence (Bertoni et al., 2014) and they are often more susceptible to

TE

D

the complications of crack cocaine compared to their male counterparts (Bastos & Bertoni, 2014). Furthermore, women with crack cocaine addiction with a severe ELS history present

CE P

distinct behavioral (Francke, Viola, Tractenberg, & Grassi-Oliveira, 2013), immune (Levandowski et al., 2013; Levandowski et al., 2014) and neurotrophic (Viola et al., 2014)

AC

phenotypes when compared to those without such early life exposure. Thus, the current study was designed to investigate the TL in a sample of crack cocaine dependent women with and without a history of ELS. In order to test our hypothesis about accelerated aging, we recruited a group of elderly women as a reference group. This reference group allows us, for the first time, to test if drug addiction with and without ELS exposure could be related to cellular senescence. Therefore, our hypothesis is that crack cocaine dependent women reporting ELS will exhibit accelerated cellular senescence, as measured by TL.

2. Material and Methods

ACCEPTED MANUSCRIPT 2.1. Study Design This study had a cross-sectional design and included 127 female crack cocaine

T

dependent women and 49 elderly women without mental disorders (ELD). Crack cocaine

IP

users were split into two distinct groups in according with presence (CRACK-ELS, n = 93) or

SC R

absence (CRACK, n = 34) of severe ELS history. All participants provided written informed consent before inclusion in the study, which was approved by the Ethical Committees of the

NU

participating institutions.

MA

2.2. Participants

2.2.1. Women with Crack Cocaine Addiction Women with crack cocaine addiction were recruited from a public and voluntary

TE

D

detoxification treatment (21 days of inpatient treatment at a public hospital from southern Brazil). The inclusion criteria were as follows: (1) age between 18–55 years; (2) diagnosis of

CE P

crack use disorder according to the Diagnostic and Statistical Manual of Mental Disorders 4th edition (DSM-IV); (3) absence of psychotic syndromes and other severe medical condition

AC

and (4) absence of corticosteroids, antibiotics or anti-inflammatory drug use. All participants were treated in an inpatient abstinence controlled environment, so they had no access to alcohol, cigarettes or other drugs. All participants were receiving a symptom-driven cocaine detoxification medication protocol, composed of neuroleptics, analgesics, antidepressants or mood stabilizers. All data (clinical assessment and blood draw) were collected at the 4th day post-admission in order to avoid ongoing cocaine intoxication.

2.2.2. Elderly Women

ACCEPTED MANUSCRIPT Elderly women were recruited from community-based elder support groups from the same region of Brazil. Considering our hypothesis, we chose to include elderly individuals as

T

a reference group for cellular senescence (Sander et al., 2008). All elderly subjects were

IP

assessed for the following inclusion criteria: (1) absence of history of ELS; (2) no current

SC R

symptoms suggestive of dementia or other neurological disorders; (3) no current or past cancer diagnosis and (4) no unstable or severe medical condition. We did not exclude individuals who were in regular treatment regarding chronic diseases, including diabetes (n =

NU

6), hypertension (n = 3), osteoporosis (n = 15), rheumatoid arthritis (n = 14) and thyroid

MA

disorders (n = 15) due to the high prevalence of these clinical conditions in Brazilian aging

TE

2.3. Clinical Assessment

D

samples (Schmidt et al., 2011).

The clinical characteristics of both crack cocaine and elderly group were assessed by

CE P

well-trained psychologists through clinical interview. Information concerning socialdemographic status, height, weight and clinical health history were also obtained. Body mass

AC

index [BMI = weight (kg)/height² (m²)] was calculated and included in the protocol. Psychiatric diagnoses were assessed using semi-structured clinical interview following the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV) criteria. In addition, self-administered questionnaires were used to assess symptoms severity. The Beck Depression Inventory (BDI-II) (Gorenstein & Andrade, 1996) and the Geriatric Depression Scale – Short Form (GDS-15) were used to measure the severity of depressive symptoms in crack cocaine and elderly groups, respectively. Cocaine Selective Severity Assessment (CSSA), adapted for crack users (Kampman et al., 1998; Kluwe-Schiavon et al., 2015), was used to evaluate the severity of the withdrawal symptoms during detoxification. The Addiction Severity Index version 6 (ASI-6) (Kessler et al., 2012) was also assessed to obtain

ACCEPTED MANUSCRIPT information regarding patterns of crack cocaine use, age of onset and crack cocaine abuse

T

severity.

IP

2.4. Early Life Stress

SC R

A history of ELS was assessed using the validated Portuguese version of Childhood Trauma Questionnaire (CTQ) (Grassi-Oliveira et al., 2014) which includes assessment of sexual, physical and emotional abuse and physical and emotional neglect during early life.

NU

CTQ contains a five-point Likert-type scale, including 5 subscales. ELS was classified as

MA

moderate to severe according to the cutoff point postulated by Bernstein and Fink (Bernstein & Fink, 1998).

TE

D

2.5. Telomere Length (TL) Assessment Genomic DNA was isolated from peripheral blood. Prior to genotyping, DNA

CE P

concentrations in samples were assessed using NanoDrop 1000 (Thermo Fisher Scientific, Wilmington, US) and set to 50 ng/ul. TL was measured as previously described by Cawthon

AC

(Cawthon, 2009). Briefly, the TL measurement via quantitative PCR (qPCR) involves determining the ratio of the telomere (T) repeat copy number to a single-copy gene (S) copy number (T/S ratio) using a standard curve. This ratio is proportional to the average TL. Telomere (T) and albumin (S) PCRs were performed on the same plate using a monochrome multiplex qPCR. One master mix was prepared containing SYBR® Select Master Mix (Life Technologies,

USA)

and

primers

for

telomeres

ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT

3’

(Tel-g: and

Tel-c:

5’ 5’

TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA 3’) and for albumin (Alb-u: 5’ CGGCGGCGGGCGGCGCGGGCTGGGCGGAAATGCTGCACAGAATCCTTG 3’; Alb-d: 5’ GCCCGGCCCGCCGCGCCCGTCCCGCCGGAAAAGCATGGTCGCCTGTT

ACCEPTED MANUSCRIPT 3’. Prior to the experiment, primer sets were tested thoroughly to determine reaction efficiency, specificity, and the absence of primer-dimers. The final primer concentrations

T

were 900 ηM for Tel-g, Alb-u, and Alb-d. The final Tel-c primer concentration was 600 ηM.

IP

The final volume of the reaction was 25 uL per well for all markers.

SC R

The standard curve was composed based on a 5-point serial dilution of reference DNA from a single person, and the dilution ranged from 150 to 1.85 ηg. The qPCRs were done on ViiA™ 7 Real-Time PCR System with 96-well block (Life Technologies, USA). The thermal

NU

cycling profile for telomere amplification consisted of Stage 1: 15 min at 95°C; Stage 2: 2

MA

cycles of 15 s at 94°C, 15 s at 49°C; and Stage 3: 35 cycles of 15 s at 94°C, 10 s at 68°C, 19 s at 74°C with signal acquisition, 10 s at 85°C, 19 s at 88°C with signal acquisition. The 74°C reads provided the Ct values for the amplification of the telomere template, and the 88°C

TE

D

reads provided the Ct values for the amplification of the albumin template. The specificity of

CE P

products synthesis was verified by melting curve analysis.

2.6. Statistical analysis

AC

All variables were tested for distribution normality using the Kolmogorov-Smirnov test. Demographic and clinical characteristics of groups were compared using Student’s t-test and one-way ANOVA when appropriated. In a first step, one-way ANOVA was used to compare TL between ELD, CRACK and CRACK-ELS groups. BMI and education did not reach the threshold for confounding effects, which was defined by the association with both the outcome (TL) and the study factor (groups). Due to the lack of homoscedasticity in this analysis, the Welch’s correction was performed. Tukey post hoc test was used to compare differences between groups accounting for multiple testing. In a second step, an analysis restricted to the CRACK and CRACK-ELS groups was performed to explore the role of different types of ELS on TL by using one-way ANOVA

ACCEPTED MANUSCRIPT with Tukey post hoc test. BMI, education, depressive symptoms, age of onset drug abuse, and craving symptoms did not meet the criterion for confounding effects in this analysis. We also

T

performed Pearson/Spearman correlations between CTQ total and subscales score and TL. All

IP

statistical analyses were performed with Statistical Package for the Social Sciences version

SC R

17.0 (SPSS, Chicago, IL, USA). Since two independent steps were carried out, we calculated corrected p-values (corrected p-value = p-value x 2) for one-way ANOVAs. In the correlation analyses, we have calculated corrected p-values by taking into account the 11

MA

NU

Pearson/Spearman correlations performed (corrected p-value = p-value x 11).

3. Results

Table 1 summarizes the demographic and clinical characteristics of the samples.

TE

D

Within the crack cocaine dependent groups, we found differences regarding BMI and depression, with higher scores in the CRACK-ELS group. In addition, as expected, the ELD

cocaine groups.

CE P

group was more than twice as old and had more years of formal education than the crack

AC

Differences in TL were statistically significant between groups (Figure 1) as determined by Welch's ANOVA (F(2,81.68) = 15.964, corrected p < .001). The post hoc test revealed that CRACK-ELS (Tukey, p < .001) and CRACK (Tukey, p = .021) groups had significantly shorter TL than ELD group. CRACK-ELS group had significantly shorter TL than CRACK group (Tukey, p = .035). Although demographic and clinical characteristics did not meet criteria for confounding effects, we carried out an analysis of covariance adjusting for age, educational level and BMI. These variables were not significant in this model and the group effects remained significant (F(2,158) = 6.310, p .002). The frequency of each type of ELS is shown in Figure 2A. The largest proportion of crack cocaine dependent women reported exposure to both childhood neglect and childhood

ACCEPTED MANUSCRIPT abuse. When we investigated TL in distinct ELS types within crack cocaine groups (Figure 2B), we found that users reporting exposure to abuse-only forms of childhood maltreatment

T

(Tukey, p = .023) as well as abuse combined with neglect exposure (Tukey, p < .012) had

IP

shorter telomere than users without ELS (F(3,123) = 4.104, corrected p = .016). In addition, we

SC R

did not find a statistical difference between TL of users reporting neglect-only exposure and users without ELS (Tukey, p < .201), possibly due to a Type-II error, given the small sample size in this group.

NU

Correlation analysis within CRACK and CRACK-ELS groups indicated that TL was

MA

negatively correlated with Emotional Abuse CTQ subscale score (r = - .257, corrected p = .044). Moreover, TL was not correlated with depression or craving symptoms, BMI,

4. Discussion

TE

D

education level, age of onset drug abuse within crack cocaine groups.

CE P

The current study provides novel evidence of shortened TL in crack cocaine dependent women, especially in those reporting ELS exposure. These findings support recent behavioral

AC

findings suggesting that crack cocaine use may confer a ‘‘fast-track’’ aging process (Sanvicente-Vieira, Kommers-Molina, De Nardi, Francke, & Grassi-Oliveira, 2016). Here we demonstrated that both crack cocaine groups (with and without a prior history of ELS) have shortened TL when compared with elderly women without mental disorders. The rationale to compare crack cocaine groups with elderly women was based on the expectation that TL in these individuals could be a reliable marker of cellular aging processes, since TL shortens progressively across the lifespan (Hohensinner et al., 2011). Telomere shortening has been found in many mental disorders, including mood disorder patients (K. K. Ridout et al., 2016), anxiety and posttraumatic stress disorder (Lindqvist et al., 2015), schizophrenia (Kao et al., 2008) and, recently, three studies that

ACCEPTED MANUSCRIPT directly addressed TL in substance abusers (Cheng et al., 2013; Pavanello et al., 2011; Yang et al., 2013). Beyond investigating the associations between TL and drug addiction, Cheng

T

and collaborators (2013) also explored the role of telomerase activity. They found that not

IP

only TL, but also telomerase activity is reduced in drug users. In addition, the reduction of

SC R

telomerase activity was correlated with structural damage in the right dorsolateral prefrontal cortex (DLPFC) and with the altered pattern of functional connectivity between DLPFC and other brain regions associated with reward and aging processes (Cheng et al., 2013). DLPFC

NU

has been strongly suggested as one of the brain regions that undergoes an age-sensitive

MA

decline leading to the deterioration of cognitive functioning (Reuter-Lorenz & Lustig, 2005; Salat et al., 2004). Thus, we believe the earlier cell senescence could explain, at least in part, the adverse effects of the drug addiction on long-term health outcomes.

TE

D

A possible mechanism that contribute to shortening TL involves the drug-induced oxidative stress and enhance of proinflammatory mediators in response to antioxidants

CE P

reduction (Araos et al., 2015; Kovacic, 2005; Levandowski et al., 2014; Zaparte et al., 2015; Zhou et al., 2000). These mediators are known to damage telomeric DNA and accelerate the

AC

rate of telomere shortening per cell division (Houben, Moonen, van Schooten, & Hageman, 2008). Moreover, oxidative stress has been suggested to be associated with withdrawal symptoms in crack cocaine dependents (Zaparte et al., 2015). In addition to prior reports that revealed shortened TL in substance abuse, a study from Tyrka and colleagues (Tyrka et al., 2016) suggested that early adverse experiences could also accelerate cellular aging among clinical populations. In order to advance the understanding of cellular mechanisms underlying ELS programming in crack cocaine users, we divided our crack cocaine sample according to ELS experiences. We found that TL among the CRACK-ELS group was shorter in comparison to CRACK and ELD groups. Moreover, previous reports shown that subtypes of maltreatment are also associated with shortened TL

ACCEPTED MANUSCRIPT (Tyrka et al., 2016; Tyrka et al., 2010). In this study, we found that abuse-only forms and abuse combined with neglect has shortened telomeres, however we failed to find data

T

regarding neglect-only forms. Although, this result could be a Type-II error given a small

IP

sample size in the subgroup of neglect-only.

SC R

These findings are in accordance with several studies that show shortened telomeres in adults who suffered childhood maltreatment (Price et al., 2013; S. J. Ridout et al., 2015). Moreover, chronic diseases are more common in adults with an ELS history (Nusslock &

NU

Miller, 2015; Tyrka et al., 2015). These diseases may be developed across the lifespan

MA

through complex interactions between gene and environment (Nusslock & Miller, 2015; Tyrka et al., 2015). However, there is evidence that age-related diseases in adults have their origins in early life experience during sensitive neurobiological periods (Kuh & New

TE

D

Dynamics of Ageing Preparatory, 2007; Sander et al., 2008). Indeed, there is a large body of research overlap between neurobiological characteristics of ELS and aging, such as

CE P

hippocampal volume decline (Staff et al., 2012), low grade of inflammation (Nusslock & Miller, 2015) and shortened TL (S. J. Ridout et al., 2015). This could explain a wide range of

AC

chronic diseases of aging in adults with a history of ELS. This study has strengths that should be highlighted. First, the majority of studies examining ELS effects in TL and other biological mediators are from North American or European upper income countries (Zahran et al., 2015). It could limit the generalization to distinct socioeconomic countries (Henrich, Heine, & Norenzayan, 2010). Brazil, for example, presented a representative portion of the population living below the poverty line in 2014, with higher estimates of childhood maltreatment in comparison to other countries (Viola et al., 2016). In addition, there is a critical public health issue regarding crack cocaine addiction (Dias et al., 2011). Thus, our study contributes to the cross-cultural evidence regarding premature aging in a sample composed by women at high risk of childhood trauma. Second,

ACCEPTED MANUSCRIPT we compared TL and ELS between two groups of women with the same diagnosis, but with distinct early life experiences. This contributes for evidences of heterogeneity in clinical

T

presentation in crack cocaine dependence. Finally, we also compared our groups of crack

IP

cocaine dependents with a group with elderly women. This allows us, for the first time, to

SC R

show that women with drug addiction and ELS have greater cellular senescence than women with no mental illness or ELS who are more than twice their age.

Our results should be understood in the context of some limitations. T/S ratio was

NU

based on average TL and cannot reflect the direct measure of telomeric region. However, this

MA

widely used method provides results that are highly correlated with the gold-standard southern blot and other methods (Aubert, Hills, & Lansdorp, 2012), and has the advantage that it can be performed at higher throughput and low cost (Shalev, 2012). Our study also did

TE

D

not measure telomerase activity, which could have an impact on the current findings. It is known that telomerase influences the rate of change in TL of peripheral blood mononuclear

CE P

cells (Lin et al., 2015).Additionally, the cross-sectional design does not allow assessment of within-individual changes in TL over the lifespan. This approach is only able to estimate how

AC

the cellular aging processes may proceed based on measurement of individuals with a range of ages and exposures. However, given that our design included a reference group of elderlies, our results provide substantial support for an advanced cellular aging process. Finally, the ELS measurement by CTQ is limited because it is a self-report questionnaire of early life events. It has been demonstrated that of early life events questionnaires are dependent on an integrate functioning of autobiographic memory (Mowlds et al., 2010). Indeed, we cannot exclude the possibility of an under- or over-estimation of early life self-report events. However, there are indications suggesting a significant effect of perceived stress in TL (Mathur et al., 2016). According to these findings is not the intensity or chronicity of stressor per se, but rather an influence of individual’s perception that could affects TL. Finally, we

ACCEPTED MANUSCRIPT investigated only a sample of crack cocaine dependent women. Thus, this data could not be generalized for crack cocaine males considering that male and female have distinct biological

T

and behavioral outcomes in response to cocaine addiction (Quinones-Jenab, 2006) and that

IP

women are more susceptible to complications due crack cocaine use (Bastos & Bertoni,

SC R

2014). 5. Conclusions

In summary, the current study provides a new evidence of shorter TL in crack cocaine

NU

dependent-women in comparison with elderly women. Moreover, this study demonstrates that

MA

ELS has an effect on telomere when we divided our sample. TL has been previously suggested as a marker of cellular aging, especially in psychiatry populations, and linked to adverse life experiences effects over development (Tyrka et al., 2016). Together, this

TE

D

evidence supports a recent hypothesis that subjects with psychiatric disorders who report a history of ELS present a distinct clinical and neurobiological profile, called an ecophenotype

CE P

(Teicher & Samson, 2013).

This ecophenotype could in part explain why treatment of crack cocaine addiction is

AC

challenging, given the high prevalence of early trauma exposure in this population. Our findings highlight the complex interaction of cellular, molecular and biological events increasing vulnerability to mental disorders due ELS. Future longitudinal studies coupled with cellular and molecular approaches and age-matched healthy controls with and without ELS could bring us a step closer to getting a clear picture on the role of TL in response to ELS across the lifespan. Author disclosures This study was supported by MCT/CT-Saúde (DECIT/SCTIE/MS), ‘Conselho Nacional de Desenvolvimento Científico e Tecnológico’ (CNPq) (Grant number 402723/2010-4) and ‘Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul’

ACCEPTED MANUSCRIPT (FAPERGS) (Grant number 11/1302-7). The funding source had no involvement in study design, in the collection, analysis and interpretation of data, in the writing of the report, and in

T

the decision to submit the paper for publication.

IP

Contributors

SC R

MLL, RGO and SGT designed the study. MLL, RGO, SGT and TCN collected the sample. DLR, CHDB, LAA, LBR and PKM extracted DNA from blood and measured telomere length. MLL and SGT drafted the first version of the manuscript. All contributors

NU

have made a substantial intellectual contribution to the work. All authors have participated in

MA

manuscript writing by reviewing drafts and approving this final version. Conflict of interest

No conflicts of interest declared concerning the publication of this article.

TE

D

Acknowledgements

We are thankful to the Developmental Cognitive Neuroscience Lab (DCNL) research

CE P

team and to the staff of the ‘Hospital Espírita de Porto Alegre (HEPA)’ and ‘Hospital Mãe de

AC

Deus’ for all their support regarding data collection.

Figure Captions

Figure 1. Comparison of telomere length of ELD, CRACK and CRACK-ELS groups. Horizontal lines indicate mean values. Mean and SD values: ELD (1.50; SD 0.42), CRACK (1.33; SD 0.16), CRACK-ELS (1.19; SD 0.21). **, p < 0.001.* p < 0.05.

Figure 2. (A) ELS history distribution of crack cocaine participants and (B) Comparison of telomere length among subtypes of early life stress in crack cocaine participants. No ELS (n=34; 26.77%), Abuse (n=30; 23.62%), Neglect (n=10; 7.87%) and Abuse + Neglect (n=53; 41.73%). Mean and SD: No ELS (1.33; SD 0.16), Abuse (1.18; SD 0.19), Neglect (1.19; SD 0.23) and Abuse + Neglect (1.19; SD 0.15). *, p < 0.05 in comparison to No ELS group.

References

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

Araos, P., Pedraz, M., Serrano, A., Lucena, M., Barrios, V., Garcia-Marchena, N., . . . Rodriguez de Fonseca, F. (2015). Plasma profile of pro-inflammatory cytokines and chemokines in cocaine users under outpatient treatment: influence of cocaine symptom severity and psychiatric comorbidity. Addict Biol, 20(4), 756-772. doi: 10.1111/adb.12156 Aubert, G., Hills, M., & Lansdorp, P. M. (2012). Telomere length measurement-caveats and a critical assessment of the available technologies and tools. Mutat Res, 730(1-2), 59-67. doi: 10.1016/j.mrfmmm.2011.04.003 Barrio, G., Molist, G., de la Fuente, L., Fernandez, F., Guitart, A., Bravo, M. J., . . . Itinere Working, Group. (2013). Mortality in a cohort of young primary cocaine users: controlling the effect of the riskiest drug-use behaviors. Addict Behav, 38(3), 1601-1604. doi: 10.1016/j.addbeh.2012.10.007 Bastos, Francisco Inácio, & Bertoni, Neilane. (2014). Pesquisa Nacional sobre o uso de crack: quem são os usuários de crack e/ou similares no Brasil? quantos são nas capitais brasileiras? Rio de Janeiro: ICICT/FIOCRUZ. Beach, S. R., Lei, M. K., Brody, G. H., Yu, T., & Philibert, R. A. (2014). Nonsupportive parenting affects telomere length in young adulthood among African Americans: mediation through substance use. J Fam Psychol, 28(6), 967-972. doi: 10.1037/fam0000039 Bernstein, David P, & Fink, Laura. (1998). Childhood trauma questionnaire: A retrospective self-report: Manual: Psychological Corporation. Bertoni, N., Burnett, C., Cruz, M. S., Andrade, T., Bastos, F. I., Leal, E., & Fischer, B. (2014). Exploring sex differences in drug use, health and service use characteristics among young urban crack users in Brazil. Int J Equity Health, 13(1), 70. doi: 10.1186/s12939-014-0070-x Blackburn, E. H. (2005). Telomeres and telomerase: their mechanisms of action and the effects of altering their functions. FEBS Lett, 579(4), 859-862. doi: 10.1016/j.febslet.2004.11.036 Cawthon, R. M. (2009). Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res, 37(3), e21. doi: 10.1093/nar/gkn1027 Cheng, G. L., Zeng, H., Leung, M. K., Zhang, H. J., Lau, B. W., Liu, Y. P., . . . Lee, T. M. (2013). Heroin abuse accelerates biological aging: a novel insight from telomerase and brain imaging interaction. Transl Psychiatry, 3, e260. doi: 10.1038/tp.2013.36 Degenhardt, L., Singleton, J., Calabria, B., McLaren, J., Kerr, T., Mehta, S., . . . Hall, W. D. (2011). Mortality among cocaine users: a systematic review of cohort studies. Drug Alcohol Depend, 113(2-3), 88-95. doi: 10.1016/j.drugalcdep.2010.07.026 Degenhardt, L., Whiteford, H., & Hall, W. D. (2014). The Global Burden of Disease projects: what have we learned about illicit drug use and dependence and their contribution to the global burden of disease? Drug Alcohol Rev, 33(1), 4-12. doi: 10.1111/dar.12088 Dias, A. C., Araujo, M. R., Dunn, J., Sesso, R. C., de Castro, V., & Laranjeira, R. (2011). Mortality rate among crack/cocaine-dependent patients: a 12-year prospective cohort study conducted in Brazil. J Subst Abuse Treat, 41(3), 273-278. doi: 10.1016/j.jsat.2011.03.008 Ersche, K. D., Jones, P. S., Williams, G. B., Robbins, T. W., & Bullmore, E. T. (2013). Cocaine dependence: a fast-track for brain ageing? Mol Psychiatry, 18(2), 134-135. doi: 10.1038/mp.2012.31 Fox, H. C., D'Sa, C., Kimmerling, A., Siedlarz, K. M., Tuit, K. L., Stowe, R., & Sinha, R. (2012). Immune system inflammation in cocaine dependent individuals: implications for medications development. Hum Psychopharmacol, 27(2), 156-166. doi: 10.1002/hup.1251 Francke, I. D., Viola, T. W., Tractenberg, S. G., & Grassi-Oliveira, R. (2013). Childhood neglect and increased withdrawal and depressive severity in crack cocaine users during early abstinence. Child Abuse Negl, 37(10), 883-889. doi: 10.1016/j.chiabu.2013.04.008 Gorenstein, C., & Andrade, L. (1996). Validation of a Portuguese version of the Beck Depression Inventory and the State-Trait Anxiety Inventory in Brazilian subjects. Braz J Med Biol Res, 29(4), 453-457. Grassi-Oliveira, R., Cogo-Moreira, H., Salum, G. A., Brietzke, E., Viola, T. W., Manfro, G. G., . . . Arteche, A. X. (2014). Childhood Trauma Questionnaire (CTQ) in Brazilian samples of different

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

age groups: findings from confirmatory factor analysis. PLoS One, 9(1), e87118. doi: 10.1371/journal.pone.0087118 Harley, C. B., Futcher, A. B., & Greider, C. W. (1990). Telomeres shorten during ageing of human fibroblasts. Nature, 345(6274), 458-460. doi: 10.1038/345458a0 Henrich, J., Heine, S. J., & Norenzayan, A. (2010). Most people are not WEIRD. Nature, 466(7302), 29. doi: 10.1038/466029a Herrero, M. J., Domingo-Salvany, A., Torrens, M., Brugal, M. T., & Investigators, Itinere. (2008). Psychiatric comorbidity in young cocaine users: induced versus independent disorders. Addiction, 103(2), 284-293. doi: 10.1111/j.1360-0443.2007.02076.x Hohensinner, P. J., Goronzy, J. J., & Weyand, C. M. (2011). Telomere dysfunction, autoimmunity and aging. Aging Dis, 2(6), 524-537. Houben, J. M., Moonen, H. J., van Schooten, F. J., & Hageman, G. J. (2008). Telomere length assessment: biomarker of chronic oxidative stress? Free Radic Biol Med, 44(3), 235-246. doi: 10.1016/j.freeradbiomed.2007.10.001 Kampman, K. M., Volpicelli, J. R., McGinnis, D. E., Alterman, A. I., Weinrieb, R. M., D'Angelo, L., & Epperson, L. E. (1998). Reliability and validity of the Cocaine Selective Severity Assessment. Addict Behav, 23(4), 449-461. Kao, H. T., Cawthon, R. M., Delisi, L. E., Bertisch, H. C., Ji, F., Gordon, D., . . . Porton, B. (2008). Rapid telomere erosion in schizophrenia. Mol Psychiatry, 13(2), 118-119. doi: 10.1038/sj.mp.4002105 Kawanishi, S., & Oikawa, S. (2004). Mechanism of telomere shortening by oxidative stress. Ann N Y Acad Sci, 1019, 278-284. doi: 10.1196/annals.1297.047 Kessler, F., Cacciola, J., Alterman, A., Faller, S., Souza-Formigoni, M. L., Cruz, M. S., . . . Pechansky, F. (2012). Psychometric properties of the sixth version of the Addiction Severity Index (ASI-6) in Brazil. Rev Bras Psiquiatr, 34(1), 24-33. Kluwe-Schiavon, Bruno, Tractenberg, Saulo Gantes, Sanvicente-Vieira, Breno, Rosa, Caroline Silva de Oliveira, Arteche, Adriane Xavier, Pezzi, Júlio Carlos, & Grassi-Oliveira, Rodrigo. (2015). Psychometric properties of Cocaine Selective Severity Assessment (CSSA) in crack users. Jornal Brasileiro de Psiquiatria, 64(2), 115-121. Kovacic, P. (2005). Role of oxidative metabolites of cocaine in toxicity and addiction: oxidative stress and electron transfer. Med Hypotheses, 64(2), 350-356. doi: 10.1016/j.mehy.2004.06.028 Kuh, D., & New Dynamics of Ageing Preparatory, Network. (2007). A life course approach to healthy aging, frailty, and capability. J Gerontol A Biol Sci Med Sci, 62(7), 717-721. Levandowski, M. L., Viola, T. W., Tractenberg, S. G., Teixeira, A. L., Brietzke, E., Bauer, M. E., & GrassiOliveira, R. (2013). Adipokines during early abstinence of crack cocaine in dependent women reporting childhood maltreatment. Psychiatry Res, 210(2), 536-540. doi: 10.1016/j.psychres.2013.07.007 Levandowski, M. L., Viola, T. W., Wearick-Silva, L. E., Wieck, A., Tractenberg, S. G., Brietzke, E., . . . Grassi-Oliveira, R. (2014). Early life stress and tumor necrosis factor superfamily in crack cocaine withdrawal. J Psychiatr Res, 53, 180-186. doi: 10.1016/j.jpsychires.2014.02.017 Lin, Y., Damjanovic, A., Metter, E. J., Nguyen, H., Truong, T., Najarro, K., . . . Weng, N. P. (2015). Ageassociated telomere attrition of lymphocytes in vivo is co-ordinated with changes in telomerase activity, composition of lymphocyte subsets and health conditions. Clin Sci (Lond), 128(6), 367-377. doi: 10.1042/CS20140481 Lindqvist, D., Epel, E. S., Mellon, S. H., Penninx, B. W., Revesz, D., Verhoeven, J. E., . . . Wolkowitz, O. M. (2015). Psychiatric disorders and leukocyte telomere length: Underlying mechanisms linking mental illness with cellular aging. Neurosci Biobehav Rev, 55, 333-364. doi: 10.1016/j.neubiorev.2015.05.007 Mathur, M. B., Epel, E., Kind, S., Desai, M., Parks, C. G., Sandler, D. P., & Khazeni, N. (2016). Perceived stress and telomere length: A systematic review, meta-analysis, and methodologic considerations for advancing the field. Brain Behav Immun, 54, 158-169. doi: 10.1016/j.bbi.2016.02.002

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

Mowlds, W., Shannon, C., McCusker, C. G., Meenagh, C., Robinson, D., Wilson, A., & Mulholland, C. (2010). Autobiographical memory specificity, depression, and trauma in bipolar disorder. Br J Clin Psychol, 49(Pt 2), 217-233. doi: 10.1348/014466509X454868 Nusslock, R., & Miller, G. E. (2015). Early-Life Adversity and Physical and Emotional Health Across the Lifespan: A Neuroimmune Network Hypothesis. Biol Psychiatry. doi: 10.1016/j.biopsych.2015.05.017 Panossian, L. A., Porter, V. R., Valenzuela, H. F., Zhu, X., Reback, E., Masterman, D., . . . Effros, R. B. (2003). Telomere shortening in T cells correlates with Alzheimer's disease status. Neurobiol Aging, 24(1), 77-84. Pavanello, S., Hoxha, M., Dioni, L., Bertazzi, P. A., Snenghi, R., Nalesso, A., . . . Baccarelli, A. (2011). Shortened telomeres in individuals with abuse in alcohol consumption. Int J Cancer, 129(4), 983-992. doi: 10.1002/ijc.25999 Price, L. H., Kao, H. T., Burgers, D. E., Carpenter, L. L., & Tyrka, A. R. (2013). Telomeres and early-life stress: an overview. Biol Psychiatry, 73(1), 15-23. doi: 10.1016/j.biopsych.2012.06.025 Quinones-Jenab, V. (2006). Why are women from Venus and men from Mars when they abuse cocaine? Brain Res, 1126(1), 200-203. doi: 10.1016/j.brainres.2006.08.109 Reece, A. S. (2007). Evidence of accelerated ageing in clinical drug addiction from immune, hepatic and metabolic biomarkers. Immun Ageing, 4, 6. doi: 10.1186/1742-4933-4-6 Reuter-Lorenz, P. A., & Lustig, C. (2005). Brain aging: reorganizing discoveries about the aging mind. Curr Opin Neurobiol, 15(2), 245-251. doi: 10.1016/j.conb.2005.03.016 Ridout, K. K., Ridout, S. J., Price, L. H., Sen, S., & Tyrka, A. R. (2016). Depression and telomere length: A meta-analysis. J Affect Disord, 191, 237-247. doi: 10.1016/j.jad.2015.11.052 Ridout, S. J., Ridout, K. K., Kao, H. T., Carpenter, L. L., Philip, N. S., Tyrka, A. R., & Price, L. H. (2015). Telomeres, early-life stress and mental illness. Adv Psychosom Med, 34, 92-108. doi: 10.1159/000369088 Salat, D. H., Buckner, R. L., Snyder, A. Z., Greve, D. N., Desikan, R. S., Busa, E., . . . Fischl, B. (2004). Thinning of the cerebral cortex in aging. Cereb Cortex, 14(7), 721-730. doi: 10.1093/cercor/bhh032 Sander, M., Avlund, K., Lauritzen, M., Gottlieb, T., Halliwell, B., Stevnsner, T., . . . Bohr, V. A. (2008). Aging-from molecules to populations. Mech Ageing Dev, 129(10), 614-623. doi: 10.1016/j.mad.2008.08.002 Sanvicente-Vieira, B., Kommers-Molina, J., De Nardi, T., Francke, I., & Grassi-Oliveira, R. (2016). Crack-cocaine dependence and aging: effects on working memory. Rev Bras Psiquiatr., 38(1), in press. doi: 10.1590/1516-4446-2015-1708 Schmidt, M. I., Duncan, B. B., Azevedo e Silva, G., Menezes, A. M., Monteiro, C. A., Barreto, S. M., . . . Menezes, P. R. (2011). Chronic non-communicable diseases in Brazil: burden and current challenges. Lancet, 377(9781), 1949-1961. doi: 10.1016/S0140-6736(11)60135-9 Shalev, I. (2012). Early life stress and telomere length: investigating the connection and possible mechanisms: a critical survey of the evidence base, research methodology and basic biology. Bioessays, 34(11), 943-952. doi: 10.1002/bies.201200084 Staff, R. T., Murray, A. D., Ahearn, T. S., Mustafa, N., Fox, H. C., & Whalley, L. J. (2012). Childhood socioeconomic status and adult brain size: childhood socioeconomic status influences adult hippocampal size. Ann Neurol, 71(5), 653-660. doi: 10.1002/ana.22631 Teicher, M. H., & Samson, J. A. (2013). Childhood maltreatment and psychopathology: A case for ecophenotypic variants as clinically and neurobiologically distinct subtypes. Am J Psychiatry, 170(10), 1114-1133. doi: 10.1176/appi.ajp.2013.12070957 Tyrka, A. R., Parade, S. H., Price, L. H., Kao, H. T., Porton, B., Philip, N. S., . . . Carpenter, L. L. (2016). Alterations of Mitochondrial DNA Copy Number and Telomere Length With Early Adversity and Psychopathology. Biol Psychiatry, 79(2), 78-86. doi: 10.1016/j.biopsych.2014.12.025 Tyrka, A. R., Price, L. H., Kao, H. T., Porton, B., Marsella, S. A., & Carpenter, L. L. (2010). Childhood maltreatment and telomere shortening: preliminary support for an effect of early stress on cellular aging. Biol Psychiatry, 67(6), 531-534. doi: 10.1016/j.biopsych.2009.08.014

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

Tyrka, A. R., Ridout, K. K., Parade, S. H., Paquette, A., Marsit, C. J., & Seifer, R. (2015). Childhood maltreatment and methylation of FK506 binding protein 5 gene (FKBP5). Dev Psychopathol, 27(4 Pt 2), 1637-1645. doi: 10.1017/S0954579415000991 Verdejo-Garcia, A., Perez-Garcia, M., Sanchez-Barrera, M., Rodriguez-Fernandez, A., & Gomez-Rio, M. (2007). [Neuroimaging and drug addiction: neuroanatomical correlates of cocaine, opiates, cannabis and ecstasy abuse]. Rev Neurol, 44(7), 432-439. Viola, T. W., Salum, G. A., Kluwe-Schiavon, B., Sanvicente-Vieira, B., Levandowski, M. L., & GrassiOliveira, R. (2016). The influence of geographical and economic factors in estimates of childhood abuse and neglect using the Childhood Trauma Questionnaire: A worldwide metaregression analysis. Child Abuse Negl, 51, 1-11. doi: 10.1016/j.chiabu.2015.11.019 Viola, T. W., Tractenberg, S. G., Kluwe-Schiavon, B., Levandowski, M. L., Sanvicente-Vieira, B., Wearick-Silva, L. E., . . . Grassi-Oliveira, R. (2015). Brain-Derived Neurotrophic Factor and Delayed Verbal Recall in Crack/Cocaine Dependents. Eur Addict Res, 21(5), 273-278. doi: 10.1159/000430436 Viola, T. W., Tractenberg, S. G., Levandowski, M. L., Pezzi, J. C., Bauer, M. E., Teixeira, A. L., & GrassiOliveira, R. (2014). Neurotrophic factors in women with crack cocaine dependence during early abstinence: the role of early life stress. J Psychiatry Neurosci, 39(3), 206-214. Yang, Z., Huang, X., Jiang, H., Zhang, Y., Liu, H., Qin, C., . . . Ju, Z. (2009). Short telomeres and prognosis of hypertension in a chinese population. Hypertension, 53(4), 639-645. doi: 10.1161/HYPERTENSIONAHA.108.123752 Yang, Z., Ye, J., Li, C., Zhou, D., Shen, Q., Wu, J., . . . Liu, Y. (2013). Drug addiction is associated with leukocyte telomere length. Sci Rep, 3, 1542. doi: 10.1038/srep01542 Zahran, S., Snodgrass, J. G., Maranon, D. G., Upadhyay, C., Granger, D. A., & Bailey, S. M. (2015). Stress and telomere shortening among central Indian conservation refugees. Proc Natl Acad Sci U S A, 112(9), E928-936. doi: 10.1073/pnas.1411902112 Zaparte, A., Viola, T. W., Grassi-Oliveira, R., da Silva Morrone, M., Moreira, J. C., & Bauer, M. E. (2015). Early abstinence of crack-cocaine is effective to attenuate oxidative stress and to improve antioxidant defences. Psychopharmacology (Berl), 232(8), 1405-1413. doi: 10.1007/s00213-014-3779-8 Zhou, J. F., Yan, X. F., Ruan, Z. R., Peng, F. Y., Cai, D., Yuan, H., . . . Xu, S. S. (2000). Heroin abuse and nitric oxide, oxidation, peroxidation, lipoperoxidation. Biomed Environ Sci, 13(2), 131-139.

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

Figure 1

AC

Figure 2

CE P

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

Figure 3

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

Table 1. Demographic and Clinical Characteristics of Crack Cocaine (n=127) and Elderly (n=49) Groups. CRACK-ELS CRACK ELD Statistics p value Pairwise (n=93) (n=34) (n=49) comparison Demographics Age 29.5 (7.7)a 26.2 (6.3)b 68.3 (7.4)c F2,173=490.67 < .001 a.b < c a b BMI 24.9 (4.3) 21.5 (5.6) 26.2 (4.4) c F2,173=10.997 < .001 b < a,c a b c Educational Level 7.5 (2.9) 8.0 (3.1) 10.9 (4.3) F2,170=15.795 < .001 a,b < c Depression assessment BDI 21.4 (7.1) 14.9 (9.6) t(121)= -2.252 .040 GDS 3.4 (2.8) Crack Cocaine assessment Age of first use of crack 21.2 (9.7) 20.6 (9.5) t(104)= -.298 .766 Withdraw prior 2.68 (4.7) 2.41 (3.7) t(109)= -.310 .779 treatment admission CSSA 47.0 (14.9) 46.5 (16.2) t(110)= .038 .631 ASI Drugs 64.6 (11.0) 63.0 (10.1) t(104)= .638 .525 CTQ Total Score 59.5 (19.0) a 33.2 (6.1) b 19. 7 (6.0) c F2,173=130.16 < .001 a< b < c Note: Values are showed as mean ± SD. CRACK-ELS, Crack Cocaine Dependents with history of Early Life Stress; CRACK, Crack Cocaine Dependents without history of Early Life Stress; ELD, Elderly Group; ASI-6, Addiction Severity Index; BDI, Beck Depression Inventory; BMI, Body Mass Index; CSSA, Cocaine Selective Severity Assessment; CTQ, Childhood Trauma Questionnaire; F, ANOVA; t, unpaired t test. 1 Pairwise comparison showing P < 0.01 where a= CRACK-ELS; b= CRACK; c= ELD.

ACCEPTED MANUSCRIPT Highlights -

Despite their younger age, crack cocaine dependents have shortened TL in comparison to the

cocaine users with

had shorter TL than the crack cocaine without such

IP

-

T

elderly individuals.

CE P

TE

D

MA

NU

TL was negatively correlated with early life stress and craving symptoms severity.

AC

-

SC R

history.