- Email: [email protected]
Cross talk of two Krupple transcription factors regulates expression of the ovine FSH receptor gene
BBRC Biochemical and Biophysical Research Communications 295 (2002) 1096–1101 www.academicpress.com
Cross talk of two Krupple transcription factors regulates expression of the ovine FSH receptor geneq Weirong Xing and M. Ram Sairam* Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, 110 Pine Avenue West Montreal, Que., Canada H2W 1R7 Received 24 June 2002
Abstract The follicle-stimulating hormone receptor (FSHR) in gonadal cells is required for normal folliculogenesis and spermatogenesis. To understand its regulation, we identified a CACC-box from )46 to )67 of the ovine FSHR promoter. Antibody supershift with a 22-bp DNA probe and nuclear extract from a Sertoli cell line demonstrated that a testis-specific zinc finger protein, ZNF202, might be one of the binding proteins. Western blots using ZNF202 antibody and Southwestern blot analyses with the DNA probe detected the same 60 kDa protein in both Sertoli and ovarian granulosa cell lines. Gel shift assays also revealed that the DNA–protein complex from Sertoli cells overexpressing the human Ras-responsive element binding protein-1 (RREB-1) migrated the same way as the complex containing endogenous CACC-box binding protein. Transfection studies indicated that ZNF202 repressed ovine FSHR promoter activity whereas RREB-1 was likely to function as an activator. These data suggest that selective expression and cross talk of functionally distinctive Krupple transcription factors could regulate tissue- and stage-specific expression of FSHR gene. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: FSH receptor promoter; Transcription; Krupple-like factor; Sertoli cells; Granulosa cells; CACC-box; DNase I footprinting; Luciferase assay
Follicle-stimulating hormone (FSH) and its specific receptor(s) are required for normal gametogenesis and biosyntheses of steroid hormones in both males and females [1]. Upon hormone binding, the activated membrane bound FSH receptors (FSHR) are believed to couple with Gs proteins as well as other transducing units activating multiple signaling mechanisms to initiate a cascade of intracellular events, leading to specific biological effects of the gonadotropin [2]. Recent studies in either the FSHb subunit or FSHR knockout mice have highlighted the importance of FSH signaling in maintaining normal spermatogenesis in the male and folliculogenesis in females [3,4]. In addition, other indiq Abbreviations: FSH, follicle-stimulating hormone; FSHR, FSH receptor; EMSA, electrophoretic mobility shift assay; bp, base pair; kb, kilobase pair; kDa, kiloDalton; SDS–PAGE, SDS–polyacrylamide gel electrophoresis; Sp-1, SV40 protein-1; EGR-1, early growth response gene 1; RREB-1: ras-responsive element binding protein-1; ZNF202: zinc finger protein 202; ORRE: orphan receptor response element. * Corresponding author. Fax: +514-987-5585. E-mail address: [email protected] (M.R. Sairam).
rect effects in controlling lipid metabolism, bone remodeling, and tumorigenesis also result from the imbalance of steroid hormones [5]. The selective expression of FSHR in target ovarian granulosa cells and testicular Sertoli cells appears to be stage-dependent, coinciding with different maturation statuses of the follicles or germ cells [6,7]. Such variable expression patterns are apparently regulated by many paracrine/autocrine factors and gonadotropic hormones by either affecting mRNA stability, receptor alternative splicing or modulating the regulatory elements within the promoter region [8–10]. The promoters of FSHR gene have been cloned from a number of species including human, rat, mouse, and ovine [11–14]. A major distinguishing feature of the 50 -flanking regions of FSHR promoters from human, rat and ovine is the lack of typical TATA or CCAAT boxes [11–13], although a TATA-like sequence is present near the major transcription initiation site of the mouse FSHR promoter [14]. An initiator-like sequence, encompassing a transcriptional start site, seems to be conserved at least in mouse and rat [15,16]. The strongest promoters of the
0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 0 8 1 2 - 4
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
four species can be localized within 370 bp of the promoter regions relative to the translation start sites [11,12,14,17]. A search for the regulatory elements in the core promoter regions reveals that a consensus E-box and steroidogenic factor-1 (SF-1) binding sites are well conserved among the species and seem to play an important role in the regulation of FSHR expression [15–17]. More recent studies have demonstrated that multiple site-specific cytosine methylation within the rat FSHR promoter might be involved in the tissue-specific repression of FSHR gene [18]. Thus, demethylation of these sites could re-activate receptor transcription as necessary [19]. These studies suggest that full activation of promoters containing recognition sequences for many different transcription factors requires simultaneous binding of a variety of transcription factors that might act synergistically or antagonistically. Therefore, a first step in understanding these mechanisms is to identify the DNA binding proteins and their functions in the expression of FSHR gene. Previous studies on ovine FSHR promoter have characterized several composite cis-elements including an E-box, a CACC-box, an AP-1 binding site embedding an atypical E-box and an orphan receptor response element (ORRE), and a complex nuclear receptor response element [17,20–22]. In the present paper, we report the functional studies of CACC-box binding proteins belonging to a family of Krupple transcription factors. We found that selective expression and cross talk between functionally distinctive Krupple transcription factors might participate in tissue- and stagespecific expression of FSHR gene.
1097
electroporation cuvette with 960 lF at 220 V, using a Gene Pulser (BioRad, Hercules, CA). The cells were incubated at 37 °C for 10 min and then cultured in 60 mm petri dishes. After 48 h, cells were lysed in a lysis buffer containing 100 mM Tris–HCl, 0.5% NP-40, 1 mM DTT. Appropriate aliquots of cell extract were used for both luciferase and b-galactosidase assays [17]. Electrophoretic mobility shift assay and antibody shift assay. Double-stranded oligonucleotides (TCCCACCCCACCCCCACCAAAG) were synthesized by BioCorp (Montreal, Canada). Nuclear extract preparation and the electrophoretic mobility shift assays (EMSAs) were performed as described [17]. Briefly, double-stranded oligonucleotides were labeled at the 50 ends using T4 polynucleotide kinase and [c-32 P]ATP. Nuclear extract ð10 lgÞ from either 15P1 or JC-410 cells was incubated in a binding buffer, containing 50 lg=ml poly(dI-dC), and 20 fmol of labeled DNA probe at room temperature for 20 min. The reaction mixture was analyzed using a 5% non-denaturing polyacrylamide gel in 1 TBE buffer (50 mM Tris–borate–EDTA, pH 8.0). For the antibody supershift assay, 1 lg antibody against ZNF202 or pre-immune control IgG (Santa Cruz Biotechnology, CA) was added into the reaction mixture and incubated at room temperature for an additional 15 min. Gels were dried and visualized by autoradiography. Western and Southwestern blot analyses. An aliquot ð120 lgÞ of nuclear extracts from 15P1 and JC-410 cells was separated on a 7.5% of SDS–PAGE denaturing gel. Proteins were then transferred to a nitrocellulose and the membrane was incubated at 4 °C overnight in a buffer containing 5% dry skim milk, 150 mM NaCl, 50 mM Tris–HCl
Materials and methods Plasmids, cell lines, and antibodies. Promoterless plasmid pGL3basic (Promega, Madison, WI) and ovine FSHR promoter/luciferase constructs were described previously [17]. A pCDNA3.1-ZNF202 plasmid was a gift from Dr. B. Bowen (Novartis Pharmaceutical, East Hanover, NJ). The pMV7p1-371 of the RREB-1 expression vector was from Dr. B.D. Nelkin (Johns Hopkins School of Medicine, Baltimore, MD). A mouse Sertoli cell line (15P1) was provided by Dr. Francßois Cuzin (University of Nice, Nice Cedex 2, France) [23]. A stable and spontaneously immortalized porcine ovarian granulosa cell line (JC410) was a gift from Dr. Jorge P Chedrese (University of Saskatchewan, Saskatoon, Canada) [24]. Antibodies against GST fusion proteins SCAN (1–199), KRAB (177–329), and zinc finger (387–543) domains of the zinc finger protein 202 (ZNF202) were also provided by Dr. B. Bowen. Cell culture and transient transfections. The cells were routinely maintained in a humidified 37 °C (JC-410 cells) or 32 °C (15P1 cells) incubator with 5% CO2 and cultured in F-12/DMEM (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum, 2 mM L -glutamine, 100 U/ml penicillin, and 100 lg=ml streptomycin. Transient transfections were carried out using electroporation as described previously [25]. The cells were transfected with 5 lg luciferase reporter and 0:5 lg pCMVlacZ with or without 5 lg expression vector of the Krupple transcription factor. After 10 min of incubation at room temperature, the cells were electroporated in a 0.4-cm gap width
Fig. 1. In vitro DNase I footprinting with nuclear extract from JC-410 or 15P1 cells. Brackets indicate the regions of protection from DNase I digestion. A portion of the FSHR promoter sequence ()80 to )40) relative to the transcription start site is given at the bottom of the panel. The protected sequence against DNase I digestion in the presence of the nuclear extracts is indicated by bars facing the corresponding strand. Lanes 1–4: DNA sequence tracks; Lane 5: DNase I digestion without nuclear extract (-NE); Lanes 6 and 7: DNase I digestion with 20 lg of nuclear extracts (+NE).
1098
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
(pH 8.0), and 0.05% Tween 20. The immunoblotting was performed in the same buffer containing 0:4 lg=ml rabbit polyclonal antibody against ZNF202 SCAN domain at room temperature for 1 h. Specific proteins were detected using ECL+ Western blotting detection system (Amersham Pharmacia Biotech UK, England) as described previously [5]. After exposing to X-ray film, the membrane was stripped in a buffer containing 100 mM 2-mercaptoethanol, 2% SDS, and 62.5 mM Tris–HCl (pH 6.7) at 50 °C for 30 min. The same membrane was blocked at 4 °C overnight in a buffer containing 5% skim milk powder, 25 mM NaCl, 5 mM MgCl2 , 25 mM Hepes (pH 7.9), and 1 mM DTT for Southwestern blot analysis as described previously [17]. The binding reaction was performed in the same, but milk powder-free buffer with 106 cpm/ml 32 P-labeled double-stranded DNA probe, in the presence of 5 lg=ml salmon-sperm DNA, at room temperature for 18 h. Prior to autoradiography, blots were washed four times at room temperature using the same buffer.
DNase I footprinting. Non-coding strand or coding strand probes were prepared by labeling its 50 end with T4 polynucleotide kinase for performing DNase I footprinting reactions [17]. Binding reactions were incubated at room temperature for 15 min, followed by 5 min of DNase I digestion on ice. The footprint reactions were terminated by the addition of 80 ll stop buffer. The samples were incubated at 45 °C for 1 h, purified, and loaded on a 7% sequencing gel along with A, C, G, and T DNA sequence tracks, followed by autoradiography.
Results and discussion To map further cis-elements within the ovine FSH-R promoter, we performed a DNase I footprinting assay
Fig. 2. Krupple transcription factors, ZNF202 and RREB-1, bind to CACC repeats. (A) An antibody supershift assay. Lane 1: probe with nuclear extract from 15P1 cells; Lanes 2–4: probe with nuclear extract from 15P1 cells, the reaction containing polyclonal antibodies against SCAN, KRAB, and zinc finger domains of ZNF202, respectively; Lane 5: probe with nuclear extract from 15P1 cells, the reaction containing rabbit IgG. (B) Western (right panel) and Southwestern blot analyses (left panel). The same membrane was hybridized with an antibody against SCAN domain of ZNF202, then stripped, and probed with 32 P-labeled double-stranded oligonucleotides containing CACC repeats. Lanes 1 and 2: nuclear proteins from JC-410 and 15P cells, respectively. (C) The electrophoretic mobility shift assay. Lane 1: 32 P-labeled probe containing CACC repeats with nuclear extract ð10 lgÞ from JC-410 cells transfected with empty expression vector; Lane 2: 32 P-labeled probe containing CACC repeats with nuclear extract ð10 lgÞ from JC-410 transfected with human RREB-1 expression vector.
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
using the previously reported P363 plasmid as a template [17]. A region protected from DNase I digestion was mapped from )46 to )67 of the strongest promoter on both strands (Fig. 1). This 22 bp region of the promoter contained three CACC repeats to which a number of putative zinc finger proteins can bind [26]. They include SP-1 (SV-40 protein-1) sub-family, early growth response gene-1 (EGR-1), and Krupple-like transcription factors [26]. Previous studies have demonstrated that proteins bound to such double-stranded oligonucleotides are likely to be Krupple-like transcription factors rather than other sub-families [17]. Among them, a Ras-response element binding protein-1 (RREB-1) and a testis-specific zinc finger protein 202 (ZNF202) are potential candidates binding to CACC repeats of the ovine FSHR promoter [27,28]. To identify further the CACC repeat binding proteins, we performed an antibody supershift assay with antibodies against the ZNF202 protein (Fig. 2A). We incubated the DNA probe with nuclear extract from 15P1 cells in the presence of antibodies specific to SCAN, KRAB, and Zinc finger domains of the ZNF202 protein (Fig. 2A). All three antibodies specifically supershifted the DNA–protein complex whereas control pre-immune rabbit IgG did not (Fig. 2A). These observations suggest that ZNF202 may be one of the potential proteins participating in DNA binding. To characterize and compare further nuclear proteins that bind the CACC-boxes, we used the same antibody specific to the SCAN domain of ZNF202 and performed a Western blot (Fig. 2B, right panel). The same blot was then stripped and hybridized with a double-stranded DNA probe to see if the proteins recognized by the antibody
1099
also bind to the probe containing CAAC repeats (Fig. 2B, left panel). The double-stranded DNA probe was bound by proteins with an apparent mass of 87 and 60 kDa in nuclear extract from JC-410 cells, but there were 60 and 50 kDa components in nuclear extract from 15P1 cells (Fig. 2B, left panel). Interestingly, the protein with molecular weight of 60 kDa protein present in both JC-410 and 15P1 cells was also recognized by the antibody against ZNF202 (Fig. 2B, right panel). To test whether RREB-1 interacts with the CACC-box probe in a binding reaction, we turned to gel shift mobility assays with the nuclear extract from JC-410 cell that overexpressed human RREB-1 protein (Fig. 2C). The nuclear extract from the same cells that were only transfected with the empty vector was set up as a control (Fig. 2C, lane 1). In agreement with previous studies [20], we could demonstrate that protein binding to the CACC repeats migrates in the same way as the RREB-1/DNA complex (Fig. 2C). Moreover, the intensity of the retarded band was significantly enhanced as a result of the presence of human RREB-1 protein in the nuclear extract (Fig. 2C, compare lane 2 with lane 1). These observations indicate that Krupple-like factors RREB-1 and ZNF202 bind to the ovine FSHR promoter and regulate expression of FSHR gene. To understand the contribution of ZNF202 and RREB-1 proteins to promoter activity of the ovine FSHR, we made a mutation by replacing three residues C to A within the CACC repeats to abolish protein binding [20]. Our luciferase assays in transiently transfected JC-410 cells demonstrated that over-expression of ZNF202 reduced promoter activity by 40% whereas
Fig. 3. Krupple transcription factors regulate FSHR gene expression. A luciferase assay was carried out, using a reporter gene construct with either wild-type promoter or the promoter with a mutated CACC-box. JC-410 cells were co-transfected with a reporter gene fused to a 806 bp wild-type promoter (P806) [17] or a similar promoter containing a mutant CACC-box (P806 CACC-mt) with Krupple transcription factor expression vector, as indicated in the figure. Relative luciferase activity was normalized with b-galactosidase activity and expressed as fold induction over the activity of the pGL3-basic vector. The data shown are means SD. from three independent experiments. An asterisk indicates statistical significance (P < 0:05, compared to P806 CACC-wild-type reporter in absence of expression vector for Krupple transcription factor by Student’s t test).
1100
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
expression of human RREB-1 in JC-410 cells elevated luciferase expression by 80% (Fig. 3). However, a mutation of CACC repeats in the promoter region abolished the responses mediated by either RRE-1 or ZNF202 (Fig. 3). These data suggest that the ZNF202 protein may function as a repressor, while RREB-1 is an activator. The repeating CACC-box sequence is required for multiple Krupple transcription factor binding with a relative higher affinity [20] and is important in genespecific localization, cell cycle regulation, hormonal activation and developmental patterning but also in maintaining the methylation-free active status of the gene, leading to tissue-specific gene expression [29–31]. These two members of Krupple-like factors have been reported as having potential phosphorylation sites, resulting in bipartite functions [27,32]. They could participate in cross talk and compete for the same binding sites either in a positive or negative manner, depending on the growth signals and events of cell proliferation or differentiation at particular stages. In addition, differential recruitment of coactivator or corepressors may be involved [33]. The net regulation of FSHR gene may therefore be determined by the relative availability of transcription factors expressed in a given physiological state. Our findings establish that differential Krupple transcription factor interactions can distinguish their activities that are not discernible in the context of simple elements. Thus, positive or negative interaction of these complex factors may contribute to the differential expression of FSHR gene in gonadal (and non-gonadal tissues) in a stage-dependent manner.
Acknowledgments This investigation was supported by grants from the Canadian Institutes of Health Research (CIHR). We are grateful to Drs. P.J. Chedrese and F. Cuzin for providing the cell lines used in this study. We also thank Drs. B.D. Nelkin and Dr. B. Bowen for generously providing antisera and expression vectors tested in this study.
References [1] M. Simoni, J. Gromoll, E. Nieschlag, The follicle stimulating hormone receptor. Biochemistry, molecular biology, physiology and pathophysiology, Endocr. Rev. 18 (1997) 739–773. [2] J.S. Richards, New signaling pathways for hormones and cyclic adenosine 30 ; 50 -monophosphate action in endocrine cells, Mol. Endocrinol. 15 (2001) 209–218. [3] T.R. Kumar, Y. Wang, N. Lu, M.M. Matzuk, Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility, Nat. Genet. 15 (1997) 201–204. [4] A. Dierich, M.R. Sairam, L. Monaco, G.M. Fimia, A. Gansmuller, M. LeMeur, P. Sassone-Corsi, Impairing follicle-stimulating hormone (FSH) signaling in vivo. Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance, Proc. Natl. Acad. Sci. USA 95 (1998) 13612–13617.
[5] N. Danilovich, P.S. Babu, W. Xing, M. Gerdes, H. Krishnamurthy, M.R. Sairam, Estrogen deficiency, obesity, and skeletal abnormalities in follicle- stimulating hormone receptor knockout (FORKO) female mice, Endocrinology 141 (2000) 4295–4308. [6] L.L. Heckert, M.D. Griswold, Expression of the FSH receptor in the testis, Recent. Prog. Horm. Res. 48 (1993) 61–77. [7] D.J. Tisdall, K. Watanabe, N.L. Hudson, P. Smith, K.P. McNatty, FSH receptor gene expression during ovarian follicle development in sheep, J. Endocrinol. 15 (1995) 273–281. [8] C.K. Sites, K. Patterson, C.S. Jamison, S.J. Friezner Degen, A.R. La Barbera, Follicle-stimulating hormone (FSH) increases FSH receptor messenger ribonucleic acid while decreasing FSH binding in cultured porcine granulosa cells, Endocrinology 134 (1994) 411–417. [9] J.L. Tilly, P.S. LaPolt, A.J. Hsueh, Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells, Endocrinology 130 (1992) 1296–1302. [10] L. Dunkel, J.L. Tilly, T. Shikone, K. Nishimori, A.J.W. Hsueh, Follicle-stimulating hormone receptor expression in the rat ovary:increases during prepubertal development and regulation by opposing actions of transforming growth factors b and a, Biol. Reprod. 50 (1994) 940–948. [11] J. Gromoll, B. Dankbar, T. Gudermann, Characterization of the 50 flanking region of the human follicle-stimulating hormone receptor gene, Mol. Cell Endocrinol. 102 (1994) 93–102. [12] L.L. Heckert, I.J. Daley, M.D. Griswold, Structural organization of the follicle-stimulating hormone receptor gene, Mol. Endocrinol. 6 (1992) 70–80. [13] M.R. Sairam, V.S.R. Subbarayan, Characterization of the 50 flanking region and potential control elements of the ovine follitropin receptor gene, Mol. Reprod. Dev. 48 (1997) 480–487. [14] I. Huhtaniemi, V. Eskola, P. Pakarinen, T. Matikainen, R. Sprengel, The murine luteinizing hormone and follicle-stimulating hormone receptor genes:transcription initiation sites, putative promoter sequences and promoter activity, Mol. Cell Endocrinol. 88 (1992) 55–66. [15] J. Levallet, P. Koskimies, N. Rahman, I. Huhtaniemi, The promoter of murine follicle-stimulating hormone receptor: functional characterization and regulation by transcription factor steroidogenic factor 1, Mol. Endocrinol. 15 (2001) 80–92. [16] T.L. Goetz, T.L. Lloyd, M.D. Griswold, Role of E box and initiator region in the expression of the rat follicle-stimulating hormone receptor, J. Biol. Chem. 271 (1996) 33317–33324. [17] W. Xing, M.R. Sairam, Characterization of regulatory elements of ovine follicle-stimulating hormone (FSH) receptor gene: the role of E-box in the regulation of ovine FSH receptor expression, Biol. Reprod. 64 (2001) 579–589. [18] C.C. Linder, L.L. Heckert, T.L. Goetz, M.D. Griswold, Folliclestimulating hormone receptor gene promoter activity, Endocrine 2 (1994) 957–966. [19] M. Griswold, J. Kim, Site-specific methylation of the promoter alters deoxyribonucleic acid–protein interactions and prevents follicle-stimulating hormone receptor gene transcription, Biol. Reprod. 64 (2001) 602–610. [20] W. Xing, M.R. Sairam, Role of CACC box in the regulation of ovine FSH receptor expression, Biol. Reprod. 65 (2001) 1142– 1149. [21] W. Xing, N. Danilovich, M.R. Sairam, Orphan receptors COUPTFs inhibit SF-1, USF and AP-1 activation of ovine FSH receptor expression via composite cis-elements, Biol. Reprod. 66 (2002) 1656–1666. [22] W. Xing, M.R. Sairam, Retinoic acid mediates transcriptional repression of ovine FSH receptor gene via a pleiotropic nuclear receptor response element, Biol. Reprod. 67 (2002) 196–203. [23] M. Rassoulzadegan, V. Paquis-Flucklinger, B. Bertino, J. Sage, M. Jasin, K. Miyagawa, V. Van Heyningen, P. Besmer, F. Cuzin,
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
[24]
[25]
[26]
[27]
[28]
Transmeiotic differentiation of male germ cells in culture, Cell 75 (1993) 997–1006. P.J. Chedrese, M.R. Rodway, C.L. Swan, C. Gillio-Meina, Establishment of a stable steroidogenic porcine granulosa cell line, J. Mol. Endocrinol. 20 (1998) 287–292. M.P. Rols, C. Delteil, G. Serin, J. Teissie, Temperature effects on electrotransfection of mammalian cells, Nucl. Acids Res. 22 (1994) 540. S. Philipsen, G. Suske, A tale of three fingers: the family of mammalian Sp/XKLF transcription factors, Nucl. Acids Res. 27 (1999) 2991–3000. A. Thiagalingam, A. Busteros, M. Borges, R. Jasti, D. Compton, L. Diamond, M. Mabry, D.W. Ball, S.B. Baylin, B.D. Nelkin, RREB-1, a novel zinc finger protein, is involved in the differentiation response to Ras in human medullary thyroid carcinomas, Mol. Cell Biol. 16 (1996) 5335–5345. S. Wagner, M.A. Hess, P. Ormonde-Hanson, J. Malandro, H. Hu, M. Chen, R. Kehrer, M. Frodsham, C. Schumacher, M. Beluch, C. Honer, M. Skolnick, D. Ballinger, B.R. Bowen, A broad role for the zinc finger protein ZNF202 in human lipid metabolism, J. Biol. Chem. 275 (2000) 15685–15690.
1101
[29] J.L. Zhao, K.F. Austen, B.K. Lam, Cell-specific transcription of leukotriene C(4) synthase involves a Kruppel-like transcription factor and Sp1, J. Biol. Chem. 275 (2000) 8903–8910. [30] R. Tewari, N. Gillemans, M. Wijgerde, B. Nuez, M. von Lindern, F. Grosveld, S. Philipsen, Erythroid Kruppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 50 HS3 of the beta-globin locus control region, EMBO J. 17 (1998) 2334–2341. [31] W. Zhang, D.E. Geiman, J.M. Shields, D.T. Dang, C.S. Mahatan, K.H. Kaestner, J.R. Biggs, A.S. Kraft, V.W. Yang, The gutenriched Kr€ uppel-like factor (kr€ uppel-like factor 4) mediates the transactivating effect of p53 on the p21WAF!=Cip1 , J. Biol. Chem. 275 (2000) 18391–18398. [32] C. Monaco, M.H. Citterich, E. Caprini, I. Vorechovsky, G. Russo, C. Croce, G. Barbanti-Brodano, M. Negrini, Molecular cloning and characterization of ZNF202: A new gene at 11q23.3 endoding testisspecific zinc finger proteins, Genomics 52 (1998) 358–362. [33] H. Peng, G.E. Begg, S.L. Harper, J.R. Friedman, D.W. Speicher, F.J. Rauscher III, Biochemical analysis of the Kruppel-associated box (KRAB) transcriptional repression domain, J. Biol. Chem. 275 (2000) 18000–18010.
Cross talk of two Krupple transcription factors regulates expression of the ovine FSH receptor geneq Weirong Xing and M. Ram Sairam* Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, 110 Pine Avenue West Montreal, Que., Canada H2W 1R7 Received 24 June 2002
Abstract The follicle-stimulating hormone receptor (FSHR) in gonadal cells is required for normal folliculogenesis and spermatogenesis. To understand its regulation, we identified a CACC-box from )46 to )67 of the ovine FSHR promoter. Antibody supershift with a 22-bp DNA probe and nuclear extract from a Sertoli cell line demonstrated that a testis-specific zinc finger protein, ZNF202, might be one of the binding proteins. Western blots using ZNF202 antibody and Southwestern blot analyses with the DNA probe detected the same 60 kDa protein in both Sertoli and ovarian granulosa cell lines. Gel shift assays also revealed that the DNA–protein complex from Sertoli cells overexpressing the human Ras-responsive element binding protein-1 (RREB-1) migrated the same way as the complex containing endogenous CACC-box binding protein. Transfection studies indicated that ZNF202 repressed ovine FSHR promoter activity whereas RREB-1 was likely to function as an activator. These data suggest that selective expression and cross talk of functionally distinctive Krupple transcription factors could regulate tissue- and stage-specific expression of FSHR gene. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: FSH receptor promoter; Transcription; Krupple-like factor; Sertoli cells; Granulosa cells; CACC-box; DNase I footprinting; Luciferase assay
Follicle-stimulating hormone (FSH) and its specific receptor(s) are required for normal gametogenesis and biosyntheses of steroid hormones in both males and females [1]. Upon hormone binding, the activated membrane bound FSH receptors (FSHR) are believed to couple with Gs proteins as well as other transducing units activating multiple signaling mechanisms to initiate a cascade of intracellular events, leading to specific biological effects of the gonadotropin [2]. Recent studies in either the FSHb subunit or FSHR knockout mice have highlighted the importance of FSH signaling in maintaining normal spermatogenesis in the male and folliculogenesis in females [3,4]. In addition, other indiq Abbreviations: FSH, follicle-stimulating hormone; FSHR, FSH receptor; EMSA, electrophoretic mobility shift assay; bp, base pair; kb, kilobase pair; kDa, kiloDalton; SDS–PAGE, SDS–polyacrylamide gel electrophoresis; Sp-1, SV40 protein-1; EGR-1, early growth response gene 1; RREB-1: ras-responsive element binding protein-1; ZNF202: zinc finger protein 202; ORRE: orphan receptor response element. * Corresponding author. Fax: +514-987-5585. E-mail address: [email protected] (M.R. Sairam).
rect effects in controlling lipid metabolism, bone remodeling, and tumorigenesis also result from the imbalance of steroid hormones [5]. The selective expression of FSHR in target ovarian granulosa cells and testicular Sertoli cells appears to be stage-dependent, coinciding with different maturation statuses of the follicles or germ cells [6,7]. Such variable expression patterns are apparently regulated by many paracrine/autocrine factors and gonadotropic hormones by either affecting mRNA stability, receptor alternative splicing or modulating the regulatory elements within the promoter region [8–10]. The promoters of FSHR gene have been cloned from a number of species including human, rat, mouse, and ovine [11–14]. A major distinguishing feature of the 50 -flanking regions of FSHR promoters from human, rat and ovine is the lack of typical TATA or CCAAT boxes [11–13], although a TATA-like sequence is present near the major transcription initiation site of the mouse FSHR promoter [14]. An initiator-like sequence, encompassing a transcriptional start site, seems to be conserved at least in mouse and rat [15,16]. The strongest promoters of the
0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 0 8 1 2 - 4
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
four species can be localized within 370 bp of the promoter regions relative to the translation start sites [11,12,14,17]. A search for the regulatory elements in the core promoter regions reveals that a consensus E-box and steroidogenic factor-1 (SF-1) binding sites are well conserved among the species and seem to play an important role in the regulation of FSHR expression [15–17]. More recent studies have demonstrated that multiple site-specific cytosine methylation within the rat FSHR promoter might be involved in the tissue-specific repression of FSHR gene [18]. Thus, demethylation of these sites could re-activate receptor transcription as necessary [19]. These studies suggest that full activation of promoters containing recognition sequences for many different transcription factors requires simultaneous binding of a variety of transcription factors that might act synergistically or antagonistically. Therefore, a first step in understanding these mechanisms is to identify the DNA binding proteins and their functions in the expression of FSHR gene. Previous studies on ovine FSHR promoter have characterized several composite cis-elements including an E-box, a CACC-box, an AP-1 binding site embedding an atypical E-box and an orphan receptor response element (ORRE), and a complex nuclear receptor response element [17,20–22]. In the present paper, we report the functional studies of CACC-box binding proteins belonging to a family of Krupple transcription factors. We found that selective expression and cross talk between functionally distinctive Krupple transcription factors might participate in tissue- and stagespecific expression of FSHR gene.
1097
electroporation cuvette with 960 lF at 220 V, using a Gene Pulser (BioRad, Hercules, CA). The cells were incubated at 37 °C for 10 min and then cultured in 60 mm petri dishes. After 48 h, cells were lysed in a lysis buffer containing 100 mM Tris–HCl, 0.5% NP-40, 1 mM DTT. Appropriate aliquots of cell extract were used for both luciferase and b-galactosidase assays [17]. Electrophoretic mobility shift assay and antibody shift assay. Double-stranded oligonucleotides (TCCCACCCCACCCCCACCAAAG) were synthesized by BioCorp (Montreal, Canada). Nuclear extract preparation and the electrophoretic mobility shift assays (EMSAs) were performed as described [17]. Briefly, double-stranded oligonucleotides were labeled at the 50 ends using T4 polynucleotide kinase and [c-32 P]ATP. Nuclear extract ð10 lgÞ from either 15P1 or JC-410 cells was incubated in a binding buffer, containing 50 lg=ml poly(dI-dC), and 20 fmol of labeled DNA probe at room temperature for 20 min. The reaction mixture was analyzed using a 5% non-denaturing polyacrylamide gel in 1 TBE buffer (50 mM Tris–borate–EDTA, pH 8.0). For the antibody supershift assay, 1 lg antibody against ZNF202 or pre-immune control IgG (Santa Cruz Biotechnology, CA) was added into the reaction mixture and incubated at room temperature for an additional 15 min. Gels were dried and visualized by autoradiography. Western and Southwestern blot analyses. An aliquot ð120 lgÞ of nuclear extracts from 15P1 and JC-410 cells was separated on a 7.5% of SDS–PAGE denaturing gel. Proteins were then transferred to a nitrocellulose and the membrane was incubated at 4 °C overnight in a buffer containing 5% dry skim milk, 150 mM NaCl, 50 mM Tris–HCl
Materials and methods Plasmids, cell lines, and antibodies. Promoterless plasmid pGL3basic (Promega, Madison, WI) and ovine FSHR promoter/luciferase constructs were described previously [17]. A pCDNA3.1-ZNF202 plasmid was a gift from Dr. B. Bowen (Novartis Pharmaceutical, East Hanover, NJ). The pMV7p1-371 of the RREB-1 expression vector was from Dr. B.D. Nelkin (Johns Hopkins School of Medicine, Baltimore, MD). A mouse Sertoli cell line (15P1) was provided by Dr. Francßois Cuzin (University of Nice, Nice Cedex 2, France) [23]. A stable and spontaneously immortalized porcine ovarian granulosa cell line (JC410) was a gift from Dr. Jorge P Chedrese (University of Saskatchewan, Saskatoon, Canada) [24]. Antibodies against GST fusion proteins SCAN (1–199), KRAB (177–329), and zinc finger (387–543) domains of the zinc finger protein 202 (ZNF202) were also provided by Dr. B. Bowen. Cell culture and transient transfections. The cells were routinely maintained in a humidified 37 °C (JC-410 cells) or 32 °C (15P1 cells) incubator with 5% CO2 and cultured in F-12/DMEM (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum, 2 mM L -glutamine, 100 U/ml penicillin, and 100 lg=ml streptomycin. Transient transfections were carried out using electroporation as described previously [25]. The cells were transfected with 5 lg luciferase reporter and 0:5 lg pCMVlacZ with or without 5 lg expression vector of the Krupple transcription factor. After 10 min of incubation at room temperature, the cells were electroporated in a 0.4-cm gap width
Fig. 1. In vitro DNase I footprinting with nuclear extract from JC-410 or 15P1 cells. Brackets indicate the regions of protection from DNase I digestion. A portion of the FSHR promoter sequence ()80 to )40) relative to the transcription start site is given at the bottom of the panel. The protected sequence against DNase I digestion in the presence of the nuclear extracts is indicated by bars facing the corresponding strand. Lanes 1–4: DNA sequence tracks; Lane 5: DNase I digestion without nuclear extract (-NE); Lanes 6 and 7: DNase I digestion with 20 lg of nuclear extracts (+NE).
1098
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
(pH 8.0), and 0.05% Tween 20. The immunoblotting was performed in the same buffer containing 0:4 lg=ml rabbit polyclonal antibody against ZNF202 SCAN domain at room temperature for 1 h. Specific proteins were detected using ECL+ Western blotting detection system (Amersham Pharmacia Biotech UK, England) as described previously [5]. After exposing to X-ray film, the membrane was stripped in a buffer containing 100 mM 2-mercaptoethanol, 2% SDS, and 62.5 mM Tris–HCl (pH 6.7) at 50 °C for 30 min. The same membrane was blocked at 4 °C overnight in a buffer containing 5% skim milk powder, 25 mM NaCl, 5 mM MgCl2 , 25 mM Hepes (pH 7.9), and 1 mM DTT for Southwestern blot analysis as described previously [17]. The binding reaction was performed in the same, but milk powder-free buffer with 106 cpm/ml 32 P-labeled double-stranded DNA probe, in the presence of 5 lg=ml salmon-sperm DNA, at room temperature for 18 h. Prior to autoradiography, blots were washed four times at room temperature using the same buffer.
DNase I footprinting. Non-coding strand or coding strand probes were prepared by labeling its 50 end with T4 polynucleotide kinase for performing DNase I footprinting reactions [17]. Binding reactions were incubated at room temperature for 15 min, followed by 5 min of DNase I digestion on ice. The footprint reactions were terminated by the addition of 80 ll stop buffer. The samples were incubated at 45 °C for 1 h, purified, and loaded on a 7% sequencing gel along with A, C, G, and T DNA sequence tracks, followed by autoradiography.
Results and discussion To map further cis-elements within the ovine FSH-R promoter, we performed a DNase I footprinting assay
Fig. 2. Krupple transcription factors, ZNF202 and RREB-1, bind to CACC repeats. (A) An antibody supershift assay. Lane 1: probe with nuclear extract from 15P1 cells; Lanes 2–4: probe with nuclear extract from 15P1 cells, the reaction containing polyclonal antibodies against SCAN, KRAB, and zinc finger domains of ZNF202, respectively; Lane 5: probe with nuclear extract from 15P1 cells, the reaction containing rabbit IgG. (B) Western (right panel) and Southwestern blot analyses (left panel). The same membrane was hybridized with an antibody against SCAN domain of ZNF202, then stripped, and probed with 32 P-labeled double-stranded oligonucleotides containing CACC repeats. Lanes 1 and 2: nuclear proteins from JC-410 and 15P cells, respectively. (C) The electrophoretic mobility shift assay. Lane 1: 32 P-labeled probe containing CACC repeats with nuclear extract ð10 lgÞ from JC-410 cells transfected with empty expression vector; Lane 2: 32 P-labeled probe containing CACC repeats with nuclear extract ð10 lgÞ from JC-410 transfected with human RREB-1 expression vector.
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
using the previously reported P363 plasmid as a template [17]. A region protected from DNase I digestion was mapped from )46 to )67 of the strongest promoter on both strands (Fig. 1). This 22 bp region of the promoter contained three CACC repeats to which a number of putative zinc finger proteins can bind [26]. They include SP-1 (SV-40 protein-1) sub-family, early growth response gene-1 (EGR-1), and Krupple-like transcription factors [26]. Previous studies have demonstrated that proteins bound to such double-stranded oligonucleotides are likely to be Krupple-like transcription factors rather than other sub-families [17]. Among them, a Ras-response element binding protein-1 (RREB-1) and a testis-specific zinc finger protein 202 (ZNF202) are potential candidates binding to CACC repeats of the ovine FSHR promoter [27,28]. To identify further the CACC repeat binding proteins, we performed an antibody supershift assay with antibodies against the ZNF202 protein (Fig. 2A). We incubated the DNA probe with nuclear extract from 15P1 cells in the presence of antibodies specific to SCAN, KRAB, and Zinc finger domains of the ZNF202 protein (Fig. 2A). All three antibodies specifically supershifted the DNA–protein complex whereas control pre-immune rabbit IgG did not (Fig. 2A). These observations suggest that ZNF202 may be one of the potential proteins participating in DNA binding. To characterize and compare further nuclear proteins that bind the CACC-boxes, we used the same antibody specific to the SCAN domain of ZNF202 and performed a Western blot (Fig. 2B, right panel). The same blot was then stripped and hybridized with a double-stranded DNA probe to see if the proteins recognized by the antibody
1099
also bind to the probe containing CAAC repeats (Fig. 2B, left panel). The double-stranded DNA probe was bound by proteins with an apparent mass of 87 and 60 kDa in nuclear extract from JC-410 cells, but there were 60 and 50 kDa components in nuclear extract from 15P1 cells (Fig. 2B, left panel). Interestingly, the protein with molecular weight of 60 kDa protein present in both JC-410 and 15P1 cells was also recognized by the antibody against ZNF202 (Fig. 2B, right panel). To test whether RREB-1 interacts with the CACC-box probe in a binding reaction, we turned to gel shift mobility assays with the nuclear extract from JC-410 cell that overexpressed human RREB-1 protein (Fig. 2C). The nuclear extract from the same cells that were only transfected with the empty vector was set up as a control (Fig. 2C, lane 1). In agreement with previous studies [20], we could demonstrate that protein binding to the CACC repeats migrates in the same way as the RREB-1/DNA complex (Fig. 2C). Moreover, the intensity of the retarded band was significantly enhanced as a result of the presence of human RREB-1 protein in the nuclear extract (Fig. 2C, compare lane 2 with lane 1). These observations indicate that Krupple-like factors RREB-1 and ZNF202 bind to the ovine FSHR promoter and regulate expression of FSHR gene. To understand the contribution of ZNF202 and RREB-1 proteins to promoter activity of the ovine FSHR, we made a mutation by replacing three residues C to A within the CACC repeats to abolish protein binding [20]. Our luciferase assays in transiently transfected JC-410 cells demonstrated that over-expression of ZNF202 reduced promoter activity by 40% whereas
Fig. 3. Krupple transcription factors regulate FSHR gene expression. A luciferase assay was carried out, using a reporter gene construct with either wild-type promoter or the promoter with a mutated CACC-box. JC-410 cells were co-transfected with a reporter gene fused to a 806 bp wild-type promoter (P806) [17] or a similar promoter containing a mutant CACC-box (P806 CACC-mt) with Krupple transcription factor expression vector, as indicated in the figure. Relative luciferase activity was normalized with b-galactosidase activity and expressed as fold induction over the activity of the pGL3-basic vector. The data shown are means SD. from three independent experiments. An asterisk indicates statistical significance (P < 0:05, compared to P806 CACC-wild-type reporter in absence of expression vector for Krupple transcription factor by Student’s t test).
1100
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
expression of human RREB-1 in JC-410 cells elevated luciferase expression by 80% (Fig. 3). However, a mutation of CACC repeats in the promoter region abolished the responses mediated by either RRE-1 or ZNF202 (Fig. 3). These data suggest that the ZNF202 protein may function as a repressor, while RREB-1 is an activator. The repeating CACC-box sequence is required for multiple Krupple transcription factor binding with a relative higher affinity [20] and is important in genespecific localization, cell cycle regulation, hormonal activation and developmental patterning but also in maintaining the methylation-free active status of the gene, leading to tissue-specific gene expression [29–31]. These two members of Krupple-like factors have been reported as having potential phosphorylation sites, resulting in bipartite functions [27,32]. They could participate in cross talk and compete for the same binding sites either in a positive or negative manner, depending on the growth signals and events of cell proliferation or differentiation at particular stages. In addition, differential recruitment of coactivator or corepressors may be involved [33]. The net regulation of FSHR gene may therefore be determined by the relative availability of transcription factors expressed in a given physiological state. Our findings establish that differential Krupple transcription factor interactions can distinguish their activities that are not discernible in the context of simple elements. Thus, positive or negative interaction of these complex factors may contribute to the differential expression of FSHR gene in gonadal (and non-gonadal tissues) in a stage-dependent manner.
Acknowledgments This investigation was supported by grants from the Canadian Institutes of Health Research (CIHR). We are grateful to Drs. P.J. Chedrese and F. Cuzin for providing the cell lines used in this study. We also thank Drs. B.D. Nelkin and Dr. B. Bowen for generously providing antisera and expression vectors tested in this study.
References [1] M. Simoni, J. Gromoll, E. Nieschlag, The follicle stimulating hormone receptor. Biochemistry, molecular biology, physiology and pathophysiology, Endocr. Rev. 18 (1997) 739–773. [2] J.S. Richards, New signaling pathways for hormones and cyclic adenosine 30 ; 50 -monophosphate action in endocrine cells, Mol. Endocrinol. 15 (2001) 209–218. [3] T.R. Kumar, Y. Wang, N. Lu, M.M. Matzuk, Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility, Nat. Genet. 15 (1997) 201–204. [4] A. Dierich, M.R. Sairam, L. Monaco, G.M. Fimia, A. Gansmuller, M. LeMeur, P. Sassone-Corsi, Impairing follicle-stimulating hormone (FSH) signaling in vivo. Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance, Proc. Natl. Acad. Sci. USA 95 (1998) 13612–13617.
[5] N. Danilovich, P.S. Babu, W. Xing, M. Gerdes, H. Krishnamurthy, M.R. Sairam, Estrogen deficiency, obesity, and skeletal abnormalities in follicle- stimulating hormone receptor knockout (FORKO) female mice, Endocrinology 141 (2000) 4295–4308. [6] L.L. Heckert, M.D. Griswold, Expression of the FSH receptor in the testis, Recent. Prog. Horm. Res. 48 (1993) 61–77. [7] D.J. Tisdall, K. Watanabe, N.L. Hudson, P. Smith, K.P. McNatty, FSH receptor gene expression during ovarian follicle development in sheep, J. Endocrinol. 15 (1995) 273–281. [8] C.K. Sites, K. Patterson, C.S. Jamison, S.J. Friezner Degen, A.R. La Barbera, Follicle-stimulating hormone (FSH) increases FSH receptor messenger ribonucleic acid while decreasing FSH binding in cultured porcine granulosa cells, Endocrinology 134 (1994) 411–417. [9] J.L. Tilly, P.S. LaPolt, A.J. Hsueh, Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells, Endocrinology 130 (1992) 1296–1302. [10] L. Dunkel, J.L. Tilly, T. Shikone, K. Nishimori, A.J.W. Hsueh, Follicle-stimulating hormone receptor expression in the rat ovary:increases during prepubertal development and regulation by opposing actions of transforming growth factors b and a, Biol. Reprod. 50 (1994) 940–948. [11] J. Gromoll, B. Dankbar, T. Gudermann, Characterization of the 50 flanking region of the human follicle-stimulating hormone receptor gene, Mol. Cell Endocrinol. 102 (1994) 93–102. [12] L.L. Heckert, I.J. Daley, M.D. Griswold, Structural organization of the follicle-stimulating hormone receptor gene, Mol. Endocrinol. 6 (1992) 70–80. [13] M.R. Sairam, V.S.R. Subbarayan, Characterization of the 50 flanking region and potential control elements of the ovine follitropin receptor gene, Mol. Reprod. Dev. 48 (1997) 480–487. [14] I. Huhtaniemi, V. Eskola, P. Pakarinen, T. Matikainen, R. Sprengel, The murine luteinizing hormone and follicle-stimulating hormone receptor genes:transcription initiation sites, putative promoter sequences and promoter activity, Mol. Cell Endocrinol. 88 (1992) 55–66. [15] J. Levallet, P. Koskimies, N. Rahman, I. Huhtaniemi, The promoter of murine follicle-stimulating hormone receptor: functional characterization and regulation by transcription factor steroidogenic factor 1, Mol. Endocrinol. 15 (2001) 80–92. [16] T.L. Goetz, T.L. Lloyd, M.D. Griswold, Role of E box and initiator region in the expression of the rat follicle-stimulating hormone receptor, J. Biol. Chem. 271 (1996) 33317–33324. [17] W. Xing, M.R. Sairam, Characterization of regulatory elements of ovine follicle-stimulating hormone (FSH) receptor gene: the role of E-box in the regulation of ovine FSH receptor expression, Biol. Reprod. 64 (2001) 579–589. [18] C.C. Linder, L.L. Heckert, T.L. Goetz, M.D. Griswold, Folliclestimulating hormone receptor gene promoter activity, Endocrine 2 (1994) 957–966. [19] M. Griswold, J. Kim, Site-specific methylation of the promoter alters deoxyribonucleic acid–protein interactions and prevents follicle-stimulating hormone receptor gene transcription, Biol. Reprod. 64 (2001) 602–610. [20] W. Xing, M.R. Sairam, Role of CACC box in the regulation of ovine FSH receptor expression, Biol. Reprod. 65 (2001) 1142– 1149. [21] W. Xing, N. Danilovich, M.R. Sairam, Orphan receptors COUPTFs inhibit SF-1, USF and AP-1 activation of ovine FSH receptor expression via composite cis-elements, Biol. Reprod. 66 (2002) 1656–1666. [22] W. Xing, M.R. Sairam, Retinoic acid mediates transcriptional repression of ovine FSH receptor gene via a pleiotropic nuclear receptor response element, Biol. Reprod. 67 (2002) 196–203. [23] M. Rassoulzadegan, V. Paquis-Flucklinger, B. Bertino, J. Sage, M. Jasin, K. Miyagawa, V. Van Heyningen, P. Besmer, F. Cuzin,
W. Xing, M.R. Sairam / Biochemical and Biophysical Research Communications 295 (2002) 1096–1101
[24]
[25]
[26]
[27]
[28]
Transmeiotic differentiation of male germ cells in culture, Cell 75 (1993) 997–1006. P.J. Chedrese, M.R. Rodway, C.L. Swan, C. Gillio-Meina, Establishment of a stable steroidogenic porcine granulosa cell line, J. Mol. Endocrinol. 20 (1998) 287–292. M.P. Rols, C. Delteil, G. Serin, J. Teissie, Temperature effects on electrotransfection of mammalian cells, Nucl. Acids Res. 22 (1994) 540. S. Philipsen, G. Suske, A tale of three fingers: the family of mammalian Sp/XKLF transcription factors, Nucl. Acids Res. 27 (1999) 2991–3000. A. Thiagalingam, A. Busteros, M. Borges, R. Jasti, D. Compton, L. Diamond, M. Mabry, D.W. Ball, S.B. Baylin, B.D. Nelkin, RREB-1, a novel zinc finger protein, is involved in the differentiation response to Ras in human medullary thyroid carcinomas, Mol. Cell Biol. 16 (1996) 5335–5345. S. Wagner, M.A. Hess, P. Ormonde-Hanson, J. Malandro, H. Hu, M. Chen, R. Kehrer, M. Frodsham, C. Schumacher, M. Beluch, C. Honer, M. Skolnick, D. Ballinger, B.R. Bowen, A broad role for the zinc finger protein ZNF202 in human lipid metabolism, J. Biol. Chem. 275 (2000) 15685–15690.
1101
[29] J.L. Zhao, K.F. Austen, B.K. Lam, Cell-specific transcription of leukotriene C(4) synthase involves a Kruppel-like transcription factor and Sp1, J. Biol. Chem. 275 (2000) 8903–8910. [30] R. Tewari, N. Gillemans, M. Wijgerde, B. Nuez, M. von Lindern, F. Grosveld, S. Philipsen, Erythroid Kruppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 50 HS3 of the beta-globin locus control region, EMBO J. 17 (1998) 2334–2341. [31] W. Zhang, D.E. Geiman, J.M. Shields, D.T. Dang, C.S. Mahatan, K.H. Kaestner, J.R. Biggs, A.S. Kraft, V.W. Yang, The gutenriched Kr€ uppel-like factor (kr€ uppel-like factor 4) mediates the transactivating effect of p53 on the p21WAF!=Cip1 , J. Biol. Chem. 275 (2000) 18391–18398. [32] C. Monaco, M.H. Citterich, E. Caprini, I. Vorechovsky, G. Russo, C. Croce, G. Barbanti-Brodano, M. Negrini, Molecular cloning and characterization of ZNF202: A new gene at 11q23.3 endoding testisspecific zinc finger proteins, Genomics 52 (1998) 358–362. [33] H. Peng, G.E. Begg, S.L. Harper, J.R. Friedman, D.W. Speicher, F.J. Rauscher III, Biochemical analysis of the Kruppel-associated box (KRAB) transcriptional repression domain, J. Biol. Chem. 275 (2000) 18000–18010.