- Email: [email protected]
Crucial role of nuclear factor-κB in neointimal hyperplasia of the mouse carotid artery after interruption of blood flow
Atherosclerosis 166 (2003) 233 /242 www.elsevier.com/locate/atherosclerosis
Crucial role of nuclear factor-kB in neointimal hyperplasia of the mouse carotid artery after interruption of blood flow Francesco Squadrito a,*, Barbara Deodato a, Antonio Bova a, Herbert Marini a, Francesco Saporito a, Margherita Calo` b, Mauro Giacca c, Letteria Minutoli a, Francesco S. Venuti d, Achille P. Caputi a, Domenica Altavilla a a
Department of Clinical and Experimental Medicine and Pharmacology, School of Medicine, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy b Department of Pathology and Infectious Disease, School of Veterinary Medicine, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy c International Center for Engineering and Biotechnology, Padriciano Trieste, Italy d Department of Neurosciences, Psychiatry and Anesthesiology, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy Received 27 February 2002; received in revised form 27 July 2002; accepted 9 September 2002
Abstract We used a molecular genetics approach to investigate the role of nuclear factor-kB (NF-kB) in neointimal hyperplasia induced by flow interruption of carotid artery in mice. Wild type mice (WT mice) and mice rendered deficient in p105, the precursor of p50, one of the components of the multimeric transcription factor NF-kB (NF-kB knockout mice; KO mice), were subjected to a complete ligation of the left common carotid artery. Morphometric analysis of the structural alteration caused by the disruption of the arterial blood flow was performed 14 days after surgery. Furthermore the expression of intercellular adhesion molecule-1 (ICAM-1) in injured arteries was evaluated 4 days after artery ligation by the means of reverse transcriptase polymerase chain reaction (RT-PCR) and quantification of the ICAM-1 protein levels. In a separate experiment normal mice were randomly assigned to receive a recombinant adeno-associated virus (rAAV) encoding the gene for the NF-kB inhibitory protein IkBa (rAAV-IkBa), or the bgalactosidase gene (rAAV-LacZ), both at a dose of 1011 copies and 2 weeks later were subjected to the complete ligation of the left carotid artery. NF-kB activity (studied by means of electrophoretic mobility shift assay */EMSA), IkBa expression (evaluated by Western blot analysis) ICAM-1 evaluation (RT-PCR and quantification of the protein levels) and a morphometric analysis were evaluated in the injured arteries. Disruption of the arterial blood flow caused a marked neointimal hyperplasia. The mean intimal area was 0.0239/0.002 mm2 in wild type mice compared with 0.0029/0.001 mm2 in NF-kB knockout mice. ICAM-1 expression was 1.79/0.8 relative amount of ICAM-1 mRNA in wild type mice compared with 0.49/0.06 relative amount of ICAM-1 mRNA in NFkB knockout mice. ICAM-1 protein levels were also significantly reduced in NF-kB knockout mice. Injured arteries treated with rAAV-IkBa had a greater expression of IkBa and lower NF-kB activity, when compared with vessels treated with rAAV-LacZ. Furthermore, ICAM-1 expression was markedly attenuated by the treatment with rAAV-IkBa (rAAV-LacZ /1.69/0.8 relative amount of ICAM-1 mRNA; rAAV-IkBa/0.559/0.04 relative amount of ICAM-1 mRNA). ICAM-1 protein levels were also significantly decreased in rAAV-IkBa treated mice. Finally the mean intimal area was 0.0289/0.003 mm2 in left carotid arteries treated with rAAV-LacZ whereas it was 0.0039/0.004 mm2 in vessels treated with rAAV-IkBa. Our data indicate that NF-kB plays a crucial role in neointimal hyperplasia induced by flow cessation in the mouse carotid artery, and in addition suggest that rAAVmediated gene transfer of IkBa might represent a novel therapeutic approach to the treatment of restenosis. # 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Nuclear factor-kB knockout mice; Neointimal hyperplasia; IkBa gene transfer; Intercellular adhesion molecule-1
1. Introduction * Corresponding author. Tel.: /39-90-221-3648; fax: /39-90-2213300 E-mail address: [email protected] (F. Squadrito).
Restenosis is one of the major limitations of percutaneous transluminal angioplasty and can be thought of as
0021-9150/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 2 ) 0 0 3 3 6 - 2
234
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
a combination of neointimal formation and arterial remodeling in response to injury. Intimal hyperplasia has been described as the ‘pathological hallmark of restenosis after angioplasty’ [1]; however, it may not be the primary mechanism by which restenosis occurs. Vascular remodeling has also a significant impact on chronic lumen area [2,3] and may be responsible for 50/ 90% of late luminal area loss [4 /7]. Remodeling is an adaptive process that occurs in response to chronic changes in hemodynamic conditions [8] and involves changes in many processes, such as cell growth, cell death, cell migration, and changes in extracellular matrix composition, that lead to a compensatory adjustment in vessel diameter and lumen area. The exact mechanism of arterial neointimal thickening still remains to be fully understood and may involve growth factors, vasoactive agents, inflammatory genes, adhesion molecules and matrix modulators. Nuclear factor-kB (NF-kB) is an early transcription factor which modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response. The prototypic inducible form of NF-kB is an heterodimer composed of NF-kB1 and Rel A, which both belong to the NF-kB/Rel family of proteins. Inactive NF-kB is present in the cytoplasm complexed with the inhibitory protein IkBa. NF-kB is activated by a number of incoming signals from the cell surface. Released from IkBa inhibition, NF-kB translocates into the nucleus and binds to kB motif of the target gene, in turn causing activation of several factors (cell adhesion molecules; cytokines) involved in the inflammatory response [9 /11] It has been suggested that NF-kB activation is involved in arterial response to balloon injury in rats [12 /14]. However, the role of this transcription factor in the vascular injury induced by disruption of carotid artery blood flow in the mouse has not yet been investigated. Interruption of flow caused by ligation of the left common carotid just proximal to the left carotid bifurcation results in a 80% reduction in the lumen area through a combination of intimal hyperplasia together with decreased vessel diameter [15]. This model is a useful tool for studying neointimal hyperplasia. It has the potential to identify molecules contributing to the remodeling process in vivo by studying animals carrying targeted disruption of genes or expressing transgenes. In the present study neointimal lesion formation in wild type mice and in mice rendered deficient in p105 (a precursor of p50, one of the component of the transcription factor NF-kB) was compared to investigate the role of this cytoplasmatic messenger in the mouse model of vascular remodeling. We also investigated the effect of adeno associated virus-mediated IkBa (the inhibitory
protein of NF-kB) delivery on lesion formation induced by interruption of blood flow in the carotid artery.
2. Methods 2.1. Animals All procedures complied with the standards for care and use of animal subjects as stated in the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, National Academy of Sciences, Bethesda, MD). Breeding pairs of NF-kB knockout mice (p105; b6; 129-Nfkb1fm1Bal) and normal control littermate wild type mice (C57Bl/6; 129), both weighing 22/30 g, were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Swiss mice (weighing 20 /25 g) were purchased from Charles River (Varese, Italy). The animals were bred in Messina University School of Medicine Animal Facility. 2.2. Recombinant AAV vectors production Infectious rAAV particles were produced according to the Grimm’s protocol [16]. Briefly, rAAV vectors were generated by cotransfecting 293 cells, seeded on 15 cm dishes, with 15 mg of the vector constructs: pAAV-IkBa or pAAV-LacZ (b-galoctosidase) and 45 mg of the helper plasmid pDG. Twelve hours later, the medium was replaced by fresh medium and 3 days after transfection the medium was collected and the cells harvested by scraping. After three freeze /thaw cycles in dry ice/ethanol bath and 37 8C water bath, the cell lysate was fractionated using ammonium sulfate precipitation. rAAV particles were then purified by CsCl gradient centrifugation in a SW41Ti rotor at 288,000 /g for 36 h. Twelve to sixteen fractions of ten drops each were collected by inserting a G-21 needle below the rAAV band and their refractive index determined. The six fractions with the index closest to 1.3715 (corresponding to a density of 1.40 g/cm3) were dialyzed against PBS at 4 8C overnight and stored at /80 8C. The rAAVs titers were determined by competitive PCR. Samples were tested for IkBa expression by Western blotting using anti-MAD-3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). 2.3. Mouse carotid ligation model In a first experiment wild type mice (C57Bl/6; 129) and NF-kB knockout mice (p105; b6; 129-Nfkb1fm1Bal) were anesthetized by intraperitoneal injection with a solution of xylazine (5 mg/kg) and ketamine (80 mg/kg). The left common carotid artery was exposed through a small midline incision in the neck. The artery was
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
completely ligated just proximal to the carotid bifurcation to disrupt blood flow. In a separate set of experiments Swiss mice were randomized to receive a recombinant adeno-associated virus (rAAV) encoding the gene for the NF-kB inhibitory protein IkBa (rAAV-IkBa), or the b-galactosidase gene (rAAV-LacZ), both at a dose of 1011 copies. The left common carotid artery was exposed through a small midline incision in the neck and injections were done under microscope magnification (to insure the gene delivery into the tunica media) on the external surface of the left common carotid artery, below the carotid bifurcation. Two weeks later these animals were subjected to the complete ligation of the left carotid artery. 2.4. Morphometric analysis Fourteen days after carotid ligation, the mice were anesthetized and perfusion-fixed at a constant pressure (100 mmHg) via the left ventricle with 4% paraformaldehyde in 0.1 mol/l phosphate buffer (pH 7.3). The whole left common carotid artery was excised and placed for 24 h in 4% paraformaldehyde. Vessels where then processed for paraffin embedding. Five serial sections (200 mM apart) of 3-mm thickness were cut, starting from 1 mm below the carotid bifurcation and proceeding to the aortic arch. Sections underwent Hematoxilin and Eosin staining. Morphometric analysis was performed in a blind fashion by use of a dedicated software package (KS300, Zeiss). The lumen, internal elastic lamina (IEL), and external elastic lamina (EEL) were defined, and the intima (tissue between lumen and IEL) and media (tissue between IEL and EEL) areas were recorded. Intima/media area ratios were also calculated. 2.5. RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR) To evaluate the message for the intercellular adhesion molecule-I (ICAM-1), total cellular RNA was extracted from carotid artery specimen harvested from mice sacrificed 4 days after interruption of blood flow in the carotid artery. In brief, approximately 100 mg of tissue was homogenized with 800 ml RNAZOL STAT (Teltest, Firendswood, TX) in a microfuge tube, after which 80 ml chloroform was added. After vortexing and centrifugation, the aqueous phase was transferred to a new microfuge tube containing an equal volume of cold isopropanol and the RNA recovered by precipitation by chilling at /80 8C for 15 min. The pellet was washed with cold ethanol 70%, centrifuged, dried in speed vacuum, centrifuged a second time and then dissolved in 20 ml of buffer. A 2-mg portion of total RNA was subjected to first strand cDNA synthesis in a 20-ml reaction mixture containing the AMV reverse transcrip-
235
tase (Superscript II; BRL USA), each dNTP, the specific primers, Tris /HCl and MgCl2. After dilution of the product with distilled water, 5 ml were used for each polymerase chain reaction (PCR) which contained the Taq polymerase (Perkin Elmer), the buffer as supplied with the enzyme, each dNTP and the specific primers, designed to cross introns and to avoid confusion between mRNA expression and genomic contamination. The following oligonucleotide pairs were used (5? oligo/3? oligo), each sequence as 5? to 3?: ICAM-1: AGGTGGATATCCGGTAGA/CCTTCTAAGTCCT CCAACA and GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.The optimal cycle number for ICAM-1 was 25 and we used a PCR negative and a PCR positive control without cDNA or with a known cDNA, respectively. A portion of the PCR product was electrophoresed and transferred to a nylon membrane which was prehybridized with oligonucleotide probes, radiolabeled with [32P] ATP by a T4 oligonucleotide kinase. After an overnight hybridization at 55 8C, filters underwent autoradiography in a dark-room with a fixed camera. The captured image, sent to an image analysis software (BIO-PROFIL, Celbio, Milan, Italy) was subjected to densitometric analysis. 2.6. Isolation of nuclear and cytoplasmatic proteins To evaluate NF-kB and IkBa, animals were scarified 6 h after carotid artery ligation. The harvested arteries were kept for 5 min in ice-cold 0.9% NaCl containing 0.02 mM butylated hydroxytoluene (BHT) and then stripped of adventitia and frozen in liquid nitrogen. Briefly 40 mg of pulverized carotid samples were homogenized in 0.8 ml ice cold hypotonic buffer [10 mM HEPES pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT); protease inhibitors: 0.5 mM phenyl methylsulfonyl fluoride, aprotinin, pepstatin, leupeptin (10 mg/ml each); and phosphatase inhibitors: 50 mM NAF, 30 mM b-glycerophosphate, 1 mM Na3VO4 and 20 mM r-nitrophenyl phosphate]. The homogenates were centrifuged for 30 s at 2000 rpm at 4 8C to eliminate any unbroken tissues. The supernatants were incubated on ice for 20 min, vortexed for 30 s after addition of 50 ml of 10% Nonidet P-40 and then centrifuged for 1 min at 4 8C in an Eppendorf centrifuge. Supernatants containing cytoplasmatic protein were collected and stored at /80 8C. The pellets after a single wash with the hypotonic buffer without Nonidet P-40, were suspended in an ice-cold hypertonic salt buffer (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitors, and phoshatase inhibitors), incubated on ice for 30 min, mixed frequently, and centrifuged for 15 min at 4 8C. The supernatants were collected as nuclear extracts and
236
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
stored at /80 8C. The concentration of total proteins in the samples was determined by a commercially available protein assay reagent. To estimate possible contamination of the nuclear extracts with the cytoplasmatic extracts, when preparing the nuclear and cytoplasmatic proteins, lactate dehydrogenase (LDH) activity was determined by a commercially available kit for the quantitative kinetic determination of LDH activity (Sigma Chemical, St. Louis, MO). Values were expressed as LDH activity units per milligram of protein. To establish that the nuclear extracts contained mainly nuclear proteins, 40 mg of nuclear protein preparations were subjected to Western blot analysis for histone H3, a nuclear protein, with anti-histone H3 antibody. (Upstate Biotechnology, Lake Placid, NY). 2.7. Electrophoretic Mobility Shift Assay (EMSA) NF-kB binding activity was performed in a 15-ml binding reaction mixture containing 1% binding buffer [50 mg/ml of double-stranded poly(dI-dC), 10 mM Tris HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 1 mM MgCl2, and 10% glycerol], 15 mg of nuclear proteins, and 35 fmol (50,000 cpm, Cherenkov counting) of double-stranded NF-kB consensus oligonucleotide (5?-AGT TGA GGG GAC TTT CCC AGG C-8?; Promega, Madison, WI) which was end-labeled with [g32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Life Sciences, Arlington Heights, IL) using T4 polynucleotide kinase. The binding reaction mixture was incubated at room temperature for 20 min and analyzed by electrophoresis on 5% non-denaturing polyacrylamide gels. After electrophoresis, the gels were dried using a gel-drier and exposed to Kodak X-ray films at /70 8C. The binding bands were quantified by scanning densitometry of a bio-image analysis system (Bio-Profil Celbio, Milan, Italy). The results for each time point from each group were expressed as relative integrated intensity compared with the uninjured carotid arteries measured in the same batch because the integrated intensity of group samples from different EMSA batches would be affected by the half-life of the isotope, exposure time, and background levels. 2.8. Western blot analysis of IkBa in cytoplasm Cytoplasmatic proteins (20 mg) from each sample were mixed with 2 /SDS sample buffer [62 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 5% b-mercaptoethanol, 0.003% bromophenol blue], heated at 95 8C for 5 min, and separated by SDS /polyacrylamide gel electrophoresis. After electrophoresis on 12.5% polyacrylamide gels, the separated proteins were transferred from the gels into Hybond electrochemiluminiscence membranes
(Amersham) using a Bio-Rad semidry transfer system (Bio-Rad) for 2 h. The membranes were blocked with 5% not-fat dry milk in TBS /0.05% Tween for 1 h at room temperature, washed three times for 10 min each in TBS /0.05% Tween 20, and incubated with a primary IkBa antibody (Santa Cruz Biotechnology) in TBS / 0.05% Tween 20 containing 5% not-fat dry milk for 1 /2 h at room temperature. After being washed three times for 10 min each in TBS /0.05% Tween 20, the membranes were incubated with a second antibody peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma) for 1 h at room temperature. After washing, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacturer’s protocol (Amersham). The IkBa protein signal was quantified by scanning densitometry using a bio-image analysis system (BIO-PROFIL Celbio, Milan Italy). The results from each experimental group were expressed as relative integrated intensity compared with uninjured arteries measured in the same batch. 2.9. Quantification of ICAM-1 protein levels Mice were sacrificed 4 days after interruption of blood flow in the carotid artery. The carotid tissue was thawed, placed in complete lysis buffer (Boehringer Mannheim, Indianapoli, IN) homogenized with a handheld homogenizer and sonicated for 10 s. The homogenate was centrifuged at 10,000 /g for 5 min, and the supernatant and sediment fraction were separated. Quantification of ICAM-1 was normalized to total protein in the sample. Total protein determination was performed using a modified Bradford assay with serial dilutions of bovine serum albumin. ICAM-1 levels were quantified in the cell homogenate using a direct ELISA method. In brief, 25 ml of the carotid tissue homogenate or Ag-specific blocking peptide (for mouse ICAM-1) as standards (serial dilutions from 0.001 to 20 ng/ml; Santa Cruz Biotechnology) was mixed with coating buffer, added in duplicate, and incubated overnight at 0 8C. The plates were washed three times with PBS and blocked with 2% BSA in PBS for 60 min at 37 8C. After further washing, 50 ml of Ab to ICAM-1 (2 mg/ml: Santa Cruz Biotechnology) was added and incubated for 60 min at 37 8C. After washing three times with PBS, a goat anti-rabbit peroxidase conjugate secondary Ab (1/200 dilution; Santa Cruz Biotechnology) was added and incubated for 45 min at 37 8C. The plates were again washed and incubated for 45 min at 37 8C. The plates were again washed and the substrate TMB (3,3?, 5,5?-tetramethylbenzidine) was added for color development. Finally the reaction was quenched using 100 ml of 1 M H2PO4. The sensitivity was 10 pg/ml and negligible background sensitivity was found when testing the secondary Ab against the absorbed Ags.
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
237
2.10. Statistical analysis Data are expressed as means9/S.D. The difference between the means of two groups was evaluated with an ANOVA followed by Bonferroni’s test and was considered significant when P B/0.05.
3. Results 3.1. Comparison of lesion formation in normal and KO mice Intimal areas for NF-kB knockout mice (KO) were significantly less than for wild type (WT mice) (Fig. 1). The mean intimal area was 0.0239/0.002 mm2 in wild type mice whereas was 0.0029/0.001 mm2 in KO mice. This decrease of neointima formation in knockout mice was confirmed by comparison of intima-to-media ratios (0.0499/0.034 for KO mice versus 0.8359/0.122 for wild type mice; P B/0.005). 3.2. ICAM-1 mRNA expression in injured carotid arteries of normal mice and KO mice
Fig. 2. (A) ICAM-1 mRNA expression in uninjured and injured arteries of wild type (WT) and NF-kB knockout (KO) mice. This figure shows representative autoradiograms highlighting ICAM-1 expression and depicts also quantitative data indicating relative amount of ICAM-1 mRNA in right (RA) and left (LA) carotid arteries of both wild type (WT) and NF-kB knockout mice (KO). Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. wild type mice. (B) ICAM-1 protein levels in uninjured and injured arteries of wild type (WT) and NF-kB knockout (KO) mice. Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. wild type mice.
Fig. 2A shows representative autoradiograms highlighting ICAM-1 mRNA expression in wild type and
Fig. 1. Average intimal area for wild type (n/15; WT) and NF-kB knockout (n/15; KO) mice. Average intimal area was calculated for ten histological sections per animal. *P B/0.001 vs. wild type mice.
238
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
KO mice 4 days after carotid artery ligation. Fig. 2A also depicts quantitative data and indicates relative amounts of ICAM-1 in the same groups of animals. ICAM-1 expression was markedly elevated in the injured artery of wild type mice (Fig. 2). Animals deficient in NF-kB had a reduced mRNA expression for the adhesion molecule in the injured left carotid artery. Both strains of mice did not show significant change in the expression of ICAM-1 in the uninjured right carotid arteries. Fig. 2B indicates ICAM-1 protein levels in injured and uninjured carotid arteries of wild type and KO mice. The evaluation of ICAM-1 levels was carried out as a read-out of the mRNA experiments. Elevated ICAM-1 levels were present in the injured artery of wild type animals. In contrast animals deficient in NF-kB showed a decreased levels of ICAM-1 levels.
3.3. Transgene expression of rAAV-IkBa in mouse carotid In a effort to determine the efficiency of rAAV-IkBa expression in mouse carotid artery, animals were treated with rAAV-LacZ or rAAV-IkBa. A Western blot performed 2 weeks after the treatment with an antibody reacting with IkBa showed and enhanced expression of the inhibitory protein (Fig. 3).
Fig. 3. Western blot analysis of IkBa protein. Vessels were stripped of adventizia. Arteries were transduced with rAAV-IkBa or rAAV-LacZ and analysis was performed 2 weeks after treatment. High level expression of IkBa is detectable. Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. rAAV-LacZ.
3.4. Increased transgene expression of IkBa and blunted NF-kB activation in injured carotid arteries following treatment with rAAV-IkBa In the injured left arteries of mice treated with the rAAV-LacZ IkBa was markedly reduced, indicating a strong degradation of this protein (Fig. 4). In contrast there was a higher expression of the inhibitory protein (studied 6 h after surgery) in the ligated carotid arteries treated with rAAV-IkBa compared with vessels treated with rAAV-LacZ (Fig. 4). NF-kB nuclear binding was significantly enhanced in the injured arteries treated with the rAAV-LacZ (Fig. 5). By contrast NF-kB binding activity was markedly suppressed in the injured carotid arteries treated with the rAAV-mediated gene transfer of IkBa (Fig. 5). 3.5. ICAM-1 mRNA expression in injured carotid arteries subjected to the rAAV-mediated gene transfer of IkBa The top of Fig. 6A shows representative autoradiograms highlighting ICAM-1 mRNA expression in carotid arteries treated either with rAAV-LacZ or rAAV-IkBa, 4 days after ligation. The bottom of Fig. 6A depicts quantitative data and indicates relative amounts of ICAM-1 in the same groups. ICAM-1 expression was markedly elevated in the injured arteries given with the gene encoding the bgaloctosidase (Fig. 6A). Injured arteries subjected to the rAAV-mediated gene transfer of IkBa had a reduced mRNA expression for the adhesion molecule. ICAM-1 protein levels were markedly enhanced in injured artery treated with rAAV-LacZ (Fig. 6B).
Fig. 4. Western blot analysis of IkBa protein levels in the cytoplasm of carotid arteries. Samples were right uninjured carotid arteries and left ligated carotid arteries treated with rAAV-LacZ or rAAV-IkBa. The top of the figure shows representative autoradiograms highlighting IkBa protein levels. The bottom of the figure shows quantitative data and indicates integrated intensity of IkBa protein levels. Bars represent the mean9/S.D of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
239
3.6. Lesion formation in mice subjected to the rAAVmediated gene transfer of IkBa
Fig. 5. EMSA of NF-kB in carotid arteries. Samples were right uninjured carotid arteries and left ligated carotid arteries treated with rAAV-LacZ or rAAV-IkBa. The top of the figure shows representative EMSA picture highlighting NF-kB binding activity. The bottom of the figure shows quantitative data and indicates integrated intensity of NF-kB binding activity. Bars represent the mean9/S.D of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
Injured artery treated with rAAV-IkBa showed a marked reduction in ICAM-1 protein levels.
Fig. 6. (A) ICAM-1 mRNA expression in uninjured and injured arteries treated with rAAV-LacZ or rAAV-IkBa. Figure shows representative autoradiograms highlighting ICAM-1 expression and depicts also quantitative data indicating relative amount of ICAM-1 mRNA in right and left carotid arteries. Bars represent the mean9/ S.D. of 15 experiments. *P B/0.02 vs. rAAV-LacZ. (B) ICAM-1 protein leveles in un-injured and injured arteries treated with rAAVLacZ or rAAV-IkBa. Bars represent the mean9/S.D. of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
Intimal areas of rAAV-IkBa-treated animals were smaller than those of mice administered with rAAVLacZ (Fig. 7). The mean intimal area for rAAV-IkBatreated mice was 0.0039/0.004 mm2 in vessels treated with rAAV-IkBa, whereas it was 0.0289/0.002 mm2 in left carotid arteries treated with rAAV-LacZ. The decrease in neointima formation in animals subjected to IkBa gene transfer was confirmed by comparison of intima-to-media ratios (0.1079/0.033 for rAAV-IkBa treated mice versus 0.7259/0.129 for mice administered with rAAV-LacZ).
4. Discussion Coronary restenosis remains a complex pathophysiological problem that continues to defy preventive pharmacological therapy. Restenosis results from a combination of negative remodeling (reduction in the area within the external elastic lamina) and intimal growth (by smooth muscle cell proliferation and extracellular deposition) [17]. Indeed balloon dilation of arteries in animal models
Fig. 7. Average intimal area (for ligated left carotid arteries treated with rAAV-LacZ (n/15) or rAAV-IkBa (n/15). Average intimal area was calculated for ten histological sections per animal. *P B/0.001 vs rAAV-LacZ.
240
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
makes it possible to study the neointimal hyperplasia at different time points, but, under these experimental conditions, hyperplasia occurs next to other processes like inflammation and proliferation. By contrast, during arterial remodeling following a change in blood flow no inflammation occurs, which makes this a relative ‘clean’ model to detect the molecular mechanism specifically involved in neointimal hyperplasia. Interruption of blood flow in the mouse left carotid artery is a murine model of neointimal hyperplasia in which a disruption of the flow field is created in the left common carotid artery [18]. During the time that these animals are allowed to recover, these altered shear stress conditions cause the vessel to ‘remodel’ and shrink in luminal area because of reduction in vessel diameter and neointima formation. Furthermore this model has the potential to allow the identification and investigation of appropriate molecular targets by studying mice carrying targeted disruption of genes (knockout mice) or expressing transgenes. The present experimental model may have also some limitations: ligation of the carotid artery may not mimic a physiological situation since there is a loss of blood flow, and vascular lesions in humans often develop at sites of altered hemodynamic associated with absent or low shear stress. NF-kB is an early transcription factor that modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response. The most studied NF-kB complex is composed of p50 and p65 subunits [19,20]. Other complexes of the five protein subunits, p65, p50, c-rel, relB and p52 have also been described and result in numerous homo-and heterodimeric combinations of NF-kB/rel proteins [21]. Inactive NF-kB is present in the cytoplasm complexed with the inhibitory protein IkBa. Subunit p50, synthesized as a 105 kDA precursor protein has a strong capacity for binding to kB motifs. Subunit p65 has the capacity for strong transactivation of the genes and is able to bind the inhibitory subunit IkBa. NF-kB is activated by a variety of cytokines, endotoxin and oxidative stress. Upon activation NF-kB dissociates from its inhibitor IkBa, translocates to the nucleus and initiates transcription of various genes, cytokines, growth and differentiation factors. To the best of our knowledge no study has been already carried out on the role of NF-kB in the ‘in vivo’ neointimal hyperplasia induced by interruption of blood flow in the carotid artery. In the present study we investigated the involvement of this early transcription factor by using a molecular genetics approach. Animals rendered deficient for expression of p105, a precursor of one of the subunits of NF-kB, and specifically p50, manifest a number of immunological defects due to a reduced NF-kB activation and functionality [22].
In the present experiment the neointimal hyperplasia was reduced in NF-kB knockout mice compared with normal mice. This finding suggests that the p50/p65 heterodimer is essential to trigger the cascade of events leading to the full development of the proliferation process induced by flow alteration and that other p65 homo/heterodimers do not substitute for the p50/p65 heterodimer in the neointimal hyperplasia caused by cessation of flow in the left carotid artery. Constitutive expression of NF-kB seems to be of vital importance for the normal growth and proliferation of vascular smooth muscle cells in vitro [23]. However, NFkB deficient mice do not show significant difference in vessel architecture compared to the normal animals. This finding would indicate that p50/65 homodimers may substitute (in contrast with the observed key role of p50/p65 in vascular remodeling) for p50/p65 heterodimers as transactivators during the physiological and normal growth and proliferation of vascular smooth muscle cells. Besides smooth muscle cell NF-kB, an impaired endothelial NF-kB activation may also have a role in determining the blunted proliferation process in NF-kB deficient mice: in fact it has been shown that the p50/p65 heterodimer plays an important role in the initiation of the atherosclerotic lesion [24]. NF-kB may use several mechanism(s) to cause neointimal hyperplasia. A mechanism may be the regulation of the expression of vascular adhesion molecules. Human fetal aorta contains numerous smooth muscle cells that express intercellular adhesion molecule-1 (ICAM-1). ICAM-1 disappears form the adult medial smooth muscle cells but reappears in smooth muscle cells during the development of atherosclerotic plaques [25]. Furthermore in experimental vascular injury neointimal smooth muscle cells also express ICAM-1 [26]. In agreement with this finding, carotid arteries harvested 4 days after artery ligation showed a marked expression of ICAM-1. ICAM-1 expression was markedly blunted in NF-kB knockout mice. This experimental evidence led us to hypothesize that hyperplasia induced by flow cessation in the left carotid artery activates NF-kB that in turn triggers the gene for ICAM-1. This adhesion molecule may represent at least one of the ‘proliferating’ adhesive molecules involved in smooth muscle cells proliferation. In agreement with our hypothesis, it has been shown that ICAM-1 antibodies exert inhibitory effect on neointimal thickening following balloon injury [27]. Collectively, these data strongly support a key role of the early transcription factor NFkB in the development of neointimal hyperplasia induced by alteration and disturbance in blood flow. Regulation of NF-kB occurs through complex formation of the heterodimer with the cytoplasmatic inhibitor IkBa. IkBa retains the p50/p65 complex in the cytoplasm by masking it nuclear localization se-
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
quence [28]. In addition to retaining NF-kB in the cytoplasm, a second function has been demonstrated for IkBa: it can prevent in vitro DNA binding of NF-kB, namely of the p50/p65 heterodimer [29]. Taking advantage of this physiological regulation of the early transcription factor, an alternative approach to study the role of NF-kB is the blockade of its activation by the transgene over-expression of its inhibitory protein IkBa. This approach may also be important to verify the potential of a gene therapy aimed at over-expressing the IkBa protein for the treatment of neointimal hyperplasia. Among the novel strategies that hold promise for therapeutic gene therapy applications is the use of vectors based on the adeno-associated virus (AAV). These vectors are derived from a non pathogenic and widespread defective parvovirus and are able to transduce both dividing and non dividing cells in a variety of tissue including smooth muscle cells [30]. Since recombinant AAV (rAAV) vectors are devoid of any viral genes (which are expressed in trans for the packaging process) they elicit virtually no inflammatory or immune response in the sites of injections [31,32]. We therefore explored the potential of rAAV mediated gene delivery of IkBa in the mouse carotid on NF-kB activation and neointimal hyperplasia induced by flow interruption. rAAV-IkBa expression in mouse carotid artery, was highly efficient. A Western blot performed after the treatment with an antibody reacting with IkBa showed an enhanced expression of the inhibitory protein. These experiments were performed after the adventitia was stripped out. Furthermore, the rAAV vector shows an exquisite tropism for the smooth muscle cells as described previously [30]. These findings, taken together, indicate that enhanced IkBa expression occurred in the smooth muscle cells of tunica media layer. Carotid artery treated with control vector (rAAVLacZ) showed a marked nuclear binding of NF-kB, reduced expression of the inhibitory protein IkBa, and enhanced expression of the adhesive molecule ICAM-1. AAV-mediated gene delivery of IkBa enhanced significantly the expression of the inhibitory protein, reduced NF-kB and blunted ICAM-1 expression. Furthermore, rAAV-IkBa administration halted significantly the proliferation process induced by flow cessation in the carotid artery. These data further stress the concept that NF-kB plays a crucial role in the neointimal hyperplasia induced by carotid artery ligation. In addition our findings suggest that recombinant AAV-mediated gene transfer of IkBa might represent a novel and promising therapeutic strategy for the clinical treatment of vascular restenosis.
241
References [1] Marmur JD, Merlini PA, Sharma SK, et al. Thrombin generation in human coronary arteries after percutaneous transluminal balloon angioplasty. J Am Coll Cardiol 1994;24:1484 /91. [2] Kakuta T, Currier JW, Haudenschild CC, Ryan TJ, Faxon DP. Differences in compensatory vessel enlargement, not in intimal formation, account for restenosis after angioplasty in the hypercholesterolemic rabbit model. Circulation 1994;89:2809 /15. [3] Currier JW, Faxon DP. Restenosis after percutaneous traansluminal coronary angioplasty, have we been aiming at the wrong target? J Am Coll Cardiol 1995;25:516 /20. [4] Post MJ, Borst C, Kuntz RE. The relative importance of arterial remodeling compared with intimal hyperplasia in lumen renarrowing after balloon angioplasty: a study in the normal rabbit and in the hypercholestolemic Yucatan micropig. Circ Am J Cardiol 1994;89:2816 /21. [5] Mintz GS, Pichard AD, Kent KM, Satler LF, Popma JJ, Leon MB. Intravascular ultrasound comparison of restenotic and de novo coronary artery narrowing. Am J Cardiol 1994;74:1278 /80. [6] Wilensky RL, March KL, Gradus-Pizlo I, Sandusky G, Fineberg N, Hathaway DR. Vascular injury, repair, and restenosis after percutaneous transluminal angioplasty in the atherosclerotic rabbit. Circulation 1995;92:2995 /3005. [7] Andersen HR, Maeng M, Thorwest M, Falk E. Remodelling rather than neointimal formation explains luminal narrowing after deep vessel wall injury: insights from a porcine coronary (re)stenosis model. Circulation 1996;93:1716 /24. [8] Glagov S. Intimal hyperplasia, vascular remodeling, and the restenosis problem. Circulation 1994;89:2888 /91. [9] Ghosh S, May MJ, Kopp EB. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 1998;16:225 /60. [10] Gius D, Botero A, Shah S, Curry HA. Intracellular oxidation/ reduction status in the regulation of transcription factor NFkappa B and AP-1. Toxicol Lett 1999;106:93 /106. [11] Lee J, Burckart GJ. Nuclear factor kappa B: important transcription factor and therapeutic target. J Clin Pharmacol 1998;38:981 / 93. [12] Cercek B, Yamashita M, Dimayuga P, et al. Nuclear factorkappaB activity and arterial response to balloon injury. Atherosclerosis 1997;131:59 /66. [13] Lindner V. The NF-kappaB and Ikappa B system in injured arteries. Pathobiology 1998;66:311 /20. [14] Landry DB, Couper LL, Bryoant SR, Lindner V. Activation of the NF-kappa B and I kappa B system in smooth muscle cells after rat arterial injury. Induction of vascular adhesion molecule-1 and monocyte chemoattractant protein-1. Am J Pathol 1997;151:1085 /95. [15] Bryant SR, Bjercke RJ, Erichesen DA, Rege A, Lindner V. Vascular remodeling in response to altered blood flow is mediated by fibroblast growth factor-2. Circ Res 1999;84:323 /8. [16] Grimm D, Kern A, Rittner K, Kleinschmidt JA. Novel tools for production and purification of recombinant adeno-associated virus vectors. Hum Gene Ther 1998;9:2745 /60. [17] Kimura T, Kaburagy S, Tamura T, et al. Remodeling of human coronary arteries undergoing coronary angioplasty or artherectomy. Circulation 1997;96:475 /83. [18] Kumar A, Lindner V. Remodeling with neointima formation in the mouse carotid artery after cessation of blood flow. Arterioscler Thromb Vasc Biol 1997;17:2238 /44. [19] Grimm S, Baeuerle PA. The inducible transcription factor NFkB: structure /function relationship of its protein subunits. Biochem J 1993;290:297 /308.
242
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
[20] Naumann M, Scheidereit C. Activation of NF-kB in vivo is regulated by multiple phosphorylations. EMBO J 1994;13:4597 / 603. [21] Baldwin AS. The NF-kB and IkB proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649 /81. [22] Cronsten BN, Montesinos CM, Weissmann G. Salicylates and sulfasalazine, but not glucocorticoids, inhibit leukocyte accumulation by an adenosine-dependent mechanism that is independent of inhibition of prostaglandin synthesis and p105 of NFkB. Proc Natl Acad Sci USA 1999;96:6377 /81. [23] Bellas RE, Lee JS, Sonnenshein GE. Expression of a constitutive NF-kB-like activity is essential for the proliferation of cultured bovine smooth muscle cells. J Clin Invest 1995;96:2521 /7. [24] Collins T. Endothelial nuclear factor-kB and the initiation of atherosclerotic lesion. Lab Invest 1993;68:499 /508. [25] Couffinhal T, Duplaa C, Labat L, Lamaziere JMD, Moreau C, Printseva O, Bonnet J. Tumor necrosis factor-a stimulates ICAM1 expression in human vascular smooth muscle cells. Arterioscler Thromb 1993;13:407 /14. [26] Tanaka H, Sukhova GK, Swanson SJ, Clinton SK, Ganz P, Cybulski MI, Libby P. Sustained activation of vascular cells and
[27]
[28]
[29]
[30] [31]
[32]
leukocytes in the rabbit aorta after ballon injury. Circulation 1993;88:1788 /803. Yasukava H, Imaizumi T, Matsoka H, Nakashima A, Kohno K, Miyamoto T, Motimatsu M. Inhibition of intimal hyperplasia after balloon injury by antibodies to ICAM-1 (CD54) and LFA-1 (CD11a/CD18). Circulation 1995;92:1 /9. Zabel U, Henkel T, Dos Santos Silva M, Baeuerle PA. Nuclear uptake control of NF-kB by MAD-3 and IkB protein present in the nucleus. EMBO J 1993;12:201 /11. Brown K, Park S, Kanno T, Franzoso G, Sienbelist U. Mutual regulation of the transcriptional activator NF-kB and its inhibitor, IkB-a. Proc Natl Acad Sci USA 1993;90:2532 /6. Monahan PE, Samulski RJ. AAV vectors: is clinical success on the horizon? Gene Ther 2000;7:24 /30. Kay MA, Manno CS, Ragni MV, et al. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector. Nat Genet 2000;24:257 /61. Chirmule M, Propert K, magosin S, Qian Y, Qian R, Wilson J. Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther 1999;6:1574 /83.
Crucial role of nuclear factor-kB in neointimal hyperplasia of the mouse carotid artery after interruption of blood flow Francesco Squadrito a,*, Barbara Deodato a, Antonio Bova a, Herbert Marini a, Francesco Saporito a, Margherita Calo` b, Mauro Giacca c, Letteria Minutoli a, Francesco S. Venuti d, Achille P. Caputi a, Domenica Altavilla a a
Department of Clinical and Experimental Medicine and Pharmacology, School of Medicine, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy b Department of Pathology and Infectious Disease, School of Veterinary Medicine, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy c International Center for Engineering and Biotechnology, Padriciano Trieste, Italy d Department of Neurosciences, Psychiatry and Anesthesiology, University of Messina, Azienda Ospedaliera Universitaria ‘G. Martino’, Torre Biologica 58 Piano, Via Consolare Valeria Gazzi, 98125 Messina, Italy Received 27 February 2002; received in revised form 27 July 2002; accepted 9 September 2002
Abstract We used a molecular genetics approach to investigate the role of nuclear factor-kB (NF-kB) in neointimal hyperplasia induced by flow interruption of carotid artery in mice. Wild type mice (WT mice) and mice rendered deficient in p105, the precursor of p50, one of the components of the multimeric transcription factor NF-kB (NF-kB knockout mice; KO mice), were subjected to a complete ligation of the left common carotid artery. Morphometric analysis of the structural alteration caused by the disruption of the arterial blood flow was performed 14 days after surgery. Furthermore the expression of intercellular adhesion molecule-1 (ICAM-1) in injured arteries was evaluated 4 days after artery ligation by the means of reverse transcriptase polymerase chain reaction (RT-PCR) and quantification of the ICAM-1 protein levels. In a separate experiment normal mice were randomly assigned to receive a recombinant adeno-associated virus (rAAV) encoding the gene for the NF-kB inhibitory protein IkBa (rAAV-IkBa), or the bgalactosidase gene (rAAV-LacZ), both at a dose of 1011 copies and 2 weeks later were subjected to the complete ligation of the left carotid artery. NF-kB activity (studied by means of electrophoretic mobility shift assay */EMSA), IkBa expression (evaluated by Western blot analysis) ICAM-1 evaluation (RT-PCR and quantification of the protein levels) and a morphometric analysis were evaluated in the injured arteries. Disruption of the arterial blood flow caused a marked neointimal hyperplasia. The mean intimal area was 0.0239/0.002 mm2 in wild type mice compared with 0.0029/0.001 mm2 in NF-kB knockout mice. ICAM-1 expression was 1.79/0.8 relative amount of ICAM-1 mRNA in wild type mice compared with 0.49/0.06 relative amount of ICAM-1 mRNA in NFkB knockout mice. ICAM-1 protein levels were also significantly reduced in NF-kB knockout mice. Injured arteries treated with rAAV-IkBa had a greater expression of IkBa and lower NF-kB activity, when compared with vessels treated with rAAV-LacZ. Furthermore, ICAM-1 expression was markedly attenuated by the treatment with rAAV-IkBa (rAAV-LacZ /1.69/0.8 relative amount of ICAM-1 mRNA; rAAV-IkBa/0.559/0.04 relative amount of ICAM-1 mRNA). ICAM-1 protein levels were also significantly decreased in rAAV-IkBa treated mice. Finally the mean intimal area was 0.0289/0.003 mm2 in left carotid arteries treated with rAAV-LacZ whereas it was 0.0039/0.004 mm2 in vessels treated with rAAV-IkBa. Our data indicate that NF-kB plays a crucial role in neointimal hyperplasia induced by flow cessation in the mouse carotid artery, and in addition suggest that rAAVmediated gene transfer of IkBa might represent a novel therapeutic approach to the treatment of restenosis. # 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Nuclear factor-kB knockout mice; Neointimal hyperplasia; IkBa gene transfer; Intercellular adhesion molecule-1
1. Introduction * Corresponding author. Tel.: /39-90-221-3648; fax: /39-90-2213300 E-mail address: [email protected] (F. Squadrito).
Restenosis is one of the major limitations of percutaneous transluminal angioplasty and can be thought of as
0021-9150/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 2 ) 0 0 3 3 6 - 2
234
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
a combination of neointimal formation and arterial remodeling in response to injury. Intimal hyperplasia has been described as the ‘pathological hallmark of restenosis after angioplasty’ [1]; however, it may not be the primary mechanism by which restenosis occurs. Vascular remodeling has also a significant impact on chronic lumen area [2,3] and may be responsible for 50/ 90% of late luminal area loss [4 /7]. Remodeling is an adaptive process that occurs in response to chronic changes in hemodynamic conditions [8] and involves changes in many processes, such as cell growth, cell death, cell migration, and changes in extracellular matrix composition, that lead to a compensatory adjustment in vessel diameter and lumen area. The exact mechanism of arterial neointimal thickening still remains to be fully understood and may involve growth factors, vasoactive agents, inflammatory genes, adhesion molecules and matrix modulators. Nuclear factor-kB (NF-kB) is an early transcription factor which modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response. The prototypic inducible form of NF-kB is an heterodimer composed of NF-kB1 and Rel A, which both belong to the NF-kB/Rel family of proteins. Inactive NF-kB is present in the cytoplasm complexed with the inhibitory protein IkBa. NF-kB is activated by a number of incoming signals from the cell surface. Released from IkBa inhibition, NF-kB translocates into the nucleus and binds to kB motif of the target gene, in turn causing activation of several factors (cell adhesion molecules; cytokines) involved in the inflammatory response [9 /11] It has been suggested that NF-kB activation is involved in arterial response to balloon injury in rats [12 /14]. However, the role of this transcription factor in the vascular injury induced by disruption of carotid artery blood flow in the mouse has not yet been investigated. Interruption of flow caused by ligation of the left common carotid just proximal to the left carotid bifurcation results in a 80% reduction in the lumen area through a combination of intimal hyperplasia together with decreased vessel diameter [15]. This model is a useful tool for studying neointimal hyperplasia. It has the potential to identify molecules contributing to the remodeling process in vivo by studying animals carrying targeted disruption of genes or expressing transgenes. In the present study neointimal lesion formation in wild type mice and in mice rendered deficient in p105 (a precursor of p50, one of the component of the transcription factor NF-kB) was compared to investigate the role of this cytoplasmatic messenger in the mouse model of vascular remodeling. We also investigated the effect of adeno associated virus-mediated IkBa (the inhibitory
protein of NF-kB) delivery on lesion formation induced by interruption of blood flow in the carotid artery.
2. Methods 2.1. Animals All procedures complied with the standards for care and use of animal subjects as stated in the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, National Academy of Sciences, Bethesda, MD). Breeding pairs of NF-kB knockout mice (p105; b6; 129-Nfkb1fm1Bal) and normal control littermate wild type mice (C57Bl/6; 129), both weighing 22/30 g, were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Swiss mice (weighing 20 /25 g) were purchased from Charles River (Varese, Italy). The animals were bred in Messina University School of Medicine Animal Facility. 2.2. Recombinant AAV vectors production Infectious rAAV particles were produced according to the Grimm’s protocol [16]. Briefly, rAAV vectors were generated by cotransfecting 293 cells, seeded on 15 cm dishes, with 15 mg of the vector constructs: pAAV-IkBa or pAAV-LacZ (b-galoctosidase) and 45 mg of the helper plasmid pDG. Twelve hours later, the medium was replaced by fresh medium and 3 days after transfection the medium was collected and the cells harvested by scraping. After three freeze /thaw cycles in dry ice/ethanol bath and 37 8C water bath, the cell lysate was fractionated using ammonium sulfate precipitation. rAAV particles were then purified by CsCl gradient centrifugation in a SW41Ti rotor at 288,000 /g for 36 h. Twelve to sixteen fractions of ten drops each were collected by inserting a G-21 needle below the rAAV band and their refractive index determined. The six fractions with the index closest to 1.3715 (corresponding to a density of 1.40 g/cm3) were dialyzed against PBS at 4 8C overnight and stored at /80 8C. The rAAVs titers were determined by competitive PCR. Samples were tested for IkBa expression by Western blotting using anti-MAD-3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). 2.3. Mouse carotid ligation model In a first experiment wild type mice (C57Bl/6; 129) and NF-kB knockout mice (p105; b6; 129-Nfkb1fm1Bal) were anesthetized by intraperitoneal injection with a solution of xylazine (5 mg/kg) and ketamine (80 mg/kg). The left common carotid artery was exposed through a small midline incision in the neck. The artery was
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
completely ligated just proximal to the carotid bifurcation to disrupt blood flow. In a separate set of experiments Swiss mice were randomized to receive a recombinant adeno-associated virus (rAAV) encoding the gene for the NF-kB inhibitory protein IkBa (rAAV-IkBa), or the b-galactosidase gene (rAAV-LacZ), both at a dose of 1011 copies. The left common carotid artery was exposed through a small midline incision in the neck and injections were done under microscope magnification (to insure the gene delivery into the tunica media) on the external surface of the left common carotid artery, below the carotid bifurcation. Two weeks later these animals were subjected to the complete ligation of the left carotid artery. 2.4. Morphometric analysis Fourteen days after carotid ligation, the mice were anesthetized and perfusion-fixed at a constant pressure (100 mmHg) via the left ventricle with 4% paraformaldehyde in 0.1 mol/l phosphate buffer (pH 7.3). The whole left common carotid artery was excised and placed for 24 h in 4% paraformaldehyde. Vessels where then processed for paraffin embedding. Five serial sections (200 mM apart) of 3-mm thickness were cut, starting from 1 mm below the carotid bifurcation and proceeding to the aortic arch. Sections underwent Hematoxilin and Eosin staining. Morphometric analysis was performed in a blind fashion by use of a dedicated software package (KS300, Zeiss). The lumen, internal elastic lamina (IEL), and external elastic lamina (EEL) were defined, and the intima (tissue between lumen and IEL) and media (tissue between IEL and EEL) areas were recorded. Intima/media area ratios were also calculated. 2.5. RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR) To evaluate the message for the intercellular adhesion molecule-I (ICAM-1), total cellular RNA was extracted from carotid artery specimen harvested from mice sacrificed 4 days after interruption of blood flow in the carotid artery. In brief, approximately 100 mg of tissue was homogenized with 800 ml RNAZOL STAT (Teltest, Firendswood, TX) in a microfuge tube, after which 80 ml chloroform was added. After vortexing and centrifugation, the aqueous phase was transferred to a new microfuge tube containing an equal volume of cold isopropanol and the RNA recovered by precipitation by chilling at /80 8C for 15 min. The pellet was washed with cold ethanol 70%, centrifuged, dried in speed vacuum, centrifuged a second time and then dissolved in 20 ml of buffer. A 2-mg portion of total RNA was subjected to first strand cDNA synthesis in a 20-ml reaction mixture containing the AMV reverse transcrip-
235
tase (Superscript II; BRL USA), each dNTP, the specific primers, Tris /HCl and MgCl2. After dilution of the product with distilled water, 5 ml were used for each polymerase chain reaction (PCR) which contained the Taq polymerase (Perkin Elmer), the buffer as supplied with the enzyme, each dNTP and the specific primers, designed to cross introns and to avoid confusion between mRNA expression and genomic contamination. The following oligonucleotide pairs were used (5? oligo/3? oligo), each sequence as 5? to 3?: ICAM-1: AGGTGGATATCCGGTAGA/CCTTCTAAGTCCT CCAACA and GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.The optimal cycle number for ICAM-1 was 25 and we used a PCR negative and a PCR positive control without cDNA or with a known cDNA, respectively. A portion of the PCR product was electrophoresed and transferred to a nylon membrane which was prehybridized with oligonucleotide probes, radiolabeled with [32P] ATP by a T4 oligonucleotide kinase. After an overnight hybridization at 55 8C, filters underwent autoradiography in a dark-room with a fixed camera. The captured image, sent to an image analysis software (BIO-PROFIL, Celbio, Milan, Italy) was subjected to densitometric analysis. 2.6. Isolation of nuclear and cytoplasmatic proteins To evaluate NF-kB and IkBa, animals were scarified 6 h after carotid artery ligation. The harvested arteries were kept for 5 min in ice-cold 0.9% NaCl containing 0.02 mM butylated hydroxytoluene (BHT) and then stripped of adventitia and frozen in liquid nitrogen. Briefly 40 mg of pulverized carotid samples were homogenized in 0.8 ml ice cold hypotonic buffer [10 mM HEPES pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT); protease inhibitors: 0.5 mM phenyl methylsulfonyl fluoride, aprotinin, pepstatin, leupeptin (10 mg/ml each); and phosphatase inhibitors: 50 mM NAF, 30 mM b-glycerophosphate, 1 mM Na3VO4 and 20 mM r-nitrophenyl phosphate]. The homogenates were centrifuged for 30 s at 2000 rpm at 4 8C to eliminate any unbroken tissues. The supernatants were incubated on ice for 20 min, vortexed for 30 s after addition of 50 ml of 10% Nonidet P-40 and then centrifuged for 1 min at 4 8C in an Eppendorf centrifuge. Supernatants containing cytoplasmatic protein were collected and stored at /80 8C. The pellets after a single wash with the hypotonic buffer without Nonidet P-40, were suspended in an ice-cold hypertonic salt buffer (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitors, and phoshatase inhibitors), incubated on ice for 30 min, mixed frequently, and centrifuged for 15 min at 4 8C. The supernatants were collected as nuclear extracts and
236
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
stored at /80 8C. The concentration of total proteins in the samples was determined by a commercially available protein assay reagent. To estimate possible contamination of the nuclear extracts with the cytoplasmatic extracts, when preparing the nuclear and cytoplasmatic proteins, lactate dehydrogenase (LDH) activity was determined by a commercially available kit for the quantitative kinetic determination of LDH activity (Sigma Chemical, St. Louis, MO). Values were expressed as LDH activity units per milligram of protein. To establish that the nuclear extracts contained mainly nuclear proteins, 40 mg of nuclear protein preparations were subjected to Western blot analysis for histone H3, a nuclear protein, with anti-histone H3 antibody. (Upstate Biotechnology, Lake Placid, NY). 2.7. Electrophoretic Mobility Shift Assay (EMSA) NF-kB binding activity was performed in a 15-ml binding reaction mixture containing 1% binding buffer [50 mg/ml of double-stranded poly(dI-dC), 10 mM Tris HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 1 mM MgCl2, and 10% glycerol], 15 mg of nuclear proteins, and 35 fmol (50,000 cpm, Cherenkov counting) of double-stranded NF-kB consensus oligonucleotide (5?-AGT TGA GGG GAC TTT CCC AGG C-8?; Promega, Madison, WI) which was end-labeled with [g32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Life Sciences, Arlington Heights, IL) using T4 polynucleotide kinase. The binding reaction mixture was incubated at room temperature for 20 min and analyzed by electrophoresis on 5% non-denaturing polyacrylamide gels. After electrophoresis, the gels were dried using a gel-drier and exposed to Kodak X-ray films at /70 8C. The binding bands were quantified by scanning densitometry of a bio-image analysis system (Bio-Profil Celbio, Milan, Italy). The results for each time point from each group were expressed as relative integrated intensity compared with the uninjured carotid arteries measured in the same batch because the integrated intensity of group samples from different EMSA batches would be affected by the half-life of the isotope, exposure time, and background levels. 2.8. Western blot analysis of IkBa in cytoplasm Cytoplasmatic proteins (20 mg) from each sample were mixed with 2 /SDS sample buffer [62 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 5% b-mercaptoethanol, 0.003% bromophenol blue], heated at 95 8C for 5 min, and separated by SDS /polyacrylamide gel electrophoresis. After electrophoresis on 12.5% polyacrylamide gels, the separated proteins were transferred from the gels into Hybond electrochemiluminiscence membranes
(Amersham) using a Bio-Rad semidry transfer system (Bio-Rad) for 2 h. The membranes were blocked with 5% not-fat dry milk in TBS /0.05% Tween for 1 h at room temperature, washed three times for 10 min each in TBS /0.05% Tween 20, and incubated with a primary IkBa antibody (Santa Cruz Biotechnology) in TBS / 0.05% Tween 20 containing 5% not-fat dry milk for 1 /2 h at room temperature. After being washed three times for 10 min each in TBS /0.05% Tween 20, the membranes were incubated with a second antibody peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma) for 1 h at room temperature. After washing, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacturer’s protocol (Amersham). The IkBa protein signal was quantified by scanning densitometry using a bio-image analysis system (BIO-PROFIL Celbio, Milan Italy). The results from each experimental group were expressed as relative integrated intensity compared with uninjured arteries measured in the same batch. 2.9. Quantification of ICAM-1 protein levels Mice were sacrificed 4 days after interruption of blood flow in the carotid artery. The carotid tissue was thawed, placed in complete lysis buffer (Boehringer Mannheim, Indianapoli, IN) homogenized with a handheld homogenizer and sonicated for 10 s. The homogenate was centrifuged at 10,000 /g for 5 min, and the supernatant and sediment fraction were separated. Quantification of ICAM-1 was normalized to total protein in the sample. Total protein determination was performed using a modified Bradford assay with serial dilutions of bovine serum albumin. ICAM-1 levels were quantified in the cell homogenate using a direct ELISA method. In brief, 25 ml of the carotid tissue homogenate or Ag-specific blocking peptide (for mouse ICAM-1) as standards (serial dilutions from 0.001 to 20 ng/ml; Santa Cruz Biotechnology) was mixed with coating buffer, added in duplicate, and incubated overnight at 0 8C. The plates were washed three times with PBS and blocked with 2% BSA in PBS for 60 min at 37 8C. After further washing, 50 ml of Ab to ICAM-1 (2 mg/ml: Santa Cruz Biotechnology) was added and incubated for 60 min at 37 8C. After washing three times with PBS, a goat anti-rabbit peroxidase conjugate secondary Ab (1/200 dilution; Santa Cruz Biotechnology) was added and incubated for 45 min at 37 8C. The plates were again washed and incubated for 45 min at 37 8C. The plates were again washed and the substrate TMB (3,3?, 5,5?-tetramethylbenzidine) was added for color development. Finally the reaction was quenched using 100 ml of 1 M H2PO4. The sensitivity was 10 pg/ml and negligible background sensitivity was found when testing the secondary Ab against the absorbed Ags.
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
237
2.10. Statistical analysis Data are expressed as means9/S.D. The difference between the means of two groups was evaluated with an ANOVA followed by Bonferroni’s test and was considered significant when P B/0.05.
3. Results 3.1. Comparison of lesion formation in normal and KO mice Intimal areas for NF-kB knockout mice (KO) were significantly less than for wild type (WT mice) (Fig. 1). The mean intimal area was 0.0239/0.002 mm2 in wild type mice whereas was 0.0029/0.001 mm2 in KO mice. This decrease of neointima formation in knockout mice was confirmed by comparison of intima-to-media ratios (0.0499/0.034 for KO mice versus 0.8359/0.122 for wild type mice; P B/0.005). 3.2. ICAM-1 mRNA expression in injured carotid arteries of normal mice and KO mice
Fig. 2. (A) ICAM-1 mRNA expression in uninjured and injured arteries of wild type (WT) and NF-kB knockout (KO) mice. This figure shows representative autoradiograms highlighting ICAM-1 expression and depicts also quantitative data indicating relative amount of ICAM-1 mRNA in right (RA) and left (LA) carotid arteries of both wild type (WT) and NF-kB knockout mice (KO). Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. wild type mice. (B) ICAM-1 protein levels in uninjured and injured arteries of wild type (WT) and NF-kB knockout (KO) mice. Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. wild type mice.
Fig. 2A shows representative autoradiograms highlighting ICAM-1 mRNA expression in wild type and
Fig. 1. Average intimal area for wild type (n/15; WT) and NF-kB knockout (n/15; KO) mice. Average intimal area was calculated for ten histological sections per animal. *P B/0.001 vs. wild type mice.
238
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
KO mice 4 days after carotid artery ligation. Fig. 2A also depicts quantitative data and indicates relative amounts of ICAM-1 in the same groups of animals. ICAM-1 expression was markedly elevated in the injured artery of wild type mice (Fig. 2). Animals deficient in NF-kB had a reduced mRNA expression for the adhesion molecule in the injured left carotid artery. Both strains of mice did not show significant change in the expression of ICAM-1 in the uninjured right carotid arteries. Fig. 2B indicates ICAM-1 protein levels in injured and uninjured carotid arteries of wild type and KO mice. The evaluation of ICAM-1 levels was carried out as a read-out of the mRNA experiments. Elevated ICAM-1 levels were present in the injured artery of wild type animals. In contrast animals deficient in NF-kB showed a decreased levels of ICAM-1 levels.
3.3. Transgene expression of rAAV-IkBa in mouse carotid In a effort to determine the efficiency of rAAV-IkBa expression in mouse carotid artery, animals were treated with rAAV-LacZ or rAAV-IkBa. A Western blot performed 2 weeks after the treatment with an antibody reacting with IkBa showed and enhanced expression of the inhibitory protein (Fig. 3).
Fig. 3. Western blot analysis of IkBa protein. Vessels were stripped of adventizia. Arteries were transduced with rAAV-IkBa or rAAV-LacZ and analysis was performed 2 weeks after treatment. High level expression of IkBa is detectable. Bars represent the mean9/S.D. of 15 experiments. *P B/0.01 vs. rAAV-LacZ.
3.4. Increased transgene expression of IkBa and blunted NF-kB activation in injured carotid arteries following treatment with rAAV-IkBa In the injured left arteries of mice treated with the rAAV-LacZ IkBa was markedly reduced, indicating a strong degradation of this protein (Fig. 4). In contrast there was a higher expression of the inhibitory protein (studied 6 h after surgery) in the ligated carotid arteries treated with rAAV-IkBa compared with vessels treated with rAAV-LacZ (Fig. 4). NF-kB nuclear binding was significantly enhanced in the injured arteries treated with the rAAV-LacZ (Fig. 5). By contrast NF-kB binding activity was markedly suppressed in the injured carotid arteries treated with the rAAV-mediated gene transfer of IkBa (Fig. 5). 3.5. ICAM-1 mRNA expression in injured carotid arteries subjected to the rAAV-mediated gene transfer of IkBa The top of Fig. 6A shows representative autoradiograms highlighting ICAM-1 mRNA expression in carotid arteries treated either with rAAV-LacZ or rAAV-IkBa, 4 days after ligation. The bottom of Fig. 6A depicts quantitative data and indicates relative amounts of ICAM-1 in the same groups. ICAM-1 expression was markedly elevated in the injured arteries given with the gene encoding the bgaloctosidase (Fig. 6A). Injured arteries subjected to the rAAV-mediated gene transfer of IkBa had a reduced mRNA expression for the adhesion molecule. ICAM-1 protein levels were markedly enhanced in injured artery treated with rAAV-LacZ (Fig. 6B).
Fig. 4. Western blot analysis of IkBa protein levels in the cytoplasm of carotid arteries. Samples were right uninjured carotid arteries and left ligated carotid arteries treated with rAAV-LacZ or rAAV-IkBa. The top of the figure shows representative autoradiograms highlighting IkBa protein levels. The bottom of the figure shows quantitative data and indicates integrated intensity of IkBa protein levels. Bars represent the mean9/S.D of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
239
3.6. Lesion formation in mice subjected to the rAAVmediated gene transfer of IkBa
Fig. 5. EMSA of NF-kB in carotid arteries. Samples were right uninjured carotid arteries and left ligated carotid arteries treated with rAAV-LacZ or rAAV-IkBa. The top of the figure shows representative EMSA picture highlighting NF-kB binding activity. The bottom of the figure shows quantitative data and indicates integrated intensity of NF-kB binding activity. Bars represent the mean9/S.D of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
Injured artery treated with rAAV-IkBa showed a marked reduction in ICAM-1 protein levels.
Fig. 6. (A) ICAM-1 mRNA expression in uninjured and injured arteries treated with rAAV-LacZ or rAAV-IkBa. Figure shows representative autoradiograms highlighting ICAM-1 expression and depicts also quantitative data indicating relative amount of ICAM-1 mRNA in right and left carotid arteries. Bars represent the mean9/ S.D. of 15 experiments. *P B/0.02 vs. rAAV-LacZ. (B) ICAM-1 protein leveles in un-injured and injured arteries treated with rAAVLacZ or rAAV-IkBa. Bars represent the mean9/S.D. of 15 experiments. *P B/0.05 vs. rAAV-LacZ.
Intimal areas of rAAV-IkBa-treated animals were smaller than those of mice administered with rAAVLacZ (Fig. 7). The mean intimal area for rAAV-IkBatreated mice was 0.0039/0.004 mm2 in vessels treated with rAAV-IkBa, whereas it was 0.0289/0.002 mm2 in left carotid arteries treated with rAAV-LacZ. The decrease in neointima formation in animals subjected to IkBa gene transfer was confirmed by comparison of intima-to-media ratios (0.1079/0.033 for rAAV-IkBa treated mice versus 0.7259/0.129 for mice administered with rAAV-LacZ).
4. Discussion Coronary restenosis remains a complex pathophysiological problem that continues to defy preventive pharmacological therapy. Restenosis results from a combination of negative remodeling (reduction in the area within the external elastic lamina) and intimal growth (by smooth muscle cell proliferation and extracellular deposition) [17]. Indeed balloon dilation of arteries in animal models
Fig. 7. Average intimal area (for ligated left carotid arteries treated with rAAV-LacZ (n/15) or rAAV-IkBa (n/15). Average intimal area was calculated for ten histological sections per animal. *P B/0.001 vs rAAV-LacZ.
240
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
makes it possible to study the neointimal hyperplasia at different time points, but, under these experimental conditions, hyperplasia occurs next to other processes like inflammation and proliferation. By contrast, during arterial remodeling following a change in blood flow no inflammation occurs, which makes this a relative ‘clean’ model to detect the molecular mechanism specifically involved in neointimal hyperplasia. Interruption of blood flow in the mouse left carotid artery is a murine model of neointimal hyperplasia in which a disruption of the flow field is created in the left common carotid artery [18]. During the time that these animals are allowed to recover, these altered shear stress conditions cause the vessel to ‘remodel’ and shrink in luminal area because of reduction in vessel diameter and neointima formation. Furthermore this model has the potential to allow the identification and investigation of appropriate molecular targets by studying mice carrying targeted disruption of genes (knockout mice) or expressing transgenes. The present experimental model may have also some limitations: ligation of the carotid artery may not mimic a physiological situation since there is a loss of blood flow, and vascular lesions in humans often develop at sites of altered hemodynamic associated with absent or low shear stress. NF-kB is an early transcription factor that modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response. The most studied NF-kB complex is composed of p50 and p65 subunits [19,20]. Other complexes of the five protein subunits, p65, p50, c-rel, relB and p52 have also been described and result in numerous homo-and heterodimeric combinations of NF-kB/rel proteins [21]. Inactive NF-kB is present in the cytoplasm complexed with the inhibitory protein IkBa. Subunit p50, synthesized as a 105 kDA precursor protein has a strong capacity for binding to kB motifs. Subunit p65 has the capacity for strong transactivation of the genes and is able to bind the inhibitory subunit IkBa. NF-kB is activated by a variety of cytokines, endotoxin and oxidative stress. Upon activation NF-kB dissociates from its inhibitor IkBa, translocates to the nucleus and initiates transcription of various genes, cytokines, growth and differentiation factors. To the best of our knowledge no study has been already carried out on the role of NF-kB in the ‘in vivo’ neointimal hyperplasia induced by interruption of blood flow in the carotid artery. In the present study we investigated the involvement of this early transcription factor by using a molecular genetics approach. Animals rendered deficient for expression of p105, a precursor of one of the subunits of NF-kB, and specifically p50, manifest a number of immunological defects due to a reduced NF-kB activation and functionality [22].
In the present experiment the neointimal hyperplasia was reduced in NF-kB knockout mice compared with normal mice. This finding suggests that the p50/p65 heterodimer is essential to trigger the cascade of events leading to the full development of the proliferation process induced by flow alteration and that other p65 homo/heterodimers do not substitute for the p50/p65 heterodimer in the neointimal hyperplasia caused by cessation of flow in the left carotid artery. Constitutive expression of NF-kB seems to be of vital importance for the normal growth and proliferation of vascular smooth muscle cells in vitro [23]. However, NFkB deficient mice do not show significant difference in vessel architecture compared to the normal animals. This finding would indicate that p50/65 homodimers may substitute (in contrast with the observed key role of p50/p65 in vascular remodeling) for p50/p65 heterodimers as transactivators during the physiological and normal growth and proliferation of vascular smooth muscle cells. Besides smooth muscle cell NF-kB, an impaired endothelial NF-kB activation may also have a role in determining the blunted proliferation process in NF-kB deficient mice: in fact it has been shown that the p50/p65 heterodimer plays an important role in the initiation of the atherosclerotic lesion [24]. NF-kB may use several mechanism(s) to cause neointimal hyperplasia. A mechanism may be the regulation of the expression of vascular adhesion molecules. Human fetal aorta contains numerous smooth muscle cells that express intercellular adhesion molecule-1 (ICAM-1). ICAM-1 disappears form the adult medial smooth muscle cells but reappears in smooth muscle cells during the development of atherosclerotic plaques [25]. Furthermore in experimental vascular injury neointimal smooth muscle cells also express ICAM-1 [26]. In agreement with this finding, carotid arteries harvested 4 days after artery ligation showed a marked expression of ICAM-1. ICAM-1 expression was markedly blunted in NF-kB knockout mice. This experimental evidence led us to hypothesize that hyperplasia induced by flow cessation in the left carotid artery activates NF-kB that in turn triggers the gene for ICAM-1. This adhesion molecule may represent at least one of the ‘proliferating’ adhesive molecules involved in smooth muscle cells proliferation. In agreement with our hypothesis, it has been shown that ICAM-1 antibodies exert inhibitory effect on neointimal thickening following balloon injury [27]. Collectively, these data strongly support a key role of the early transcription factor NFkB in the development of neointimal hyperplasia induced by alteration and disturbance in blood flow. Regulation of NF-kB occurs through complex formation of the heterodimer with the cytoplasmatic inhibitor IkBa. IkBa retains the p50/p65 complex in the cytoplasm by masking it nuclear localization se-
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
quence [28]. In addition to retaining NF-kB in the cytoplasm, a second function has been demonstrated for IkBa: it can prevent in vitro DNA binding of NF-kB, namely of the p50/p65 heterodimer [29]. Taking advantage of this physiological regulation of the early transcription factor, an alternative approach to study the role of NF-kB is the blockade of its activation by the transgene over-expression of its inhibitory protein IkBa. This approach may also be important to verify the potential of a gene therapy aimed at over-expressing the IkBa protein for the treatment of neointimal hyperplasia. Among the novel strategies that hold promise for therapeutic gene therapy applications is the use of vectors based on the adeno-associated virus (AAV). These vectors are derived from a non pathogenic and widespread defective parvovirus and are able to transduce both dividing and non dividing cells in a variety of tissue including smooth muscle cells [30]. Since recombinant AAV (rAAV) vectors are devoid of any viral genes (which are expressed in trans for the packaging process) they elicit virtually no inflammatory or immune response in the sites of injections [31,32]. We therefore explored the potential of rAAV mediated gene delivery of IkBa in the mouse carotid on NF-kB activation and neointimal hyperplasia induced by flow interruption. rAAV-IkBa expression in mouse carotid artery, was highly efficient. A Western blot performed after the treatment with an antibody reacting with IkBa showed an enhanced expression of the inhibitory protein. These experiments were performed after the adventitia was stripped out. Furthermore, the rAAV vector shows an exquisite tropism for the smooth muscle cells as described previously [30]. These findings, taken together, indicate that enhanced IkBa expression occurred in the smooth muscle cells of tunica media layer. Carotid artery treated with control vector (rAAVLacZ) showed a marked nuclear binding of NF-kB, reduced expression of the inhibitory protein IkBa, and enhanced expression of the adhesive molecule ICAM-1. AAV-mediated gene delivery of IkBa enhanced significantly the expression of the inhibitory protein, reduced NF-kB and blunted ICAM-1 expression. Furthermore, rAAV-IkBa administration halted significantly the proliferation process induced by flow cessation in the carotid artery. These data further stress the concept that NF-kB plays a crucial role in the neointimal hyperplasia induced by carotid artery ligation. In addition our findings suggest that recombinant AAV-mediated gene transfer of IkBa might represent a novel and promising therapeutic strategy for the clinical treatment of vascular restenosis.
241
References [1] Marmur JD, Merlini PA, Sharma SK, et al. Thrombin generation in human coronary arteries after percutaneous transluminal balloon angioplasty. J Am Coll Cardiol 1994;24:1484 /91. [2] Kakuta T, Currier JW, Haudenschild CC, Ryan TJ, Faxon DP. Differences in compensatory vessel enlargement, not in intimal formation, account for restenosis after angioplasty in the hypercholesterolemic rabbit model. Circulation 1994;89:2809 /15. [3] Currier JW, Faxon DP. Restenosis after percutaneous traansluminal coronary angioplasty, have we been aiming at the wrong target? J Am Coll Cardiol 1995;25:516 /20. [4] Post MJ, Borst C, Kuntz RE. The relative importance of arterial remodeling compared with intimal hyperplasia in lumen renarrowing after balloon angioplasty: a study in the normal rabbit and in the hypercholestolemic Yucatan micropig. Circ Am J Cardiol 1994;89:2816 /21. [5] Mintz GS, Pichard AD, Kent KM, Satler LF, Popma JJ, Leon MB. Intravascular ultrasound comparison of restenotic and de novo coronary artery narrowing. Am J Cardiol 1994;74:1278 /80. [6] Wilensky RL, March KL, Gradus-Pizlo I, Sandusky G, Fineberg N, Hathaway DR. Vascular injury, repair, and restenosis after percutaneous transluminal angioplasty in the atherosclerotic rabbit. Circulation 1995;92:2995 /3005. [7] Andersen HR, Maeng M, Thorwest M, Falk E. Remodelling rather than neointimal formation explains luminal narrowing after deep vessel wall injury: insights from a porcine coronary (re)stenosis model. Circulation 1996;93:1716 /24. [8] Glagov S. Intimal hyperplasia, vascular remodeling, and the restenosis problem. Circulation 1994;89:2888 /91. [9] Ghosh S, May MJ, Kopp EB. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 1998;16:225 /60. [10] Gius D, Botero A, Shah S, Curry HA. Intracellular oxidation/ reduction status in the regulation of transcription factor NFkappa B and AP-1. Toxicol Lett 1999;106:93 /106. [11] Lee J, Burckart GJ. Nuclear factor kappa B: important transcription factor and therapeutic target. J Clin Pharmacol 1998;38:981 / 93. [12] Cercek B, Yamashita M, Dimayuga P, et al. Nuclear factorkappaB activity and arterial response to balloon injury. Atherosclerosis 1997;131:59 /66. [13] Lindner V. The NF-kappaB and Ikappa B system in injured arteries. Pathobiology 1998;66:311 /20. [14] Landry DB, Couper LL, Bryoant SR, Lindner V. Activation of the NF-kappa B and I kappa B system in smooth muscle cells after rat arterial injury. Induction of vascular adhesion molecule-1 and monocyte chemoattractant protein-1. Am J Pathol 1997;151:1085 /95. [15] Bryant SR, Bjercke RJ, Erichesen DA, Rege A, Lindner V. Vascular remodeling in response to altered blood flow is mediated by fibroblast growth factor-2. Circ Res 1999;84:323 /8. [16] Grimm D, Kern A, Rittner K, Kleinschmidt JA. Novel tools for production and purification of recombinant adeno-associated virus vectors. Hum Gene Ther 1998;9:2745 /60. [17] Kimura T, Kaburagy S, Tamura T, et al. Remodeling of human coronary arteries undergoing coronary angioplasty or artherectomy. Circulation 1997;96:475 /83. [18] Kumar A, Lindner V. Remodeling with neointima formation in the mouse carotid artery after cessation of blood flow. Arterioscler Thromb Vasc Biol 1997;17:2238 /44. [19] Grimm S, Baeuerle PA. The inducible transcription factor NFkB: structure /function relationship of its protein subunits. Biochem J 1993;290:297 /308.
242
F. Squadrito et al. / Atherosclerosis 166 (2003) 233 /242
[20] Naumann M, Scheidereit C. Activation of NF-kB in vivo is regulated by multiple phosphorylations. EMBO J 1994;13:4597 / 603. [21] Baldwin AS. The NF-kB and IkB proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649 /81. [22] Cronsten BN, Montesinos CM, Weissmann G. Salicylates and sulfasalazine, but not glucocorticoids, inhibit leukocyte accumulation by an adenosine-dependent mechanism that is independent of inhibition of prostaglandin synthesis and p105 of NFkB. Proc Natl Acad Sci USA 1999;96:6377 /81. [23] Bellas RE, Lee JS, Sonnenshein GE. Expression of a constitutive NF-kB-like activity is essential for the proliferation of cultured bovine smooth muscle cells. J Clin Invest 1995;96:2521 /7. [24] Collins T. Endothelial nuclear factor-kB and the initiation of atherosclerotic lesion. Lab Invest 1993;68:499 /508. [25] Couffinhal T, Duplaa C, Labat L, Lamaziere JMD, Moreau C, Printseva O, Bonnet J. Tumor necrosis factor-a stimulates ICAM1 expression in human vascular smooth muscle cells. Arterioscler Thromb 1993;13:407 /14. [26] Tanaka H, Sukhova GK, Swanson SJ, Clinton SK, Ganz P, Cybulski MI, Libby P. Sustained activation of vascular cells and
[27]
[28]
[29]
[30] [31]
[32]
leukocytes in the rabbit aorta after ballon injury. Circulation 1993;88:1788 /803. Yasukava H, Imaizumi T, Matsoka H, Nakashima A, Kohno K, Miyamoto T, Motimatsu M. Inhibition of intimal hyperplasia after balloon injury by antibodies to ICAM-1 (CD54) and LFA-1 (CD11a/CD18). Circulation 1995;92:1 /9. Zabel U, Henkel T, Dos Santos Silva M, Baeuerle PA. Nuclear uptake control of NF-kB by MAD-3 and IkB protein present in the nucleus. EMBO J 1993;12:201 /11. Brown K, Park S, Kanno T, Franzoso G, Sienbelist U. Mutual regulation of the transcriptional activator NF-kB and its inhibitor, IkB-a. Proc Natl Acad Sci USA 1993;90:2532 /6. Monahan PE, Samulski RJ. AAV vectors: is clinical success on the horizon? Gene Ther 2000;7:24 /30. Kay MA, Manno CS, Ragni MV, et al. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector. Nat Genet 2000;24:257 /61. Chirmule M, Propert K, magosin S, Qian Y, Qian R, Wilson J. Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther 1999;6:1574 /83.