- Email: [email protected]
VCAM-1 siRNA reduces neointimal formation after surgical mechanical injury of the rat carotid artery
VCAM-1 siRNA reduces neointimal formation after surgical mechanical injury of the rat carotid artery Yanming Qu, MD,a Xiangen Shi, MD,a Hongwei Zhang, MD,b Wei Sun, MD,a Song Han, MD,c Chunjiang Yu, MD,a and Junfa Li, MD, PhD,c Beijing, PR China Objective: Restenosis is one of several complications following carotid endarterectomy (CEA). The pathogenesis of restenosis may be related to postsurgery inflammation and leukocyte recruitment mediated by cellular adhesion molecules. In this study, we examine the role of vascular cell adhesion molecule-1 (VCAM-1) in carotid neointimal hyperplasia following carotid surgical mechanical de-endothelialization (CSMDE) in a rat model of CEA. Methods: The inhibition of siRNA on VCAM-1 protein expression was determined by using the methods of immunostaining and Western blot. Ultrasound imaging and morphometric analysis were applied to measure the degree of CSMDE-induced carotid artery neointimal hyperplasia of rats. Results: We found that a lentivirus-based construct expressing a small interfering RNA (siRNA) against VCAM-1 could effectively (P < .05, n ⴝ 10 per group) reduce VCAM-1 protein expression in the carotid arteries of rats undergoing CSMDE (CSMDEⴙRNAi: 135.0 ⴞ 27.6%) when compared that of CSMDE with scrambled siRNA (CSMDEⴙCON: 182.7 ⴞ 36.4%). Doppler ultrasonography revealed that CSMDEⴙRNAi was accompanied by a significant reduction in the extent of stenosis demonstrated by increased blood velocity (665.85 ⴞ 48.37 mm/s) and linear diameter (0.59 ⴞ 0.77 mm) compared to CSMDEⴙCON (46.72 ⴞ 28.67 mm/s with undetectable linear diameter, P < .05, n ⴝ 10 per group). In addition, morphometric analysis of hematoxylin and eosin (HE)-stained sections indicated that the intima (innermost layer of media at lesion site)/media area ratio (I/M) was significantly increased (P < .05, n ⴝ 10 per group) both in the CSMDE (3.99 ⴞ 0.65) and CSMDEⴙCON (4.33 ⴞ 0.59) groups compared with the SHAM group (0.35 ⴞ 0.13). However, CSMDEⴙRNAi resulted in a significant (P < .05, n ⴝ 10 per group) decrease in the I/M ratio (1.79 ⴞ 0.43) compared to CSMDEⴙCON, whereas there were no significant differences in the total arterial area and medial areas among the groups. Conclusion: These results suggest that perivascular events mediated by VCAM-1 are likely to play an important role in the pathogenesis of carotid artery neointimal hyperplasia in rats after CSMDE. ( J Vasc Surg 2009;50:1452-8.) Clinical Relevance: Carotid endarterectomy (CEA) is an effective treatment for carotid artery atherosclerotic disease, but there can be complications such as the development of intimal hyperplasia. Post-CEA restenosis is a multifactorial process initiated by vessel injury and inflammatory reactions. The results of this study support the notion that perivascular events mediated by vascular cell adhesion molecule-1 (VCAM-1) are likely to play an important role in the pathogenesis of neointimal hyperplasia in rats following carotid surgical mechanical de-endothelialization, and VCAM-1 siRNA may be used by local delivery during CEA operation to reduce restenosis.
Carotid atherosclerotic stenosis is a major risk factor for stroke.1 Carotid endarterectomy (CEA) has proved to be a very effective surgical procedure for treating patients with severe (70%-99%) carotid stenosis.2,3 However, carotid From the Department of Neurosurgery, Capital Medical University Affiliated Fu Xing Hospital,a Department of Neurosurgery, Brain Sciences Institute of Beijing,b and Department of Neurobiology and Beijing Institute for Neuroscience, Capital Medical University.c Supported by the following grants: National Natural Science Foundation of China (30571902, 30670782, and 30871219), Beijing Natural Science Foundation (5072008), Key Scientific Developing Programs of Beijing Municipal Commission of Education (KZ200810025012), Beijing Municipal Programs for Hundred-Thousand-Ten Thousand Excellent Talents of New Century (Li J), and Funding Projects for Academic Human Resources Development in Institutions of Higher Learning under the Jurisdiction of Beijing Municipality (PHR200906116). Competition of interest: none. Reprint requests: Junfa Li, MD, PhD, Department of Neurobiology and Beijing Institute for Neuroscience, Capital Medical University, No. 10 You An Men Wai Xi Tou Tiao, Beijing 100069, China (e-mail: junfali@ ccmu.edu.cn) and Chunjiang Yu, MD, Department of Neurosurgery, Capital Medical University Affiliated Fu Xing Hospital, No. 20 Fu Xing Men Wai Street, Beijing 100038, China (e-mail: [email protected]). The editors and reviewers of this article have no relevant financial relationships to disclose per the JVS policy that requires reviewers to decline review of any manuscript for which they may have a competition of interest. 0741-5214/$36.00 Copyright © 2009 by the Society for Vascular Surgery. doi:10.1016/j.jvs.2009.08.050
1452
artery restenosis following surgery is a common complication; this limits the efficacy of CEA in stroke prevention.1 A proposed paradigm for carotid artery restenosis, based on the vascular biology of wound healing, suggests that the restenosis takes place in three phases comprising an inflammatory phase, a proliferative phase, and a remodeling phase.4 The early phase involves the recruitment of inflammatory cells from the circulation; this process is mediated by cell adhesion molecules (CAM). Human genetic studies and work in animal models both support the contention that CAM plays an important role in the pathogenesis of restenosis.5-7 Vascular cell adhesion molecule-1 (VCAM-1) is a member of the CAM superfamily expressed by endothelial cells and by cytokine-stimulated smooth muscle cells and mediates leukocyte recruitment during inflammation.8-10 VCAM-1 is thought to interact with integrin ␣41 at the surface of leukocytes to trigger intracellular signal transduction pathways.11 The potential role of VCAM-1 in restenosis has been investigated previously: monoclonal antibody blockade of VCAM-1 in an animal model was found to reduce neointimal formation post-CEA.12 In vivo studies on the role of VCAM-1 in restenosis have been limited because the VCAM-1 gene knockout in mice causes embryonic lethality. In the present study, we instead used a
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
lentivirus-based small interfering RNA (siRNA) to downregulate VCAM-1 expression in rats undergoing carotid surgical mechanical de-endothelialization (CSMDE) to mimic CEA. siRNA techniques afford a novel approach for manipulating VCAM-1 expression in vivo and may provide insights for the management of carotid restenosis postCEA. MATERIALS AND METHODS Proteinase inhibitors, phosphatase inhibitors, dithiothreitol (DTT), Nonidet P-40, ethylenediamine tetraacetic acid (EDTA), ethyleneglycol tetraacetic acid (EGTA), sodium dodecyl sulfate (SDS), and other standard reagents were from Sigma-Aldrich (St. Louis, Mo). Protein assay reagents, horseradish peroxidase-conjugated goat antirabbit IgG and goat anti-mouse IgG were purchased from Bio-Rad Company (Hercules, Calif). Antibody against -actin was from Sigma-Aldrich. Lentivirus-based VCAM-1 siRNA construction. Four target sequences are selected from the previously published rat VCAM-1 mRNA sequence (NM_012889). Each sequence is 19 nt in length. The sequences were selected to ensure that the GC content was ⬃30% to 50% and there were no contiguous sequences of more than four adenines or thymidines. The sequences were blast-searched against rat expressed sequence tags (EST) libraries to ensure that they are not homologous to other sequences. The most favorable of the siRNA sequences was ⫹1718CTGCAGCCTCTTTCTCAAA⫹ 1738. The short hairpin RNA (shRNA) sequence (5’CTGCAGCCTCTTTCTCAAATTCAAGAGATTTGAGAAAGAGGCTGCA G-3’) was based on this siRNA sequence. These were annealed and cloned into the pGCLGFP entry vector between Hpa I and Xho I sites. The sequence of the scrambled siRNA was 5’-TTCTCCGAACGTGTCACGT-3’. Lentivirus stocks were prepared according to a previously described 3-plasmid transfection lentivirus preparation protocol.13 Briefly, confluent HK293 cells were cotransfected with pGCL-GFP, pHelper1.0, and the lentiviral helper plasmid pHelper2.0. The crude viral lysate was purified by two-tier CsCl centrifugation. The final titer of lentivirus was prepared as 6 ⫻ 108 TU/mL. The lentiviral package system was provided by the Institute of Virology, Chinese Academy of Medical Sciences (Beijing, China). Preparation of carotid surgical mechanical deendothelialization (CSMDE) in a rat model. The animal protocol was approved by the Animal Care and Use Committee of Capital Medical University and is consistent with the NIH Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23). Male SpragueDawley rats (aged 6-7 weeks, 250-300 g) were initially housed in a temperature- and light-controlled room (2124oC; 12:12 hours light:dark cycle) with free access to food and water. Animals were randomized into carotid surgical mechanical de-endothelialization (CSMDE, n ⫽ 30), sham CSMDE operation (SHAM, n ⫽ 30), CSMDE treated with scrambled siRNA (CSMDE⫹CON, n ⫽ 30), and CSMDE treated with VCAM-1 siRNA (CSMDE⫹RNAi, n ⫽ 30)
Qu et al 1453
groups. Left carotid arteries of untreated rats were used as controls for molecular biological analysis. CSMDE was performed as previously reported to mimic CEA.14 Briefly, animals were anesthetized with trichloroacetaldehyde monohydrate (200 mg/kg, ip). After exposure of the right common carotid artery, Yasargil clamps were applied proximal and distal to the bifurcation (10.0 mm apart). Arteriotomy was performed using a corneal blade, and the endothelial cell layer and the inner portion of the media were carefully removed with a burr tip. The arteriotomy was closed with a running 10-0 monofilament nylon suture thread. For the group treated with lentiviral constructs, a polypropylene catheter was introduced into the common carotid artery through the external carotid artery. A 100-L volume of lentiviral constructs with scrambled siRNA (6 ⫻ 108 TU/mL) or VCAM-1 siRNA (6 ⫻ 108 TU/mL) was instilled as a static application in the isolated injury segment of the carotid artery over 120 minutes. During the procedure, the cell culture medium (DMEM⫹10% FBS, 37oC) was used to infuse the isolated vessel. The catheter was withdrawn, followed by the ligation of the external carotid artery. After the clamps were removed, the common carotid artery was examined to confirm that surgery had been successful. The superficial muscle layer was closed with a running 4-0 absorbable suture, and the section was closed. Rats in the sham operation group received carotid arteriotomy and suture without endothelial denudation. Animals were sacrificed with an overdose of pentobarbital (200 mg/kg, ip) 2 weeks postsurgery; sections of targeted carotid artery were dissected and embedded in optimal cutting temperature (OCT) compound for morphometric analysis or frozen in liquid nitrogen for Western blot analysis. Western blot analysis. As described previously,15 frozen samples of carotid artery sections were homogenized at 4oC in homogenizing buffer (50 mM Tris.HCl pH 7.5 containing 2 mM dithiothreitol, 2 mM EDTA, 2 mM EGTA, 5 mg/mL each of leupeptin, aprotinin, pepstatin A, and chymostatin, 50 mM KF, 50 nM okadaic acid, 5 mM sodium pyrophosphate, 1 mM orthovanadate, and 2% SDS) and sonicated to obtain complete dissolution. Protein concentrations were determined using a commercial BCA kit (Pierce Company, Upland, Ind). Expression of green fluorescent protein (GFP) and VCAM-1 was analyzed by SDS-PAGE and Western blotting as previously reported.16,17 Briefly, homogenate samples containing 30 g of protein were resolved on an 8% SDS-PAGE gel. Gels were electrotransferred to nitrocellulose membranes (NC membrane; Bio-Rad) at 4oC, 400 mA for 4 hours. Membranes were washed for 10 minutes with TTBS (20 mM Tris.HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20) followed by blocking with 10% nonfat milk in TTBS for 1 hour. Blocked membranes were first incubated with rabbit polyclonal antibody against VCAM-1 (1:1000 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif) or a rabbit
1454 Qu et al
JOURNAL OF VASCULAR SURGERY December 2009
Fig 1. Lentivirus-based VCAM-1 siRNA transfection in carotid arteries of rats following CSMDE. Representative images showing no detectable green fluorescence in normal (CON, A) animals but pronounced fluorescence in the neointima of carotid arteries after transfection with lentiviral constructs co-expressing GFP (TRNAS, B); C, Western blotting of carotid arterial homogenates showing the expression of GFP (27 kDa) and -actin (42 kDa) in CON and TRANS animals; D, Quantitative analysis of Western blot signals shows that GFP expression levels increased significantly in carotid arterial homogenates from TRANS animals (*P ⬍ .05 vs CON, n ⫽ 6 per group).
polyclonal antibody against GFP (1:1000; Sigma-Aldrich Company). After washing, membranes were incubated with horseradish peroxidase-conjugated goat antirabbit IgG (1:5000) second antibody for 2 hours at room temperature. Immunoblotting signals were visualized by enhanced chemiluminescence using a commercial kit (ECL-plus; Chemicon International, Billerica, Mass). As an internal control, membranes were redeveloped using antibody against -actin. Membranes were first stripped in buffer containing 62.5 mM Tris.HCl pH 6.7, 100 mM 2-mercaptoethanol, 2% SDS for 30 minutes at 55oC, and then reacted with primary antibody against -actin (1: 1000). Quantitative analysis of immunoblot signals was performed using the GelDoc-2000 Imaging System (BioRad Company). To determine relative expression levels, the signal intensities of VCAM-1 and GFP were normalized to -actin. The ratio of the relative values in the control group was taken as 100%; data from other groups were expressed as a percentage of the value from the control group.15,16 Measurement of Doppler ultrasonography on carotid arteries in vivo. Measurements were performed as previously described.18 Rats in each group (n ⫽ 10 per group) were anesthetized with trichloroacetaldehyde monohydrate (200 mg/kg, ip) 2 weeks postsurgery. A 60-Hz linear array transducer (Vevo system; Visual-Sonics Corporation, Toronto, Ontario, Canada) was used to examine the
ultrasonographic signals. Horizontal calibration measurements were performed using the appropriate ultrasound assurance phantom. Preprocessing configurations were adjusted to visibly test the constant and least dense arterial wall interface during examination. The blood/intima (the innermost layer of media in lesion site) borderlines were automatically detected and collected by the system. Linear diameter and blood flow velocity at the narrowest site of the common carotid arteries were calculated by blinded observer.18 Morphometric analysis of common carotid artery. Arteries were embedded in OCT compound and sectioned (7.0-m thickness) as previously reported.19 Three sections per artery were collected from the central one-third of the segment following CSMDE. Sections were stained with hematoxylin and eosin (HE) solution and photographed. The perimeters of the lumen, the internal elastic lamina (IEL), or the innermost layer of media (ILM) in lesion site, and the external elastic lamina (EEL) were obtained by tracing the contours on digitized or images using the NIH Image 1.62 program. The intimal/neointimal area (I) and medial area (M) were calculated by subtracting the area defined by the lumen from that of the IEL/ILM and subtracting the area defined by the IEL/ILM from that of the EEL, respectively.19
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
Qu et al 1455
Statistical and data analysis. Our sample-size estimation was based on the expected differences in linear diameter and blood flow velocity of the common carotid arteries, which were measured by Doppler ultrasonography between SHAM and CSMDE groups. The sample size of eight per group would give a power of 80% at an ␣ level of 0.05 for detecting the difference in linear diameter and blood flow velocity. In this study, we prospectively set the sample size at 10 rats (n ⫽ 10 per group) for Doppler ultrasonography, morphometric analysis, and Western blot analysis, respectively. All values were expressed as means ⫾ SD calculated from at least six independent experiments in each group. Statistical analysis was conducted using oneway analysis of variance followed by pairwise multiple comparisons using the Bonferroni test. Statistical significance was set at P ⬍ .05. RESULTS Inhibitory effects of VCAM-1 siRNA on VCAM-1 expression in arteries of rats. To assess the efficacy of in vivo gene transfer using GFP-conjugated lentiviral constructs, frozen sections of the carotid artery from control and transfected groups were harvested at 4 days after surgery and examined under a fluorescence microscope. As shown in Fig 1, B, GFP-fluorescence signals were clearly visible in the arterial neointima of the transfection (TRANS) group. GFP protein was also detected by immunoblotting (Fig 1, C). Quantitative analysis (Fig 1, D) showed that GFP protein expression was significantly increased relative to the control group (P ⬍ .05, n ⫽ 6 per group). These results indicate that the lentiviral construct system is an effective in vivo delivery method for targeting siRNA expression to the carotid arteries. To determine whether siRNA expression altered VCAM-1 protein expression levels, tissue homogenates were examined by Western blotting. Representative data and quantitative analysis are shown in Fig 2, A and B; these results indicate that VCAM-1 protein expression levels increased significantly post-CSMDE (188.8 ⫾ 24.3%; P ⬍ .05 vs the sham group: 100%; n ⫽ 10 per group). The upregulation of VCAM-1 protein after CSMDE was significantly inhibited by the construct expressing VCAM-1 siRNA (CSMDE⫹RNAi: 135.0 ⫾ 27.6%; P ⬍ .05 vs CSMDE⫹CON; n ⫽ 10 per group) but was not affected by treatment with the construct expressing scrambled siRNA (CSMDE⫹CON: 182.7 ⫾ 36.4%). These results suggest that VCAM-1 siRNA can effectively reduce VCAM-1 protein expression in the carotid arteries of rats undergoing CSMDE. Effects of VCAM-1 siRNA on carotid neointimal hyperplasia in rats. Two weeks postsurgery, high-resolution Doppler apparatus was used to measure blood velocity and the linear diameter of common carotid arteries in 10 rats from each group. As shown in Fig 3, A and B, no stenosis was observed in sham-operated animals. Blood/ intima borderlines were smooth, and the linear diameters and blood velocities in the common carotid arteries were 0.92 ⫾ 0.73 mm and 545.50 ⫾ 40.87 mm/s, respectively.
Fig 2. siRNA blocks CSMDE-induced VCAM-1 upregulation in rat carotid arteries. A, Representative Western blot showing VCAM-1 (110 kDa) protein expression levels in carotid arteries of rats in the SHAM, CSMDE, CSMDE⫹CON and CSMDE⫹ RNAi groups. B, Quantitative analysis reveals significant upregulation of VCAM-1 protein expression following CSMDE and CSMDE⫹CON (*P ⬍ .05 vs SHAM). VCAM-1 siRNA significantly reduced VCAM-1 protein expression compared with CSMDE⫹CON (#P ⬍ .05). SHAM, Sham operation; CSMDE, carotid surgical mechanical de-endothelialization; CSMDE⫹ CON, CSMDE⫹scrambled siRNA; CSMDE⫹RNAi, CSMDE⫹ VCAM-1 siRNA; n ⫽ 10 per group.
Neointima thickness increased significantly in the CSMDE group with an undetectable lumen and significantly decreased blood velocity (57.25 ⫾ 39.53 mm/s, P ⬍ .05 vs SHAM, n ⫽10 per group). These data were obtained at a point distal to neointimal hyperplasia in the common carotid artery. The extent of stenosis and blood velocity data in arteries from the CSMDE group treated with the scrambled siRNA construct (CSMDE⫹CON, 46.72 ⫾ 28.67 mm/s) was not significantly different from the CSMDE group. In contrast, transfection with the VCAM-1 siRNA construct (CSMDE⫹RNAi) was accompanied by a significant reduction in the extent of stenosis demonstrated by increased blood velocity (665.85 ⫾ 48.37 mm/s) and linear diameter (0.59 ⫾ 0.77mm) at the site with maximal narrowing (P ⬍ .05 vs CSMDE⫹CON, n ⫽ 10 per group). Histologic analysis of HE-stained sections indicated that VCAM-1 siRNA transfection (CSMDE⫹RNAi) significantly inhibited the eccentric proliferation of neointima
1456 Qu et al
JOURNAL OF VASCULAR SURGERY December 2009
Fig 3. Doppler ultrasonographic measurement of rat carotid arteries. A, Representative images showing carotid artery linear diameter and blood velocity measurements; left and right panels respectively show the blood vessel lumens and blood flow spectrograms at the sites of greatest narrowing (arrowheads indicate the points of stenosis). B, Quantitative analysis showing that both arterial linear diameter and blood velocity are significantly decreased in the CSMDE and CSMDE⫹CON groups (*P ⬍ .05 vs SHAM). Treatment of VCAM-1 siRNA transfection (CSMDE⫹RNAi) resulted in a significant increase in linear diameter and blood velocity (#P ⬍ .05 vs CSMDE⫹CON). n ⫽ 10 per group.
and severe stenosis in arteries at 2 weeks post-CSMDE (Fig 4). Morphometric analysis in the Table revealed that the intima/media area ratio was significantly increased (P ⬍ .05) in both the CSMDE (3.99 ⫾ 0.65, n ⫽ 10) and CSMDE⫹CON (4.33 ⫾ 0.59, n ⫽ 10) groups compared with the SHAM group (0.35 ⫾ 0.13, n ⫽ 10). However, VCAM-1 siRNA transfection resulted in a significant decrease in the intima/media area ratio (1.79 ⫾ 0.43, n ⫽ 10) compared with the CSMDE⫹CON group (P ⬍ .05). As shown in the Table, there were no significant differences in total arterial area and medial areas among the groups (n ⫽ 10 per group). DISCUSSION Although CEA vascular surgery is commonly used to treat severe carotid stenosis, postoperative restenosis and reocclusion increase the risk of subsequent life-threatening events.20,21 A detailed understanding of the molecular mechanisms underlying restenosis after CEA is essential to develop new preventive and therapeutic strategies. In a recent study, carotid artery injury was induced in a rat model by denudement of the endothelial cell monolayer and vessel wall stretching using a balloon-tip catheter.22 However, such vessel injuries do not resemble the types of damage induced by surgical CEA in humans. Balloon cath-
eter injury results in the migration and proliferation of vascular smooth muscle cells with little initial endothelial regrowth. The present study employed a CSMDE procedure with intima removal and a closured suture that resembles the surgical procedure of CEA performed in patients. Cytokines, chemokines, and adhesion molecules are proinflammatory mediators that regulate the infiltration of inflammatory cells into the vascular wall. Inflammatory signals are known to predispose to restenosis of vascular structures.23 VCAM-1 is a key adhesion molecule responsible for leukocyte migration and recruitment; the molecule may be implicated in the pathoetiology of inflammatory conditions including atherosclerosis and blood vessel restenosis. VCAM-1 has been detected both in atherosclerotic plaques and in endothelial cells, and VCAM-1 expression may contribute to the development of atherosclerosis.24 A correlation has been reported between VCAM-1 expression and neointima formation following carotid artery injury: such damage was shown to increase VCAM-1 expression and lead to intimal thickening.25 In the present study, we found that VCAM-1 protein is significantly upregulated in rat carotid arteries after a CSMDE procedure. Interactions between leukocytes and adhesion molecules are critical for triggering restenosis; blocking these interactions may diminish the risk of restenosis.26 Several
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
Qu et al 1457
Fig 4. Inhibition of carotid artery neointimal hyperplasia by local VCAM-1 siRNA expression in rats following CSMDE. Representative light microscope images of carotid artery cross-sections from SHAM, CSMDE, CSMDE⫹CON and CSMDE⫹RNAi animals, scale bar ⫽ 200 m.
Table. Morphometric analysis of neointimal formation after surgical mechanical injury of the rat carotid artery
Lumen area (mm2) Neointimal area (I, mm2) Medial area (M, mm2) Total arterial area (mm2) I/M ratio
SHAM (n ⫽ 10)
CSMDE (n ⫽ 10)
CSMDE⫹CON (n ⫽ 10)
CSMDE⫹RNAi (n ⫽ 10)
0.495 ⫾ 0.024 0.036 ⫾ 0.015 0.105 ⫾ 0.031 0.578 ⫾ 0.048 0.35 ⫾ 0.13
0.041 ⫾ 0.012a 0.469 ⫾ 0.098a 0.116 ⫾ 0.035 0.571 ⫾ 0.053 3.99 ⫾ 0.65a
0.039 ⫾ 0.014a 0.484 ⫾ 0.086a 0.107 ⫾ 0.037 0.568 ⫾ 0.059 4.33 ⫾ 0.59a
0.210 ⫾ 0.074a,b 0.245 ⫾ 0.083a,b 0.116 ⫾ 0.041 0.562 ⫾ 0.063 1.79 ⫾ 0.43a,b
SHAM, Sham operation; CSMDE, carotid surgical mechanical de-endothelialization; CSMDE⫹CON, CSMDE⫹scrambled siRNA; CSMDE⫹RNAi, CSMDE⫹VCAM-1 siRNA. Values were presented as mean ⫾ SD. n ⫽ 10 per group. a P ⬍ .05 vs SHAM. b P ⬍ .05 vs CSMED⫹CON.
studies have addressed this possibility using either selective monoclonal antibodies against specific adhesion molecules or by genetic knockout of selectin or integrin genes.27,28 In nonhuman primates undergoing CEA, an antibody against VLA-4 effectively reduced intimal hyperplasia.29 Other studies have reported that antibodies against VCAM-1 or VLA-4 can block the recruitment of monocytes/macrophages and inhibit neointima formation in injured arteries in mice.12,30 These reports are consistent with our findings that lentivirus-based expression of VCAM-1 siRNA can successfully inhibit neointimal formation after surgical mechanical injury of the rat carotid artery even the VCAM-1 siRNA did not completely suppress CSMDE-induced upregulation of VCAM-1.
In conclusion, this study is the first to report that blockade of VCAM-1 expression with VCAM-1 siRNA in carotid arteries can inhibit carotid arterial neointimal hyperplasia after CSMDE. We have shown that local expression of VCAM-1 siRNA can profoundly reduce neointima formation as reflected by a decreased intima/media area ratio in carotid artery sections. The precise mechanism whereby VCAM-1 siRNA expression can reduce arterial neointimal hyperplasia is not yet known, but this may take place through inhibition of monocyte/macrophage infiltration mediated by VCAM-1. Further studies into the inflammatory processes that culminate in arterial neointimal hyperplasia will be required to address this question. In addition, this is a model of carotid injury not atheroscle-
1458 Qu et al
rotic disease, so it may not reflect the human condition in which restenosis occurs much more slowly, and the findings in a rat may not be true in a human. AUTHOR CONTRIBUTIONS Conception and design: XS, CY, JL Analysis and interpretation: YQ, XS, HZ, WS, CY, JL Data collection: YQ, HZ, WS, SH, CY, JL Writing the article: YQ, CY, JL Critical revision of the article: YQ, CY, JL Final approval of the article: YQ, XS, HZ, WS, SH, CY, JL Statistical analysis: YQ, SH, CY, JL Obtained funding: XS, JL Overall responsibility: CY, JL REFERENCES 1. Reina-Gutierrez T, Serrano-Hernando FJ, Sanchez-Hervas L, Ponce A, Vega de CM, Martin A. Recurrent carotid artery stenosis following endarterectomy: natural history and risk factors. Eur J Vasc Endovasc Surg 2005;29:334-41. 2. Rubio F, Martinez-Yelamos S, Cardona P, Krupinski J. Carotid endarterectomy: is it still a gold standard? Cerebrovasc Dis 2005;20(Suppl 2):119-22. 3. Rothwell PM. Current status of carotid endarterectomy and stenting for symptomatic carotid stenosis. Cerebrovasc Dis 2007;24(Suppl 1): 116-25. 4. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol 1991;17:758-69. 5. Heider P, Wildgruber MG, Weiss W, Berger HJ, Eckstein HH, Wolf O. Role of adhesion molecules in the induction of restenosis after angioplasty in the lower limb. J Vasc Surg 2006;43:969-77. 6. Kollum M, Hoefer I, Schreiber R, Bode C, Hehrlein C. Systemic application of anti-ICAM-1 monoclonal antibodies to prevent restenosis in rabbits: an anti-inflammatory strategy. Coron Artery Dis 2007;18: 117-23. 7. Wexberg P, Jordanova N, Strehblow C, Syeda B, Meyer B, Charvat S, et al. Time course of prothrombotic and proinflammatory substance release after intracoronary stent implantation. Thromb Haemost 2008; 99:739-48. 8. Bishop-Bailey D, Burke-Gaffney A, Hellewell PG, Pepper JR, Mitchell JA. Cyclo-oxygenase-2 regulates inducible ICAM-1 and VCAM-1 expression in human vascular smooth muscle cells. Biochem Biophys Res Commun 1998;249:44-7. 9. Ludwig A, Lorenz M, Grimbo N, Steinle F, Meiners S, Bartsch C, et al. The tea flavonoid epigallocatechin-3-gallate reduces cytokine-induced VCAM-1 expression and monocyte adhesion to endothelial cells. Biochem Biophys Res Commun 2004;316:659-65. 10. Steele AD, Warfel JM, D’Agnillo F. Anthrax lethal toxin enhances cytokine-induced VCAM-1 expression on human endothelial cells. Biochem Biophys Res Commun 2005;337:1249-56. 11. Preiss DJ, Sattar N. Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract 2007;61:697-701. 12. Oguchi S, Dimayuga P, Zhu J, Chyu KY, Yano J, Shah PK, et al. Monoclonal antibody against vascular cell adhesion molecule-1 inhibits neointimal formation after periadventitial carotid artery injury in genetically hypercholesterolemic mice. Arterioscler Thromb Vasc Biol 2000; 20:1729-36.
JOURNAL OF VASCULAR SURGERY December 2009
13. Parker DG, Kaufmann C, Brereton HM, Anson DS, Francis-Staite L, Jessup CF, et al. Lentivirus-mediated gene transfer to the rat, ovine and human cornea. Gene Ther 2007;14:760-7. 14. Southern FN, Cruz N, Fink LM, Cooney CA, Barone GW, Eidt JF, et al. Hyperhomocysteinemia increases intimal hyperplasia in a rat carotid endarterectomy model. J Vasc Surg 1998;28:909-18. 15. Gao Y, Gao G, Long C, Han S, Zu P, Fang L, et al. Enhanced phosphorylation of cyclic AMP response element binding protein in the brain of mice following repetitive hypoxic exposure. Biochem Biophys Res Commun 2006;340:661-7. 16. Zhang N, Gao G, Bu X, Han S, Fang L, Li J. Neuron-specific phosphorylation of c-Jun N-terminal kinase increased in the brain of hypoxic preconditioned mice. Neurosci Lett 2007;423:219-24. 17. Wu J, Zhang X, Nauta HJ, Lin Q, Li J, Fang L. JNK1 regulates histone acetylation in trigeminal neurons following chemical stimulation. Biochem Biophys Res Commun 2008;376:781-6. 18. Fehm NP, Vatankhah B, Dittmar MS, Retzl G, Schuierer G, Horn M, et al. Application of clinical scanners in rats: experimental carotid imaging using magnetic resonance imaging, spiral computed tomography, and color duplex ultrasound. J Neuroimaging 2005;15:319-25. 19. Barbee RW, Stapleton DD, Madras DE, Re RN, Murgo JP, Davenport WD, et al. Retroviral suicide vector does not inhibit neointimal growth in a porcine coronary model of restenosis. Biochem Biophys Res Commun 1995;207:89-98. 20. Schanzer A, Hoel A, Owens CD, Wake N, Nguyen LL, Conte MS, et al. Restenosis after carotid endarterectomy performed with routine intraoperative duplex ultrasonography and arterial patch closure: a contemporary series. Vasc Endovasc Surg 2007;41:200-5. 21. Gallego J, Martinez VE, Munoz R. Patients at high risk for ischemic stroke: identification and actions. Cerebrovasc Dis 2007;24(Suppl 1): 49-63. 22. Kong D, Melo LG, Mangi AA, Zhang L, Lopez-Ilasaca M, Perrella MA, et al. Enhanced inhibition of neointimal hyperplasia by genetically engineered endothelial progenitor cells. Circulation 2004;109: 1769-75. 23. Wang K, Zhou X, Zhou Z, Mal N, Fan L, Zhang M, et al. Platelet, not endothelial, P-selectin is required for neointimal formation after vascular injury. Arterioscler Thromb Vasc Biol 2005;25:1584-9. 24. Patel S, Celermajer DS, Bao S. Atherosclerosis-underlying inflammatory mechanisms and clinical implications. Int J Biochem Cell Biol 2008;40:576-80. 25. Shimizu N, Suzuki H, Wakabayashi K, Iso Y, Shibata M, Yorozuya M, et al. [Expression of intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in the pig coronary artery injury model: comparison of plain old balloon angioplasty and stent implantation]. J Cardiol 2004;43:131-9. 26. Harlan JM, Winn RK. Leukocyte-endothelial interactions: clinical trials of anti-adhesion therapy. Crit Care Med 2002;30(5 Suppl):S214-9. 27. Bhoday J, de SS, Xu Q. The molecular mechanisms of vascular restenosis: Which genes are crucial? Curr Vasc Pharmacol 2006;4:269-75. 28. Schober A, Weber C. Mechanisms of monocyte recruitment in vascular repair after injury. Antioxid Redox Signal 2005;7:1249-57. 29. Lumsden AB, Chen C, Hughes JD, Kelly AB, Hanson SR, Harker LA. Anti-VLA-4 antibody reduces intimal hyperplasia in the endarterectomized carotid artery in nonhuman primates. J Vasc Surg 1997;26: 87-93. 30. Suzuki J, Izawa A, Isobe M. Anti-vascular cell adhesion molecule-1 and anti-very late antigen-4 monoclonal antibodies inhibit neointimal hyperplasia in the murine model of arterial injury. Acta Cardiol 2004;59: 147-52. Submitted May 17, 2009; accepted Aug 15, 2009.
Carotid atherosclerotic stenosis is a major risk factor for stroke.1 Carotid endarterectomy (CEA) has proved to be a very effective surgical procedure for treating patients with severe (70%-99%) carotid stenosis.2,3 However, carotid From the Department of Neurosurgery, Capital Medical University Affiliated Fu Xing Hospital,a Department of Neurosurgery, Brain Sciences Institute of Beijing,b and Department of Neurobiology and Beijing Institute for Neuroscience, Capital Medical University.c Supported by the following grants: National Natural Science Foundation of China (30571902, 30670782, and 30871219), Beijing Natural Science Foundation (5072008), Key Scientific Developing Programs of Beijing Municipal Commission of Education (KZ200810025012), Beijing Municipal Programs for Hundred-Thousand-Ten Thousand Excellent Talents of New Century (Li J), and Funding Projects for Academic Human Resources Development in Institutions of Higher Learning under the Jurisdiction of Beijing Municipality (PHR200906116). Competition of interest: none. Reprint requests: Junfa Li, MD, PhD, Department of Neurobiology and Beijing Institute for Neuroscience, Capital Medical University, No. 10 You An Men Wai Xi Tou Tiao, Beijing 100069, China (e-mail: junfali@ ccmu.edu.cn) and Chunjiang Yu, MD, Department of Neurosurgery, Capital Medical University Affiliated Fu Xing Hospital, No. 20 Fu Xing Men Wai Street, Beijing 100038, China (e-mail: [email protected]). The editors and reviewers of this article have no relevant financial relationships to disclose per the JVS policy that requires reviewers to decline review of any manuscript for which they may have a competition of interest. 0741-5214/$36.00 Copyright © 2009 by the Society for Vascular Surgery. doi:10.1016/j.jvs.2009.08.050
1452
artery restenosis following surgery is a common complication; this limits the efficacy of CEA in stroke prevention.1 A proposed paradigm for carotid artery restenosis, based on the vascular biology of wound healing, suggests that the restenosis takes place in three phases comprising an inflammatory phase, a proliferative phase, and a remodeling phase.4 The early phase involves the recruitment of inflammatory cells from the circulation; this process is mediated by cell adhesion molecules (CAM). Human genetic studies and work in animal models both support the contention that CAM plays an important role in the pathogenesis of restenosis.5-7 Vascular cell adhesion molecule-1 (VCAM-1) is a member of the CAM superfamily expressed by endothelial cells and by cytokine-stimulated smooth muscle cells and mediates leukocyte recruitment during inflammation.8-10 VCAM-1 is thought to interact with integrin ␣41 at the surface of leukocytes to trigger intracellular signal transduction pathways.11 The potential role of VCAM-1 in restenosis has been investigated previously: monoclonal antibody blockade of VCAM-1 in an animal model was found to reduce neointimal formation post-CEA.12 In vivo studies on the role of VCAM-1 in restenosis have been limited because the VCAM-1 gene knockout in mice causes embryonic lethality. In the present study, we instead used a
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
lentivirus-based small interfering RNA (siRNA) to downregulate VCAM-1 expression in rats undergoing carotid surgical mechanical de-endothelialization (CSMDE) to mimic CEA. siRNA techniques afford a novel approach for manipulating VCAM-1 expression in vivo and may provide insights for the management of carotid restenosis postCEA. MATERIALS AND METHODS Proteinase inhibitors, phosphatase inhibitors, dithiothreitol (DTT), Nonidet P-40, ethylenediamine tetraacetic acid (EDTA), ethyleneglycol tetraacetic acid (EGTA), sodium dodecyl sulfate (SDS), and other standard reagents were from Sigma-Aldrich (St. Louis, Mo). Protein assay reagents, horseradish peroxidase-conjugated goat antirabbit IgG and goat anti-mouse IgG were purchased from Bio-Rad Company (Hercules, Calif). Antibody against -actin was from Sigma-Aldrich. Lentivirus-based VCAM-1 siRNA construction. Four target sequences are selected from the previously published rat VCAM-1 mRNA sequence (NM_012889). Each sequence is 19 nt in length. The sequences were selected to ensure that the GC content was ⬃30% to 50% and there were no contiguous sequences of more than four adenines or thymidines. The sequences were blast-searched against rat expressed sequence tags (EST) libraries to ensure that they are not homologous to other sequences. The most favorable of the siRNA sequences was ⫹1718CTGCAGCCTCTTTCTCAAA⫹ 1738. The short hairpin RNA (shRNA) sequence (5’CTGCAGCCTCTTTCTCAAATTCAAGAGATTTGAGAAAGAGGCTGCA G-3’) was based on this siRNA sequence. These were annealed and cloned into the pGCLGFP entry vector between Hpa I and Xho I sites. The sequence of the scrambled siRNA was 5’-TTCTCCGAACGTGTCACGT-3’. Lentivirus stocks were prepared according to a previously described 3-plasmid transfection lentivirus preparation protocol.13 Briefly, confluent HK293 cells were cotransfected with pGCL-GFP, pHelper1.0, and the lentiviral helper plasmid pHelper2.0. The crude viral lysate was purified by two-tier CsCl centrifugation. The final titer of lentivirus was prepared as 6 ⫻ 108 TU/mL. The lentiviral package system was provided by the Institute of Virology, Chinese Academy of Medical Sciences (Beijing, China). Preparation of carotid surgical mechanical deendothelialization (CSMDE) in a rat model. The animal protocol was approved by the Animal Care and Use Committee of Capital Medical University and is consistent with the NIH Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23). Male SpragueDawley rats (aged 6-7 weeks, 250-300 g) were initially housed in a temperature- and light-controlled room (2124oC; 12:12 hours light:dark cycle) with free access to food and water. Animals were randomized into carotid surgical mechanical de-endothelialization (CSMDE, n ⫽ 30), sham CSMDE operation (SHAM, n ⫽ 30), CSMDE treated with scrambled siRNA (CSMDE⫹CON, n ⫽ 30), and CSMDE treated with VCAM-1 siRNA (CSMDE⫹RNAi, n ⫽ 30)
Qu et al 1453
groups. Left carotid arteries of untreated rats were used as controls for molecular biological analysis. CSMDE was performed as previously reported to mimic CEA.14 Briefly, animals were anesthetized with trichloroacetaldehyde monohydrate (200 mg/kg, ip). After exposure of the right common carotid artery, Yasargil clamps were applied proximal and distal to the bifurcation (10.0 mm apart). Arteriotomy was performed using a corneal blade, and the endothelial cell layer and the inner portion of the media were carefully removed with a burr tip. The arteriotomy was closed with a running 10-0 monofilament nylon suture thread. For the group treated with lentiviral constructs, a polypropylene catheter was introduced into the common carotid artery through the external carotid artery. A 100-L volume of lentiviral constructs with scrambled siRNA (6 ⫻ 108 TU/mL) or VCAM-1 siRNA (6 ⫻ 108 TU/mL) was instilled as a static application in the isolated injury segment of the carotid artery over 120 minutes. During the procedure, the cell culture medium (DMEM⫹10% FBS, 37oC) was used to infuse the isolated vessel. The catheter was withdrawn, followed by the ligation of the external carotid artery. After the clamps were removed, the common carotid artery was examined to confirm that surgery had been successful. The superficial muscle layer was closed with a running 4-0 absorbable suture, and the section was closed. Rats in the sham operation group received carotid arteriotomy and suture without endothelial denudation. Animals were sacrificed with an overdose of pentobarbital (200 mg/kg, ip) 2 weeks postsurgery; sections of targeted carotid artery were dissected and embedded in optimal cutting temperature (OCT) compound for morphometric analysis or frozen in liquid nitrogen for Western blot analysis. Western blot analysis. As described previously,15 frozen samples of carotid artery sections were homogenized at 4oC in homogenizing buffer (50 mM Tris.HCl pH 7.5 containing 2 mM dithiothreitol, 2 mM EDTA, 2 mM EGTA, 5 mg/mL each of leupeptin, aprotinin, pepstatin A, and chymostatin, 50 mM KF, 50 nM okadaic acid, 5 mM sodium pyrophosphate, 1 mM orthovanadate, and 2% SDS) and sonicated to obtain complete dissolution. Protein concentrations were determined using a commercial BCA kit (Pierce Company, Upland, Ind). Expression of green fluorescent protein (GFP) and VCAM-1 was analyzed by SDS-PAGE and Western blotting as previously reported.16,17 Briefly, homogenate samples containing 30 g of protein were resolved on an 8% SDS-PAGE gel. Gels were electrotransferred to nitrocellulose membranes (NC membrane; Bio-Rad) at 4oC, 400 mA for 4 hours. Membranes were washed for 10 minutes with TTBS (20 mM Tris.HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20) followed by blocking with 10% nonfat milk in TTBS for 1 hour. Blocked membranes were first incubated with rabbit polyclonal antibody against VCAM-1 (1:1000 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif) or a rabbit
1454 Qu et al
JOURNAL OF VASCULAR SURGERY December 2009
Fig 1. Lentivirus-based VCAM-1 siRNA transfection in carotid arteries of rats following CSMDE. Representative images showing no detectable green fluorescence in normal (CON, A) animals but pronounced fluorescence in the neointima of carotid arteries after transfection with lentiviral constructs co-expressing GFP (TRNAS, B); C, Western blotting of carotid arterial homogenates showing the expression of GFP (27 kDa) and -actin (42 kDa) in CON and TRANS animals; D, Quantitative analysis of Western blot signals shows that GFP expression levels increased significantly in carotid arterial homogenates from TRANS animals (*P ⬍ .05 vs CON, n ⫽ 6 per group).
polyclonal antibody against GFP (1:1000; Sigma-Aldrich Company). After washing, membranes were incubated with horseradish peroxidase-conjugated goat antirabbit IgG (1:5000) second antibody for 2 hours at room temperature. Immunoblotting signals were visualized by enhanced chemiluminescence using a commercial kit (ECL-plus; Chemicon International, Billerica, Mass). As an internal control, membranes were redeveloped using antibody against -actin. Membranes were first stripped in buffer containing 62.5 mM Tris.HCl pH 6.7, 100 mM 2-mercaptoethanol, 2% SDS for 30 minutes at 55oC, and then reacted with primary antibody against -actin (1: 1000). Quantitative analysis of immunoblot signals was performed using the GelDoc-2000 Imaging System (BioRad Company). To determine relative expression levels, the signal intensities of VCAM-1 and GFP were normalized to -actin. The ratio of the relative values in the control group was taken as 100%; data from other groups were expressed as a percentage of the value from the control group.15,16 Measurement of Doppler ultrasonography on carotid arteries in vivo. Measurements were performed as previously described.18 Rats in each group (n ⫽ 10 per group) were anesthetized with trichloroacetaldehyde monohydrate (200 mg/kg, ip) 2 weeks postsurgery. A 60-Hz linear array transducer (Vevo system; Visual-Sonics Corporation, Toronto, Ontario, Canada) was used to examine the
ultrasonographic signals. Horizontal calibration measurements were performed using the appropriate ultrasound assurance phantom. Preprocessing configurations were adjusted to visibly test the constant and least dense arterial wall interface during examination. The blood/intima (the innermost layer of media in lesion site) borderlines were automatically detected and collected by the system. Linear diameter and blood flow velocity at the narrowest site of the common carotid arteries were calculated by blinded observer.18 Morphometric analysis of common carotid artery. Arteries were embedded in OCT compound and sectioned (7.0-m thickness) as previously reported.19 Three sections per artery were collected from the central one-third of the segment following CSMDE. Sections were stained with hematoxylin and eosin (HE) solution and photographed. The perimeters of the lumen, the internal elastic lamina (IEL), or the innermost layer of media (ILM) in lesion site, and the external elastic lamina (EEL) were obtained by tracing the contours on digitized or images using the NIH Image 1.62 program. The intimal/neointimal area (I) and medial area (M) were calculated by subtracting the area defined by the lumen from that of the IEL/ILM and subtracting the area defined by the IEL/ILM from that of the EEL, respectively.19
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
Qu et al 1455
Statistical and data analysis. Our sample-size estimation was based on the expected differences in linear diameter and blood flow velocity of the common carotid arteries, which were measured by Doppler ultrasonography between SHAM and CSMDE groups. The sample size of eight per group would give a power of 80% at an ␣ level of 0.05 for detecting the difference in linear diameter and blood flow velocity. In this study, we prospectively set the sample size at 10 rats (n ⫽ 10 per group) for Doppler ultrasonography, morphometric analysis, and Western blot analysis, respectively. All values were expressed as means ⫾ SD calculated from at least six independent experiments in each group. Statistical analysis was conducted using oneway analysis of variance followed by pairwise multiple comparisons using the Bonferroni test. Statistical significance was set at P ⬍ .05. RESULTS Inhibitory effects of VCAM-1 siRNA on VCAM-1 expression in arteries of rats. To assess the efficacy of in vivo gene transfer using GFP-conjugated lentiviral constructs, frozen sections of the carotid artery from control and transfected groups were harvested at 4 days after surgery and examined under a fluorescence microscope. As shown in Fig 1, B, GFP-fluorescence signals were clearly visible in the arterial neointima of the transfection (TRANS) group. GFP protein was also detected by immunoblotting (Fig 1, C). Quantitative analysis (Fig 1, D) showed that GFP protein expression was significantly increased relative to the control group (P ⬍ .05, n ⫽ 6 per group). These results indicate that the lentiviral construct system is an effective in vivo delivery method for targeting siRNA expression to the carotid arteries. To determine whether siRNA expression altered VCAM-1 protein expression levels, tissue homogenates were examined by Western blotting. Representative data and quantitative analysis are shown in Fig 2, A and B; these results indicate that VCAM-1 protein expression levels increased significantly post-CSMDE (188.8 ⫾ 24.3%; P ⬍ .05 vs the sham group: 100%; n ⫽ 10 per group). The upregulation of VCAM-1 protein after CSMDE was significantly inhibited by the construct expressing VCAM-1 siRNA (CSMDE⫹RNAi: 135.0 ⫾ 27.6%; P ⬍ .05 vs CSMDE⫹CON; n ⫽ 10 per group) but was not affected by treatment with the construct expressing scrambled siRNA (CSMDE⫹CON: 182.7 ⫾ 36.4%). These results suggest that VCAM-1 siRNA can effectively reduce VCAM-1 protein expression in the carotid arteries of rats undergoing CSMDE. Effects of VCAM-1 siRNA on carotid neointimal hyperplasia in rats. Two weeks postsurgery, high-resolution Doppler apparatus was used to measure blood velocity and the linear diameter of common carotid arteries in 10 rats from each group. As shown in Fig 3, A and B, no stenosis was observed in sham-operated animals. Blood/ intima borderlines were smooth, and the linear diameters and blood velocities in the common carotid arteries were 0.92 ⫾ 0.73 mm and 545.50 ⫾ 40.87 mm/s, respectively.
Fig 2. siRNA blocks CSMDE-induced VCAM-1 upregulation in rat carotid arteries. A, Representative Western blot showing VCAM-1 (110 kDa) protein expression levels in carotid arteries of rats in the SHAM, CSMDE, CSMDE⫹CON and CSMDE⫹ RNAi groups. B, Quantitative analysis reveals significant upregulation of VCAM-1 protein expression following CSMDE and CSMDE⫹CON (*P ⬍ .05 vs SHAM). VCAM-1 siRNA significantly reduced VCAM-1 protein expression compared with CSMDE⫹CON (#P ⬍ .05). SHAM, Sham operation; CSMDE, carotid surgical mechanical de-endothelialization; CSMDE⫹ CON, CSMDE⫹scrambled siRNA; CSMDE⫹RNAi, CSMDE⫹ VCAM-1 siRNA; n ⫽ 10 per group.
Neointima thickness increased significantly in the CSMDE group with an undetectable lumen and significantly decreased blood velocity (57.25 ⫾ 39.53 mm/s, P ⬍ .05 vs SHAM, n ⫽10 per group). These data were obtained at a point distal to neointimal hyperplasia in the common carotid artery. The extent of stenosis and blood velocity data in arteries from the CSMDE group treated with the scrambled siRNA construct (CSMDE⫹CON, 46.72 ⫾ 28.67 mm/s) was not significantly different from the CSMDE group. In contrast, transfection with the VCAM-1 siRNA construct (CSMDE⫹RNAi) was accompanied by a significant reduction in the extent of stenosis demonstrated by increased blood velocity (665.85 ⫾ 48.37 mm/s) and linear diameter (0.59 ⫾ 0.77mm) at the site with maximal narrowing (P ⬍ .05 vs CSMDE⫹CON, n ⫽ 10 per group). Histologic analysis of HE-stained sections indicated that VCAM-1 siRNA transfection (CSMDE⫹RNAi) significantly inhibited the eccentric proliferation of neointima
1456 Qu et al
JOURNAL OF VASCULAR SURGERY December 2009
Fig 3. Doppler ultrasonographic measurement of rat carotid arteries. A, Representative images showing carotid artery linear diameter and blood velocity measurements; left and right panels respectively show the blood vessel lumens and blood flow spectrograms at the sites of greatest narrowing (arrowheads indicate the points of stenosis). B, Quantitative analysis showing that both arterial linear diameter and blood velocity are significantly decreased in the CSMDE and CSMDE⫹CON groups (*P ⬍ .05 vs SHAM). Treatment of VCAM-1 siRNA transfection (CSMDE⫹RNAi) resulted in a significant increase in linear diameter and blood velocity (#P ⬍ .05 vs CSMDE⫹CON). n ⫽ 10 per group.
and severe stenosis in arteries at 2 weeks post-CSMDE (Fig 4). Morphometric analysis in the Table revealed that the intima/media area ratio was significantly increased (P ⬍ .05) in both the CSMDE (3.99 ⫾ 0.65, n ⫽ 10) and CSMDE⫹CON (4.33 ⫾ 0.59, n ⫽ 10) groups compared with the SHAM group (0.35 ⫾ 0.13, n ⫽ 10). However, VCAM-1 siRNA transfection resulted in a significant decrease in the intima/media area ratio (1.79 ⫾ 0.43, n ⫽ 10) compared with the CSMDE⫹CON group (P ⬍ .05). As shown in the Table, there were no significant differences in total arterial area and medial areas among the groups (n ⫽ 10 per group). DISCUSSION Although CEA vascular surgery is commonly used to treat severe carotid stenosis, postoperative restenosis and reocclusion increase the risk of subsequent life-threatening events.20,21 A detailed understanding of the molecular mechanisms underlying restenosis after CEA is essential to develop new preventive and therapeutic strategies. In a recent study, carotid artery injury was induced in a rat model by denudement of the endothelial cell monolayer and vessel wall stretching using a balloon-tip catheter.22 However, such vessel injuries do not resemble the types of damage induced by surgical CEA in humans. Balloon cath-
eter injury results in the migration and proliferation of vascular smooth muscle cells with little initial endothelial regrowth. The present study employed a CSMDE procedure with intima removal and a closured suture that resembles the surgical procedure of CEA performed in patients. Cytokines, chemokines, and adhesion molecules are proinflammatory mediators that regulate the infiltration of inflammatory cells into the vascular wall. Inflammatory signals are known to predispose to restenosis of vascular structures.23 VCAM-1 is a key adhesion molecule responsible for leukocyte migration and recruitment; the molecule may be implicated in the pathoetiology of inflammatory conditions including atherosclerosis and blood vessel restenosis. VCAM-1 has been detected both in atherosclerotic plaques and in endothelial cells, and VCAM-1 expression may contribute to the development of atherosclerosis.24 A correlation has been reported between VCAM-1 expression and neointima formation following carotid artery injury: such damage was shown to increase VCAM-1 expression and lead to intimal thickening.25 In the present study, we found that VCAM-1 protein is significantly upregulated in rat carotid arteries after a CSMDE procedure. Interactions between leukocytes and adhesion molecules are critical for triggering restenosis; blocking these interactions may diminish the risk of restenosis.26 Several
JOURNAL OF VASCULAR SURGERY Volume 50, Number 6
Qu et al 1457
Fig 4. Inhibition of carotid artery neointimal hyperplasia by local VCAM-1 siRNA expression in rats following CSMDE. Representative light microscope images of carotid artery cross-sections from SHAM, CSMDE, CSMDE⫹CON and CSMDE⫹RNAi animals, scale bar ⫽ 200 m.
Table. Morphometric analysis of neointimal formation after surgical mechanical injury of the rat carotid artery
Lumen area (mm2) Neointimal area (I, mm2) Medial area (M, mm2) Total arterial area (mm2) I/M ratio
SHAM (n ⫽ 10)
CSMDE (n ⫽ 10)
CSMDE⫹CON (n ⫽ 10)
CSMDE⫹RNAi (n ⫽ 10)
0.495 ⫾ 0.024 0.036 ⫾ 0.015 0.105 ⫾ 0.031 0.578 ⫾ 0.048 0.35 ⫾ 0.13
0.041 ⫾ 0.012a 0.469 ⫾ 0.098a 0.116 ⫾ 0.035 0.571 ⫾ 0.053 3.99 ⫾ 0.65a
0.039 ⫾ 0.014a 0.484 ⫾ 0.086a 0.107 ⫾ 0.037 0.568 ⫾ 0.059 4.33 ⫾ 0.59a
0.210 ⫾ 0.074a,b 0.245 ⫾ 0.083a,b 0.116 ⫾ 0.041 0.562 ⫾ 0.063 1.79 ⫾ 0.43a,b
SHAM, Sham operation; CSMDE, carotid surgical mechanical de-endothelialization; CSMDE⫹CON, CSMDE⫹scrambled siRNA; CSMDE⫹RNAi, CSMDE⫹VCAM-1 siRNA. Values were presented as mean ⫾ SD. n ⫽ 10 per group. a P ⬍ .05 vs SHAM. b P ⬍ .05 vs CSMED⫹CON.
studies have addressed this possibility using either selective monoclonal antibodies against specific adhesion molecules or by genetic knockout of selectin or integrin genes.27,28 In nonhuman primates undergoing CEA, an antibody against VLA-4 effectively reduced intimal hyperplasia.29 Other studies have reported that antibodies against VCAM-1 or VLA-4 can block the recruitment of monocytes/macrophages and inhibit neointima formation in injured arteries in mice.12,30 These reports are consistent with our findings that lentivirus-based expression of VCAM-1 siRNA can successfully inhibit neointimal formation after surgical mechanical injury of the rat carotid artery even the VCAM-1 siRNA did not completely suppress CSMDE-induced upregulation of VCAM-1.
In conclusion, this study is the first to report that blockade of VCAM-1 expression with VCAM-1 siRNA in carotid arteries can inhibit carotid arterial neointimal hyperplasia after CSMDE. We have shown that local expression of VCAM-1 siRNA can profoundly reduce neointima formation as reflected by a decreased intima/media area ratio in carotid artery sections. The precise mechanism whereby VCAM-1 siRNA expression can reduce arterial neointimal hyperplasia is not yet known, but this may take place through inhibition of monocyte/macrophage infiltration mediated by VCAM-1. Further studies into the inflammatory processes that culminate in arterial neointimal hyperplasia will be required to address this question. In addition, this is a model of carotid injury not atheroscle-
1458 Qu et al
rotic disease, so it may not reflect the human condition in which restenosis occurs much more slowly, and the findings in a rat may not be true in a human. AUTHOR CONTRIBUTIONS Conception and design: XS, CY, JL Analysis and interpretation: YQ, XS, HZ, WS, CY, JL Data collection: YQ, HZ, WS, SH, CY, JL Writing the article: YQ, CY, JL Critical revision of the article: YQ, CY, JL Final approval of the article: YQ, XS, HZ, WS, SH, CY, JL Statistical analysis: YQ, SH, CY, JL Obtained funding: XS, JL Overall responsibility: CY, JL REFERENCES 1. Reina-Gutierrez T, Serrano-Hernando FJ, Sanchez-Hervas L, Ponce A, Vega de CM, Martin A. Recurrent carotid artery stenosis following endarterectomy: natural history and risk factors. Eur J Vasc Endovasc Surg 2005;29:334-41. 2. Rubio F, Martinez-Yelamos S, Cardona P, Krupinski J. Carotid endarterectomy: is it still a gold standard? Cerebrovasc Dis 2005;20(Suppl 2):119-22. 3. Rothwell PM. Current status of carotid endarterectomy and stenting for symptomatic carotid stenosis. Cerebrovasc Dis 2007;24(Suppl 1): 116-25. 4. Forrester JS, Fishbein M, Helfant R, Fagin J. A paradigm for restenosis based on cell biology: clues for the development of new preventive therapies. J Am Coll Cardiol 1991;17:758-69. 5. Heider P, Wildgruber MG, Weiss W, Berger HJ, Eckstein HH, Wolf O. Role of adhesion molecules in the induction of restenosis after angioplasty in the lower limb. J Vasc Surg 2006;43:969-77. 6. Kollum M, Hoefer I, Schreiber R, Bode C, Hehrlein C. Systemic application of anti-ICAM-1 monoclonal antibodies to prevent restenosis in rabbits: an anti-inflammatory strategy. Coron Artery Dis 2007;18: 117-23. 7. Wexberg P, Jordanova N, Strehblow C, Syeda B, Meyer B, Charvat S, et al. Time course of prothrombotic and proinflammatory substance release after intracoronary stent implantation. Thromb Haemost 2008; 99:739-48. 8. Bishop-Bailey D, Burke-Gaffney A, Hellewell PG, Pepper JR, Mitchell JA. Cyclo-oxygenase-2 regulates inducible ICAM-1 and VCAM-1 expression in human vascular smooth muscle cells. Biochem Biophys Res Commun 1998;249:44-7. 9. Ludwig A, Lorenz M, Grimbo N, Steinle F, Meiners S, Bartsch C, et al. The tea flavonoid epigallocatechin-3-gallate reduces cytokine-induced VCAM-1 expression and monocyte adhesion to endothelial cells. Biochem Biophys Res Commun 2004;316:659-65. 10. Steele AD, Warfel JM, D’Agnillo F. Anthrax lethal toxin enhances cytokine-induced VCAM-1 expression on human endothelial cells. Biochem Biophys Res Commun 2005;337:1249-56. 11. Preiss DJ, Sattar N. Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract 2007;61:697-701. 12. Oguchi S, Dimayuga P, Zhu J, Chyu KY, Yano J, Shah PK, et al. Monoclonal antibody against vascular cell adhesion molecule-1 inhibits neointimal formation after periadventitial carotid artery injury in genetically hypercholesterolemic mice. Arterioscler Thromb Vasc Biol 2000; 20:1729-36.
JOURNAL OF VASCULAR SURGERY December 2009
13. Parker DG, Kaufmann C, Brereton HM, Anson DS, Francis-Staite L, Jessup CF, et al. Lentivirus-mediated gene transfer to the rat, ovine and human cornea. Gene Ther 2007;14:760-7. 14. Southern FN, Cruz N, Fink LM, Cooney CA, Barone GW, Eidt JF, et al. Hyperhomocysteinemia increases intimal hyperplasia in a rat carotid endarterectomy model. J Vasc Surg 1998;28:909-18. 15. Gao Y, Gao G, Long C, Han S, Zu P, Fang L, et al. Enhanced phosphorylation of cyclic AMP response element binding protein in the brain of mice following repetitive hypoxic exposure. Biochem Biophys Res Commun 2006;340:661-7. 16. Zhang N, Gao G, Bu X, Han S, Fang L, Li J. Neuron-specific phosphorylation of c-Jun N-terminal kinase increased in the brain of hypoxic preconditioned mice. Neurosci Lett 2007;423:219-24. 17. Wu J, Zhang X, Nauta HJ, Lin Q, Li J, Fang L. JNK1 regulates histone acetylation in trigeminal neurons following chemical stimulation. Biochem Biophys Res Commun 2008;376:781-6. 18. Fehm NP, Vatankhah B, Dittmar MS, Retzl G, Schuierer G, Horn M, et al. Application of clinical scanners in rats: experimental carotid imaging using magnetic resonance imaging, spiral computed tomography, and color duplex ultrasound. J Neuroimaging 2005;15:319-25. 19. Barbee RW, Stapleton DD, Madras DE, Re RN, Murgo JP, Davenport WD, et al. Retroviral suicide vector does not inhibit neointimal growth in a porcine coronary model of restenosis. Biochem Biophys Res Commun 1995;207:89-98. 20. Schanzer A, Hoel A, Owens CD, Wake N, Nguyen LL, Conte MS, et al. Restenosis after carotid endarterectomy performed with routine intraoperative duplex ultrasonography and arterial patch closure: a contemporary series. Vasc Endovasc Surg 2007;41:200-5. 21. Gallego J, Martinez VE, Munoz R. Patients at high risk for ischemic stroke: identification and actions. Cerebrovasc Dis 2007;24(Suppl 1): 49-63. 22. Kong D, Melo LG, Mangi AA, Zhang L, Lopez-Ilasaca M, Perrella MA, et al. Enhanced inhibition of neointimal hyperplasia by genetically engineered endothelial progenitor cells. Circulation 2004;109: 1769-75. 23. Wang K, Zhou X, Zhou Z, Mal N, Fan L, Zhang M, et al. Platelet, not endothelial, P-selectin is required for neointimal formation after vascular injury. Arterioscler Thromb Vasc Biol 2005;25:1584-9. 24. Patel S, Celermajer DS, Bao S. Atherosclerosis-underlying inflammatory mechanisms and clinical implications. Int J Biochem Cell Biol 2008;40:576-80. 25. Shimizu N, Suzuki H, Wakabayashi K, Iso Y, Shibata M, Yorozuya M, et al. [Expression of intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in the pig coronary artery injury model: comparison of plain old balloon angioplasty and stent implantation]. J Cardiol 2004;43:131-9. 26. Harlan JM, Winn RK. Leukocyte-endothelial interactions: clinical trials of anti-adhesion therapy. Crit Care Med 2002;30(5 Suppl):S214-9. 27. Bhoday J, de SS, Xu Q. The molecular mechanisms of vascular restenosis: Which genes are crucial? Curr Vasc Pharmacol 2006;4:269-75. 28. Schober A, Weber C. Mechanisms of monocyte recruitment in vascular repair after injury. Antioxid Redox Signal 2005;7:1249-57. 29. Lumsden AB, Chen C, Hughes JD, Kelly AB, Hanson SR, Harker LA. Anti-VLA-4 antibody reduces intimal hyperplasia in the endarterectomized carotid artery in nonhuman primates. J Vasc Surg 1997;26: 87-93. 30. Suzuki J, Izawa A, Isobe M. Anti-vascular cell adhesion molecule-1 and anti-very late antigen-4 monoclonal antibodies inhibit neointimal hyperplasia in the murine model of arterial injury. Acta Cardiol 2004;59: 147-52. Submitted May 17, 2009; accepted Aug 15, 2009.