Cryopreservation of viroid-infected chrysanthemum shoot tips

Scientia Horticulturae 244 (2019) 1–9

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Cryopreservation of viroid-infected chrysanthemum shoot tips a,b

Jing-Wei Li , Munetaka Hosokawa ⁎⁎ Qiao-Chun Wanga,

b,c,⁎

b

b

T b

, Tomoyuki Nabeshima , Ko Motoki , Haruka Yamada ,

a

State Key Laboratory of Crop Stress Biology for Arid Areas, Key Laboratory of Genetic Improvement of Horticultural Crops of Northwest China, College of Horticulture, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan c Faculty of Agriculture, Kindai University, 3327-204, Naka machi, Nara, 631-8505, Japan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Chrysanthemum CChMVd Cryopreservation CSVd In situ hybridization Shoot tips

Chrysanthemum stunt viroid (CSVd) and chrysanthemum chlorotic mottle viroid (CChMVd) are the two viroids most frequently infecting chrysanthemum. This study attempted to cryopreserve in vitro shoot tips of Chrysanthemum morifolium ‘Piato’ infected with high or low titers of CSVd, and co-infected with CSVd and CChMVd. By optimizing several key factors including the time and light regimes during cold-hardening of stock shoots, and the size of shoot tips, an encapsulation-vitrification procedure was established for cryopreservation of viroid-infected shoot tips. Viroid-infected stock shoots were cold-hardened in vitro at 4 °C in a 16-h photoperiod for 6 weeks. Shoot tips (1.5 mm in size) containing 3-4 LPs were excised from the cold-hardened stock shoots and subjected to encapsulation-vitrification cryopreservation. With this protocol, about 65%, 45% and 42% of shoot regrowth levels were obtained in cryopreserved shoot tips derived from in vitro stock shoots infected with low or high titers of CSVd, and co-infected with CSVd and CChMVd, respectively. All regenerants from cryopreservation maintained their viroid-infected status, identical to those of their in vitro stock shoots. Histological observations and in situ hybridization elucidated why cryopreservation could maintain viroids in cryopreserved shoot tips. Cryopreservation of viroid-infected plant materials has potential applications to all types of viroid-related basic and applied studies.

1. Introduction Chrysanthemum (Chrysanthemum morifolium), the second most economically important ornamental crop worldwide, is mainly used as cut and potted flowers (Anderson, 2006), as medicine (China Pharmacopoeia Commission, 2010), edible flowers and important additives to many beverages (Wang et al., 2014a). Availability of and easy access to diverse genetic resources are necessary for genetic improvements to obtain novel cultivars in both traditional and biotechnological programs (Wang et al., 2014b). Cryopreservation is at present time considered an ideal mean for the longterm conservation of plant genetic resources (Engelmann, 2011; Wang et al., 2014b; Li et al., 2017a). Since 1990s, various cryogenic procedures have been developed for cryopreservation of chrysanthemum shoot tips, including two-step cooling (Fukai, 1990), preculture-desiccation (Hitmi et al., 1999, 2000) and dimethyl sulfoxide (DMSO) droplet (Halmagyi et al., 2004), and vitrification-based methods such as encapsulation–dehydration (Sakai et al., 2000; Halmagyi et al., 2004;

⁎

Martín and González-Benito, 2005; Martín et al., 2011), vitrification (Martín and González-Benito, 2005; Jeon et al., 2015) and droplet-vitrification (Halmagyi et al., 2004; Lee et al., 2011; Wang et al., 2014c; Bi et al., 2017). Plant growth, flower production, genetic stability and biochemical compounds have been assessed in the regenerants of chrysanthemum following cryopreservation (Martín and GonzálezBenito, 2005; Martín et al., 2011; Lee et al., 2011; Wang et al., 2014c; Bi et al., 2017), and the results were quite promising. These studies made chrysanthemum one of ornamental crops most amenable to cryopreservation. Viroids are small pathogens consisting of a small (250–400 nucleotides), nonprotein-coding, single-stranded, circular RNA that cause infectious diseases in various crops including chrysanthemum (Flores et al., 2005). Chrysanthemum stunt viroid (CSVd) and chrysanthemum chlorotic mottle viroid (CChMVd) are two viroids that infect chrysanthemum widely distributed in many of the chrysanthemum-growing countries (Liu et al., 2014; Flores et al., 2017; Palukaitis et al., 2017). CSVd is a member of the genus Pospiviroid in the family Pospiviroidae

Corresponding author at: Faculty of Agriculture, Kindai University, 3327-204, Naka machi, Nara, 631-8505, Japan. Corresponding author. E-mail addresses: [email protected] (M. Hosokawa), [email protected] (Q.-C. Wang).

⁎⁎

https://doi.org/10.1016/j.scienta.2018.09.004 Received 3 May 2018; Received in revised form 20 July 2018; Accepted 4 September 2018 0304-4238/ © 2018 Elsevier B.V. All rights reserved.

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

Precultured shoot tips were encapsulated with 3% (w/v) Na-alginate solution to form beads, each being 4–5 mm in diameter and containing one shoot tip. The beads were treated with a loading solution composed of MS supplemented with 0.4 M sucrose and 2 M glycerol at 25 °C in the dark for 1.5 h, followed by exposure to plant vitrification solution 2 (PVS2, Sakai et al., 1990) on ice for 5 h. PVS2 is composed of MS supplemented with 0.4 M sucrose, 30% (w/v) glycerol, 15% (w/v) dimethyl sulfoxide (DMSO) and 15% (w/v) ethylene glycol (pH 5.8). Following PVS2 dehydration, 10 beads were transferred into each of 2ml cryovials (Sarstedt, Nümbrecht, Germany) containing 1.0 ml PVS2, prior to direct immersion in liquid nitrogen (LN) for at least 1 h. Cryopreserved shoot tips were thawed by removing the frozen beads and immediately placing those at 38 °C for 2–3 min. Thawed beads were incubated in an unloading solution at room temperature for 20 min. Unloading solution is composed of MS containing 1.2 M sucrose. Cryopreserved, thawed shoot tips were extracted from the beads and post-thaw cultured on half-strength Knop medium (Knop, 1965) supplemented with 0.05 mg/l gibberellic acid (GA3) in the dark for 1 day, and then transferred onto MS in the light conditions for shoot regrowth. Shoot regrowth was defined as the percentage of the total number of shoot tips regenerating into normal shoots (≥5 mm) 4 weeks after postthaw culture. Three experiments were conducted to optimize some key factors affecting shoot regrowth in cryopreserved shoot tips, including time durations and light regimes of cold-hardening, and shoot tip sizes.

(Palukaitis et al., 2017), while CChMVd belongs to the genus Pelamoviroid in the family Avsunviroidae (Navarro and Flores, 1997; Flores et al., 2017). CSVd and CChMVd can be transmitted by mechanical inoculation, vegetative propagation and seeds, making chrysanthemum prone to viroid infection and accumulations from generation to generation by vegetative propagation (Palukaitis et al., 2017). Field-grown chrysanthemum plants are frequently infected by viroids, often in mixed infection (Liu et al., 2014). Surveys conducted in field-grown chrysanthemum showed CChMVd infection on 20% of cultivars in Akita, Japan (Yamamoto and Sano, 2006) and 10% in Karnataka, India (Adkar-Purushothama et al., 2015a), while those of CSVd infection were 11.5% in China (Zhang et al., 2011), 9.7–66.8% in South Korea (Chung et al., 2005), and 70% in India (Singh et al., 2010). Like other plants, in shoot tip cryopreservation of chrysanthemum, the source plants are collected from the field and maintained in greenhouse conditions. Then, explants are taken from the greenhouse-maintained source plants and introduced into in vitro cultures to establish stock shoots, from which shoot tips are excised and used for cryopreservation (Fukai, 1990; Fukai et al., 1994; Jeon et al., 2015). In all previous studies on cryopreservation of chrysanthemum, the sanitary status of in vitro stock cultures was never clarified, except in the study of Jeon et al. (2016), in which cryopreservation was tested for viroid eradication. Cryopreservation of viroid-infected plant materials has potential applications to all types of viroid-related basic and applied studies (Gómez et al., 2009; Adkar-Purushothama et al., 2015b). The present study attempted to cryopreserve shoot tips of in vitrogrown chrysanthemum shoots infected with low or high titers of CSVd, and co-infected with CSVd and CChMVd. Histological observations and in situ hybridization were conducted to investigate the mechanism making possible viroids that could be maintained in the regenerants recovered from cryopreserved shoot tips.

2.4. Histological observations Histological observations were performed on cryopreserved shoot tips derived from CSVd (low)-infected in vitro stock shoots cold-hardened in the light and dark for 6 weeks, as described by Li et al. (2017b), with some modifications. Shoot tips were collected 3 days after post-thaw culture and fixed overnight in FAA [3.7% paraformaldehyde (w/v), 5% acetic acid (v/v), and 50% ethanol (v/v)], dehydrated with ethanol series (50%, 70%, 90% and 95%, 2 h for each concentration) and stored in 100% ethanol. After embedding in paraffin, sections (5 μm) were cut with a microtome (RM2155, Leica, Germany) and stained with 0.05% toluidine blue (TB) (Sakai, 1973). Stained sections were observed under a microscope (BX53, Olympus, Japan). The total number of cells and the number of cells that appeared to be living were observed in cryopreserved shoot tips and recorded in each of the shoot tip cross sections by two operators and the resulting data were subjected to blind analysis. Shoot-tips that were freshly excised from in vitro stock shoots served as a positive control, while those that were freshly excised, directly immersed in LN were the negative control. Both positive and negative controls underwent the same histological processes as described above.

2. Materials and methods 2.1. Plant materials In vitro stock shoots of Chrysanthemum morifolium ‘Piato’ single-infected with low titer of CSVd (low), high titer of CSVd (high) and coinfected with CSVd and CChMVd, established by Hosokawa et al., 2004, 2005, were used. The viroid-infected status of the in vitro stock shoots was confirmed using reverse transcription PCR (RT-PCR), in situ hybridization and real-time RT-qPCR (supplementary material 1), as described below. Viroid-free ‘Piato’ in vitro stock shoots were not available. The cultures were maintained on a basic medium (BM) composed of Murashige and Skoog (1962) medium (MS) supplemented with 20 g/ l sucrose and 8 g/l agar (pH 5.8), and placed at 23 ± 3 °C under a 16-h photoperiod of light intensity of 40.5 μmol m–2s–1 provided by white fluorescent tubes, according to Hosokawa et al. (2004). Subculture was done every 3 weeks.

2.5. Viroid detection by RT-PCR Viroid detection was performed twice in the present study. The first time was conducted in in vitro stock shoots, to confirm their viroid status. The second was performed in the regenerants after two months of post-thaw culture following cryopreservation. CSVd and CChMVd detection by RT-PCR was conducted, according to Hosokawa et al. (2004) and Nabeshima et al. (2012), respectively. RNA was extracted from fresh leaves (0.1 mg) using sepasol-RNA I super G (Nakarai tesque, Kyoto, Japan), according to manufactory instructions. cDNA synthesis was conducted at 42 °C for 30 min in reaction solution containing 0.5 μL of 20 μM random primer (6–9 mer), 1 μg of total RNA, 1 μL of 10 mM dNTP mixture, 0.5 μL of 20 U RNase inhibitor (Toyobo Co., Ltd., Osaka, Japan), 0.5 μL of reverse transcriptase (Toyobo Co., Ltd., Osaka, Japan) and 2 μL of buffer, with RNase-free water added to reach a total volume of 10 μL. PCR reaction was done in 10 μL reaction volume containing 0.1 μL of each primer (20 μM each), 1 μL of 2 mM dNTPs, 0.1 μL of 2U Blend Taq DNA polymerase (Toyobo

2.2. Cold-hardening of in vitro stock shoots Terminal shoot segments (3 cm in length) with two fully-opened leaves (Fig. 1A) were excised from 3-weeks old in vitro stock shoots and cultured on MS medium. The cultures were cold-hardened for up to 6 weeks at 4 °C under two light regimes: 16-h photoperiod with 40.5 μmol m–2s–1 intensity (light) and consistent darkness (dark). Shoot growth and morphologies were recorded after 4 and 6 weeks of the cold-hardening treatments. 2.3. Encapsulation-vitrification cryopreservation Shoot tips excised from viroid-infected stock shoots that had been cold-hardened were used for cryopreservation, as described by Li et al. (2017b), with some modifications. Shoot tips were precultured on MS medium supplemented with 0.5 M sucrose at 25 °C in the dark for 16 h. 2

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

Fig. 1. Growth and morphologies of in vitro viroid-infected C. morifolium ‘Piato’ shoots cold-hardened at 4 °C in 16-h photoperiod (light) and consistent darkness (dark) for 4 and 6 weeks. An explant used for cold-hardening (A); Shoots cold-hardened in light (B, C, D, H, I and J) and the dark (E, F, G, K, L and M) for 4 weeks (B, C, D, E, F and G) for 6 weeks (H, I, J, K, L and M). CSVd (low) = shoots infected with low titers of CSVd; CSVd (high) = shoots infected with high titers of CSVd; CSVd + CChMVd = shoots co-infected with CSVd + CChMVd. Bars indicate 1 cm.

Co., Ltd., Osaka, Japan) and 1.0 μL of its corresponding buffer, 1.0 μL of template cDNA and 6.7 μL RNase-free water. PCR amplification was performed in a thermal cycler using the following program for both CSVd and CChMVd: initial denaturation step at 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, followed by the final extension step at 72 °C for 5 min. Primers (forward: 5′-CAAC TGAAGCTTCAACGCCTT-3′ and reverse: 5′-AGGATTACTCCTGTCTC GCA-3′) were used to amplify a specific cDNA fragment (252 bp) of CSVd (Hosokawa et al., 2004), while those (PI: 5′-TGGGACTGGCCCC ATCTCCCTTCTCC-3′) and PII: 5′-GTCGGTTCGCTCTCGTAG-TCACA GCC-3′) were used to amplify the full-length cDNA (399 bp) of CChMVd (Navarro and Flores, 1997).

buffer (0.3 M NaCl, 30 mM trisodium citrate) at 52 °C and soaked in 0.5% blocking reagent (Roche Diagnostics Inc., Basel, Switzerland) and anti-DIG alkaline phosphatase conjugate containing 0.1% albumin from bovine serum (BSA). After the slides were washed, CSVd and CChMVd signals were detected with NBT/BCIP (Roche Diagnostics Inc., Basel, Switzerland). 2.7. Viroid detection by real-time RT-qPCR The RNA extraction and cDNA synthesis were performed according to RT-PCR mentioned above. Relative quantification of CSVd and CChMVd titers was performed by real-time RT-qPCR according to Nabeshima et al. (2012) with some modifications. Each real-time RTqPCR mixture consisted of 5 μl SYBR Premix Ex Taq (Takara Bio Inc.), 0.8 μM forward and reverse primers, 1 μl template cDNA and adjusted to 10 μl by sterilized distilled water. Primer sequences are presented as follow: CSVd-NF: 5’CCAGTGGTCGTACAACTGGCATT3’ and CSVd-NR: 5’-CAGTCAGATCACGACCAGCAAGATC-3’ for CSVd, CChMVd F28: 5’ATCCATGACAGGATCGAAAC-3’ and CChMVd R269: 5’-CCGAGGAGA ATATCCAAC -GA-3’ for CChMVd, Actin-F: 5’-CCAGTGGTCGTACAACT GGCATT-3’ and Actin-R: 5’-CAGTCAGATCACGACCAGCAAGATC-3’ for the chrysanthemum actin gene. Forty cycles were conducted at 95 °C for 10 s, and at 60 °C for 15 s.

2.6. Viroid localization by in situ hybridization Shoot tips of in vitro stock shoots of C. morifolium ‘Piato’ single-infected with CSVd (low) or CSVd (high), and co-infected with CSVd and CChMVd were used for viroid localization using in situ hybridization. Shoot tips excised from in vitro shoots of healthy C. morifolium ‘Sei Hillary’ were used as a negative control, because no healthy ‘Piato’ cultures were available. In situ hybridization was conducted according to Nabeshima et al. (2012). Shoot tips were fixed with FAA solution [3.7% paraformaldehyde (w/v), 5% acetic acid (v/v), and 50% ethanol (v/v)] at 4 °C overnight. The fixed tissues were dehydrated and embedded in paraffin (Paraplast Plus, Sigma-Aldrich, St. Louis, USA). The tissues were cut into 10-μm sections and dried overnight. RNA extraction, cDNA synthesis and PCR were conducted as mentioned above. Same primers were involved in this section. CSVd and CChMVd RT-PCR products which had been cloned into pTAC-1 (BioDynamics Laboratory Inc., Tokyo, Japan) were used as the template for probe synthesis. Purified plasmid was linearized by restrictive endonuclease XbaI (Toyobo Co., Ltd., Osaka, Japan) according to its instruction. Hybridization was performed overnight at 52 °C with digoxigenin (DIG)labeled RNA probes which were transcrived in vitro with T7 RNA polymerase using a DIG RNA Labeling Kit (Roche Diagnostics Inc., Basel, Switzerland). Sections were washed twice with half-strength SSC

2.8. Experiment design and statistical analysis In experiments of cryopreservation, at least 10 samples were employed in each treatment of three replicates, and the whole experiment was repeated twice. The data were analyzed using one-way ANOVA and Student’s t-test. Least significant differences (LSD) were calculated at P < 0.05. Ten samples were used in each treatment of histological observations. Sanitary status of in vitro stock shoots was detected by RTPCR for CSVd and CChMVd. CSVd-infected in vitro stock shoots were further analyzed by in situ hybridization for their viroid titers. Only those with their sanitary status confirmed were used in the cryopreservation experiments. Twenty regenerants recovered from each of 3

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

treatments in cryopreservation experiments were used for CSVd and CChMVd detection by RT-PCR. Viroid localization in shoot tips of diseased in vitro stock shoots were analyzed by in situ hybridization. 3. Results 3.1. Growth and morphologies of viroid-infected in vitro stock shoots following cold-hardening Light regime and time duration of cold-hardening affected growth and morphologies of viroid-infected in vitro stock shoots. Shoots coldhardened in the light were shorter and thicker (Fig. 1B, C, D, H, I and J) than those (Fig. 1E, F, G, K, L and M) in the dark, regardless of their viroid-infected status. Cold-hardening in the dark induced formation of etiolated shoots, and this effect increased with the duration of coldhardening from 4 (Fig. 1E, F and G) to 6 weeks (Fig. 1K, L and M) in the three types of viroid-infected shoots. Reddish coloration was observed in the three types of viroid-infected in vitro stock shoots (Fig. 1B, C, D, H, I and J), when cold-hardened in the light condition, but not in darkness, for 4 and 6 weeks. The reddish coloration was stronger in stock shoots cold-hardened in the light condition for 6 weeks (Fig. 1H, I and J) than in those for 4 weeks (Fig. 1B, C and D). Leaves became chlorotic in stock shoots infected with CSVd (high) (Fig. 1C and I) and co-infected with CSVd and CChMVd (Fig. 1D and J), but not in those infected with CVSd (low) (Fig. B and H), after 4 and 6 weeks of coldhardening in the light. No chlorotic leaves were observed in all types of viroid-infected shoots (Fig. 1E, F and G) after 4 weeks of cold-hardening in the dark, but slightly chlorotic leaves were found in the three viroidinfected stock shoots (Fig. 1K, L and M) after 6 weeks of cold-hardening.

Fig. 3. Effects of time durations of cold-hardening of three types of viroid-infected in vitro stock shoots on shoot regrowth of cryopreserved shoot tips of C. morifolium ‘Piato’. Shoot tips (1.5 mm) were excised from in vitro stock shoots that had been coldhardened at 4 °C in a 16-h photoperiod for 0 to 6 weeks and used for cryopreservation. Bars indicate standard errors calculated by one-way ANOVA.

regenerate shoots (Fig. 2E). Time durations and light regimes of cold-hardening of viroid-infected in vitro stock shoots affected shoot regrowth in cryopreserved shoot tips. No shoot regrowth was obtained in stock shoots without cold hardening and cold-hardened for 2 weeks, regardless of their viroidinfected status (Fig. 3). Similar shoot regrowth levels (42–45%) were found in cryopreserved shoot tips excised from the three types of viroidinfected stock shoots cold-hardened for 4 weeks (Fig. 3). Shoot regrowth levels significantly increased to about 65% when CSVd (low)infected in vitro stock shoots were cold-hardened for 6 weeks, while shoot regrowth levels were similar when in vitro stock shoots infected

3.2. Cryopreservation Surviving shoot tips showed green color (Fig. 2A), while dead ones turned white-black (Fig. 2B) after 3 days of post-thaw culture. Surviving shoot tips started to elongate (Fig. 2C) and eventually developed into plantlets with roots after 10 weeks of post-thaw culture (Fig. 2D). About 15% of surviving shoot tips developed only leaves and failed to

Fig. 2. Recovery of cryopreserved CSVd (low)-infected shoot tips of C. morifolium ‘Piato’. Surviving (A) and killed (B) shoot tips after 3 days of post-thaw culture. A surviving shoot tips started to elongate shoot after 7 days of post-thaw culture (C). A plantlet regenerated from cryopreserved shoot tips after 10 weeks of post-thaw culture (D). A cryopreserved shoot tip developed only leaves without shoot elongation after 4 weeks of post-thaw culture (E). Bars in A, B, C and E = 1 mm, and in D = 1 cm.

4

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

about 42% in 1.0 mm-shoot tips and was similar in 1.5 mm-shoot tips. With stock shoots infected with CSVd (low), shoot growth levels increased to about 45% in 1.0 mm-shoot tips and further increased to about 63% in 1.5 mm-shoot tips. ANOVA analysis showed that each parameter, viroid infection types, cold hardening periods, shoot tip sizes and light regime during cold-hardening, had significant influence (P < 0.05) on the final regrowth rate of ‘Piato’ shoot tips (Supplementary material 2). Additionally, low-infected shoot tips leaded to a significant higher regeneration rate compared with other two counterparts, while no significant difference was observed between CSVd single-infected and CSVd+CChMVd co-infected materials (Figs. 3 and 5). 3.3. Histological observations The positive control living cells had densely TB-stained and wellpreserved cytoplasm with the nucleolus enclosed in the nucleus (Fig. 6A). Dead cells, as observed in the negative control, had reduced levels of TB-stained cytoplasm (Fig. 6B), a typical sign of ruptured plasma membranes. Similar cell survival patterns were observed in cryopreserved shoot tips excised from in vitro stock shoots cold-hardened in the light: cells locating in upper parts of apical dome (AD) and the youngest leaf primordia (LPs) (1-4) were able to survive after cryopreservation. Cell survival patterns of cryopreserved 1.5 mm-shoot tips excised from stock shoots cold-hardened in the light and in the dark are presented in Fig. 6C and D. However, the number of surviving cells varied with sizes of shoot tips and light regimes of cold-hardening (Table 1). The number of surviving cells in AD was greatest in 1.5 mmshoot tips excised from stock shoots cold-hardened in the light, followed by those of 1.0 mm cold-hardened in the light, 1.5 mm coldhardened in the dark and 1.0 mm in the dark (Table 1). No differences in the number of surviving cells in LPs were found between cryopreserved 1.5 mm- and 1.0 mm-shoot tips excised from stock shoots coldhardened in the light, which were much higher than those obtained of the same sizes of cryopreserved shoot tips excised from stock shoots cold-hardened in the dark (Table 1).

Fig. 4. Effects of light regimes used for cold-hardening of three types of viroidsinfected in vitro stock shoots on shoot regrowth in cryopreserved shoot tips of C. morifolium ‘Piato’. Shoot tips (1.5 mm) were excised from in vitro stock shoots that had been coldhardened at 4 °C in a 16-h photoperiod (light) and in a consistent darkness (dark) for 6 weeks and used for cryopreservation. Data were presented as means ± SE and with different letters indicated significant differences at P < 0.05 Student’s t-test

with CSVd (high), and co-infected with CSVd and CChMVd were coldhardened for 6 weeks (Fig. 3). Shoot regrowth levels were higher in cryopreserved shoot tips excised from in vitro stock shoots cold-hardened in the light than in the dark, regardless of their viroid-infected status (Fig. 4). Higher shoot regrowth levels were obtained in CSVd (low)-infected stock shoots than in those infected with CSVd (high), and co-infected with CSVd and CChMVd when stock shoot were cold-hardened both in the light and dark (Fig. 4). Sizes of shoot tips affected shoot regrowth levels in cryopreserved shoot tips excised from the three types of viroid-infected in vitro stock shoots cold-hardened in the light for 6 weeks. No shoot regrowth was found in 0.5 mm-shoot tips, regardless of their viroid-infected status (Fig. 5). With stock shoots co-infected with CSVd and CChMVd, shoot regrowth levels reached about 31% in 1.0 mm-shoot tips and significantly increased to about 42% in 1.5 mm-shoot tips. With stock shoots infected with CSVd (high), shoot regrowth level increased to

3.4. Viroid detection by RT-PCR When RT-PCR was applied to detect viroid infections, positive controls showed a specific band of 252 bp for CSVd (Fig. 7A) and 399 bp for CChMVd (Fig. 7B), while such bands were not detected in negative control (Fig. 7A, B). CSVd was detected in all CSVd (low)- and (high)-infected in vitro stock shoots used for cryopreservation (Fig. 7A). Specific bands of CSVd in CSVd (low)-infected in vitro stock shoots were weaker than those in CSVd (high)-infected in vitro stock shoots (Fig. 7A). CSVd was also detected in all regenerants recovered from cryopreserved shoot tips derived from CSVd (low)- and (high)-infected in vitro stock shoots (Fig. 7A). All in vitro stock shoots co-infected with CSVd and CChMVd showed specific bands of CSVd (Fig. 7A) and CChMVd (Fig. 7B), respectively. CSVd (Fig. 7A) and CChMVd (Fig. 7B) were also detected in all regenerants recovered from cryopreserved shoot tips derived from in vitro stock shoots co-infected with CSVd and CChMVd. 3.5. Viroid localization by in situ hybridization With in situ hybridization for localization of viroid in shoot tips, strand-specific DIG-labeled CSVd or CChMVd antisense probes produced blue color reaction, indicating presence of viroid, in CSVd- or CChMVd-infected cells, while no such color reactions were seen in the healthy sample (Fig. 8A and a). CSVd signals were detected in shoot AD and the youngest LPs in shoot tips infected with CSVd (low) (Fig. 8B and b) and CSVd (high) (Fig. 8C and c). The viroid signals were weaker in CSVd (low)-infected shoot tips (Fig. 8C and c) than in CSVd (high)infected ones. These data and results of viroid detection by RT-PCR

Fig. 5. Effects of shoot tip sizes on shoot regrowth in cryopreserved shoot tips excised from three types of viroid-infected in vitro stock shoots of C. morifolium ‘Piato’. Three sizes of shoot tips (0.5 mm without leaf primordium (LP), 1.0 mm with 12 LPs and 1.5 mm without 3-4 LPs) were excised from in vitro stock shoots that had been cold-hardened at 4 °C in a 16-h photoperiod for 6 weeks and used for cryopreservation. Bars indicate standard errors calculated by one-way ANOVA. 5

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

Fig. 6. Histological observations of longitudinal sections of cryopreserved shoot tips (1.5 mm) excised from CSVd (low)-infected stock shoots of C. morifolium ‘Piato’ cold-hardened at 4 °C in the light and dark for 6 weeks. Positive control showing living cells (A) and negative control showing dead cells (B). Cell survival patterns in cryopreserved shoot tips excised from stock shoots cold-harden in the light (C) and dark (D). Living and killed or damaged cells are indicated by white and black arrows, respectively. AD = apical dome; LPleaf = leaf primordium. Bars in A and B = 1 μm, and in C and D = 10 μm.

Betula pendula, Ryynänen (1996, 1998) found that in vitro stock shoots cold-hardened in the light were shorter and thicker than non-coldhardened ones, and that leaves were yellow compared with non-coldhardened ones. Cold-hardening in the light was found to reduce shoot length and induce leaf necrosis of the in vitro stock shoots in chrysanthemum ‘Ency’ infected with CSVd (Savitri et al., 2013). Similar results were found when in vitro stock shoots were cold-hardened in the light in the present study. Shoots incubated under dark exhibited green and no necrosis, with the whole water content was higher than that of those exposed to light. Moreover, being kept under dark, the newly formed shoot terminals were fragile and lack of fiber (data not shown). In addition, we further found cold-hardening in the light induced reddish coloration of in vitro stock shoots, while not in the dark. The reddish coloration observed in cold-hardened in vitro stock shoots indicated accumulation of anthocyanin, as reported in in vitro shoots of Torenia fournieri (Nagira and Ozeki, 2004). Light is necessary for accumulation of anthocyanin and light combining with low temperature improved accumulations of anthocyanin (Nagira and Ozeki, 2004). Cold-hardening has been widely used to precondition stock shoots before shoot tip cryopreservation in a number of species including woody and herbaceous plants (Ryynänen, 1996, 1998; Hirai and Sakai, 1999; Channuntapipat et al., 2000; Bilavčík et al., 2012; Panta et al., 2015; Arizaga et al., 2017). In cryopreservation of chrysanthemum, cold-hardening of stock shoots was usually not included (Fukai, 1990; Fukai and Oe, 1990; Fukai et al., 1994; Halmagyi et al., 2004; Lee et al., 2011; Wang et al., 2014c) and only a few studies used cold-hardening (Tanaka et al., 2014). Almost all results so far obtained showed that cold-hardening significantly improved recovery of cryopreserved shoot tips, except for quite a few cases in which cryopreserved shoot tips, for example of B. pendula, showed browning and a lag phase of shoot regrowth when in vitro stock shoots were cold-hardened, compared with non-cold-hardened ones (Ryynänen, 1996, 1998). Prolonged cold hardening helps improving the cryopreservation efficiency has been well reported. Zhao et al. (2005) pointed out that potato (Solanum tuberosum) shoot tips which were chilled for 3 weeks under 10 °C resulted in a significant higher recovery compared with those cold hardened only for 1 or 2 weeks. However, over-chilling (4 weeks) may decrease

Table 1 Cell survival percentages in cryopreserved shoot tips of CSVd (low)-infected in vitro stock shoots of Chrysanthemum morifolium ‘Piato’ cold-hardened at 4 °C in the light and dark for 6 weeks. Light regime in coldhardening

Light Dark

Size of shoot tips (mm)

1.0 1.5 1.0 1.5

Cell survival percentage (%) Apical dome

Leaf primordia

53.3 65.5 42.0 43.2

42.7 43.5 32.5 33.5

± ± ± ±

5.5 6.2 5.1 4.5

a b a a

± ± ± ±

4.1 5.3 4.6 4.4

a a a a

Data are presented as means ± SE and with different letters in the same tissues indicate significant differences at P < 0.05 by Student’s t-test.

presented above confirmed viroid titer was lower in CSVd (low)-infected samples than in CSVd (high)-infected samples. CChMVd signals with similar distribution patterns to CSVd were also detected in shoot tips co-infected with CSVd and CChMVd (Fig. 8D and d).

4. Discussion 4.1. Optimal conditions for cryopreservation of viroid-infected chrysanthemum The present study used three types of viroid-infected stock shoots of Chrysanthemum morifolium ‘Piato’ for encapsulation-vitrification cryopreservation. With the optimized parameters, about 65%, 45% and 42% of shoot regrowth levels were obtained in cryopreserved shoot tips excised from in vitro stock shoots infected with CSVd (low) or (high), and co-infected with CSVd and CChMVd, respectively. All regenerants from cryopreservation maintained their viroid-infected status, identical to those of in vitro stock shoots. Since no viroid-free stock shoots of the same cultivar were available, we could only compare results produced among samples with different viroid-infected status. Effects of cold-hardening on growth and morphologies of cold-hardened in vitro stock shoots have received limited attention. Working on

Fig. 7. Detection of CSVd (A) and CChMVd (B) by RT-PCR in in vitro stock shoots before cold-hardening and shoots regenerated from cryopreserved shoot tips of C. morifolium ‘Piato’ after 8 weeks of post-thaw culture. M = molecular marker (100 bp ladder); P = viroid positive control; N = negative control ‘Sei Hillary’; lane 1 in. A = CSVd (high)-infected in vitro stock shoots; lanes 2 in. A = in vitro stock shoots co-infected with CSVd + CChMVd; lane 3 in. A = regenerants recovered from cryopreserved shoot tips derived from CSVd (high)-infected in vitro stock shoots; lane 4 in. A = regenerants recovered from cryopreserved shoot tips derived from in vitro stock shoots coinfected with CSVd + CChMV; lanes 5–6 in A = CSVd (low)infected in vitro stock shoots; lanes 7–8 in.(A) = regenerants recovered from cryopreserved shoot tips derived from CSVd (low)-infected in vitro stock shoots; lanes 1–4 in B = in vitro stock shoots co-infected with CSVd + CChMVd; lanes 5–8 in B = regenerants recovered from cryopreserved shoot tips derived from in vitro stock shoots co-infected with CSVd + CChMVd. 6

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

Fig. 8. In situ hybridization of CSVd and CChMVd in viroid-infected shoot tips of in vitro stock shoots of C. morifolium ‘Piato’. Healthy shoot tips of C. morifolium ‘Sei Hillary’ serving as negative control (A, a). CSVd in CSVd (low)-infected shoot tips (B, b). CSVd in CSVd (high)-infected shoot tips (C, c). CChMVd in shoot tips co-infected with CSVd + CChMVd (D, d). Closer views (a, b, c and d) from the black squares in A, B, C and D, respectively. AD = apical dome; LP = leaf primordium. Arrows in b, c and d indicate viroid infection. Bars = 40 μm.

from the three types of viroid-infected stock shoots cold-hardened in the light, but they were not significantly affected in sizes of shoot tips derived from stock shoots cold-hardened in the dark. These results indicate that larger shoot tips are needed for obtaining optimal shoot regrowth levels in chrysanthemum, as reported by Wang et al. (2014c). Up to now, the main task of cryopreservation is to establish high efficiency working protocols according to various plant species, which serves for plant gene bank enrichment. The optimal size of shoot tips varies with different genotypes. To the best of our knowledge, no enough work and evidences can tell the mechanism that how shoot tip sizes affect cryopreservation efficiency.

the cryopreservation efficiency. Similar result was confirmed by Hirai and Sakai (1999), when mint (Mentha spicata) axillary meristem shoot tips were conserved by encapsulation vitrification: 3 weeks cold hardening under 4 °C leaded to the highest regeneration rate compared with 1 and 2 weeks chilling. Results reported in present study verified the positive role of cold hardening of in vitro stock shoots on recovery of cryopreserved shoot tips, as reported on various plants including chrysanthemum (Hirai and Sakai, 1999; Channuntapipat et al., 2000; Bilavčík et al., 2012; Panta et al., 2015; Tanaka et al., 2014; Arizaga et al., 2017), and prolonged cold hardening (6-weeks) leaded to a significant higher regeneration. Cold hardening of stock shoots was usually performed in light conditions (Ryynänen, 1996, 1998; Hirai and Sakai, 1999; Channuntapipat et al., 2000; Bilavčík et al., 2012; Panta et al., 2015; Yi et al., 2013; Arizaga et al., 2017), some in the dark (Wang et al., 2013, 2017), and sometimes was conducted only during the dark period (Reed, 1990). Very limited evidences have been revealed that how photoperiods during cold hardening affect cryopreservation recovery rate, also, seldom has been done on the comparison between illumination and darkness when chilling was conducting. Ryynänen (1998) reported that cold hardening of stock shoots under 8-h photoperiod produced higher shoot regrowth than under 16-h photoperiod. While the most effective cold hardening treatments varies with species, we felt oblige to test this parameter which has often been overlooked in previous studies. In this study, we compared effects of light regimes (light and dark) of cold-hardening on recovery of cryopreserved shoot tips, and found that shoot regrowth levels were significantly higher in cryopreserved shoot tips derived from the three types of viroid-infected stock shoots cold-hardened in the light than in the dark. As we mentioned before, water and fiber content were different between two treatments. While content of water in shoot tips is a key factor that affects the final cryopreservation regeneration, not enough dehydration leads to a poor result. Shoot growth of those incubated under light was highly inhibited, also, these shoot tips were much more compact compared with the dark-incubated counterparts. Additionally, we speculate that the light and cold induced accumulation of anthocyanin is likely responsible for the improved shoot regrowth after shoot tip cryopreservation found in present study. Size of shoot tips was found to influence recovery of cryopreserved shoots and suitable size varied with plant species. For some plant species like S. tuberosum (Halmagyi et al., 2005), Ipomoea batatas (Wang and Valkonen, 2008), Malus (Li et al., 2014) and chrysanthemum (Wang et al., 2014c), larger shoot tips produced higher shoot regrowth levels than smaller ones. In contrast, for other plant species, like Castanea sativa (Vidal et al., 2005) and Allium sativum (Kim et al., 2005), smaller shoot tips resulted in the higher levels. In the present study, we found shoot regrowth levels were higher in larger shoot tips derived

4.2. Viroid-free plants are difficult to be obtained by cryo-treatment Analysis by RT-PCR in the present study showed that sanitary status of regenerants recovered from cryopreserved shoot tips was identical to that of in vitro stock shoots, indicating that viroids were cryopreserved in living shoot tips. Failure of cryopreservation to eradicate CSVd from diseased Argyranthemum shoot tips was also reported by Zhang et al. (2014). Results of in situ hybridization reported by Zhang et al. (2015,2016)and in the present study showed that CSVd and CChMVd widely distributed in the AD and the youngest LPs (Zhang et al., 2015,2016). Histological observations conducted in the present study showed that cells in the AD and the youngest LPs survived following cryopreservation. These data provide clear explanations as to why shoot tip cryopreservation failed to eradicate CSVd and CChMVd. Recently, Jeon et al. (2016) reported shoot tip cryopreservation produced 13.3% of CSVd-free and 20% of CChMVd-free plants from chrysanthemum shoots infected with low titers of viroids. Whether or not tissues other than shoot apical meristems die after cryo-treatment is an important factor for cryotherapy. One possible explanation is the difference of cultivars which have different tolerance for cryo-treatment. In conclusion, the present study successfully cryopreserved shoot tips of three types of viroid-infected plants. Field collections of diseased plant materials are vulnerable to attacks by pests and diseases and to extreme climates, which may cause total loss of the stored materials, and may alter sanitary status of the stored materials. In vitro storage needs periodical subculture, which cause contamination of the stored materials. It is also time-consuming and labor-expensive. Healthy ‘Piato’ stock was conserved separately with viroid-infected plants in vitro for at least ten years (Hosokawa et al., 2004); we accidentally infected viroid to healthy plants by sub-culture propagation. Our case emphasizes the risk of losing precious plant stocks by in vitro long-term preservation. Cryopreservation of viroid-infected chrysanthemum plant materials provides advantages over both field collection and in vitro storage of viroids-infected plants. We previously reported cryopreservation of Apple stem grooving virus in shoot tips. No alternations in 7

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

infectious ability and gene sequences were detected in the cryopreserved virus. Further studies on testing infectious ability and gene sequences of cryopreserved viroids are under studies.

Landwirtsch. Vers. Stn. 7, 93–107. Lee, Y.G., Park, S.U., Kim, H.H., 2011. Cryopreservation of chrysanthemum shoot tips using the droplet-vitrification technique. Korean J. Agric. Sci. 38, 227–233. Li, B.Q., Feng, C.H., Hu, L.Y., Wang, M.R., Chen, L., Wang, Q.C., 2014. Shoot regeneration and cryopreservation of shoot tips of apple (Malus) by encapsulation–dehydration. In Vitro Cell. Dev. Biol. Plant 50, 357–368. Li, J.W., Ozudogru, E.A., Li, J., Wang, M.R., Bi, W.L., Lambardi, M., Wang, Q.C., 2017a. Cryobiotechnology of forest trees: recent advances and future prospects. Biodivers. Conserv. 27, 795–814. Li, J.W., Chen, H.Y., Li, X.Y., Zhang, Z.B., Blystad, D.R., Wang, Q.C., 2017b. Cryopreservation and evaluations of vegetative growth, microtuber production and genetic stability in regenerants of purple-fleshed potato. Plant Cell Tiss. Org. Cult. 128, 641–653. Liu, X.L., Zhao, X.T., Muhammad, I., Ge, B.B., Hong, B., 2014. Multiplex reverse transcription loop-mediated isothermal amplification for the simultaneous detection of CVB and CSVd in chrysanthemum. J. Virol. Methods 210, 26–31. Martín, C., González-Benito, M.E., 2005. Survival and genetic stability of Dendranthema grandiflora Tzvelev shoot apices after cryopreservation by vitrification and encapsulation–dehydration. Cryobiology 51, 281–289. Martín, C., Cervera, M.T., González-Benito, M.E., 2011. Genetic stability analysis of chrysanthemum (Chrysanthemum x morifolium Ramat) after different stages of an encapsulation–dehydration cryopreservation protocol. J. Plant Physiol. 168, 158–166. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio assays with tobacco cell cultures. Physiol. Plant. 15, 473–497. Nabeshima, T., Hosokawa, M., Yano, S., Ohishi, K., Doi, M., 2012. Screening of chrysanthemum cultivars with resistance to Chrysanthemum stunt viroid. J. Jpn. Soc. Hort. Sci. 81, 285–294. Nagira, Y., Ozeki, Y., 2004. A system in which anthocyanin synthesis is induced in regenerated torenia shoots. J. Plant Res. 117, 377–383. Navarro, B., Flores, R., 1997. Chrysanthemum chlorotic mottle viroid: unusual structural properties of a subgroup of self-cleaving viroids with hammerhead ribozymes. Proc. Natl. Acad. Sci. U. S. A. 94, 11262–11267. Palukaitis, P., 2017. Chrysanthemum stunt viroid. In: Hadidi, A., Flores, R., Randles, J.W., Palukaitis, P. (Eds.), Viroids & Satellites. Elsevier, London, pp. 181–190. Panta, A., Panis, B., Ynouye, C., Swennen, R., Roca, W., Tay, D., Ellis, D., 2015. Improved cryopreservation method for the long-term conservation of the world potato germplasm collection. Plant Cell Tiss. Org. Cult. 120, 117–125. Reed, B.M., 1990. Survival of in vitro-grown apical meristems of Pyrus following cryopreservation. HortScience 25, 111–113. Ryynänen, L., 1996. Cold hardening and slow cooling: tools for successful cryopreservation and recovery of in vitro shoot tips of silver birch. Can. J. For. Res. 26, 2015–2022. Ryynänen, L., 1998. Effect of abscisic acid, cold Hardening, and photoperiod on recovery of cryopreserved in vitro shoot tips of silver birch. Cryobiology 36, 32–39. Sakai, W.S., 1973. Simple method for differential staining of paraffin embedded plant material using toluidine blue O. Stain Technol. 48, 247–249. Sakai, A., Kobayashi, S., Oiyama, I., 1990. Cryopreservation of nucellar cells of navel orange (Citrus sinensis Osb. Var. Brasiliensis Tanaka) by vitrification. Plant Cell Rep. 9, 30–33. Sakai, A., Matsumoto, T., Hirai, D., Niino, T., 2000. Newly developed encapsulation-dehydration protocol for plant cryopreservation. Cryo Lett. 21, 53–62. Savitri, W.D., Park, K.I., Jeon, S.M., Chung, M.Y., Han, J.S., Kim, C.K., 2013. Elimination of Chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Hort. Environ. Biotech. 54, 177–182. Singh, D., Pathania, M., Ram, R., Zaidi, A.A., 2010. Screening of chrysanthemum cultivars for Chrysanthemum stunt viroid in an Indian scenario. Arch. Phytopathol. Plant Protect. 43, 1517–1523. Tanaka, D., Akimoto-Kato, A., Niino, T., Matsumoto, T., 2014. Cryopreservation of chrysanthemum using aluminium Cryo-plate protocol. Cryobiology 69, 520–521. Vidal, N., Sánchez, C., Jorquera, L., Ballester, A., Vieitez, A.M., 2005. Cryopreservation of chestnut by vitrification of in vitro-grown shoot tips. In Vitro Cell. Dev. Biol. Plant 41, 63–68. Wang, Q.C., Valkonen, J.P.T., 2008. Efficient elimination of Sweetpotato little leaf phytoplasma from sweetpotato by cryotherapy of shoot tips. Plant Pathol. 57, 338–347. Wang, B., Wang, R.R., Li, J.W., Ma, Y.L., Sheng, W.M., Li, M.F., Wang, Q.C., 2013. Development of three vitrification-based cryopreservation procedures of shoot tips of China’s potato. Cryo Lett. 34, 369–380. Wang, S.H., Hao, L.J., Zhu, J.J., Zhang, Q.W., Wang, Z.M., Zhang, X., Song, X.M., 2014a. Study on the effects of sulfur fumigation on chemical constituents and antioxidant activity of Chrysanthemum morifolium cv. Hang-ju. Phytomedicine 21, 773–779. Wang, B., Wang, R.R., Cui, Z.H., Bi, W.L., Li, J.W., Li, B.Q., Ozudogru, E.A., Volk, G.M., Wang, Q.C., 2014b. Potential applications of cryogenic technologies to plant genetic improvement and pathogen eradication. Biotechnol. Adv. 32, 583–595. Wang, R.R., Gao, X.X., Chen, L., Huo, L.Q., Li, M.F., Wang, Q.C., 2014c. Shoot recovery and genetic integrity of Chrysanthemum morifolium shoot tips following cryopreservation by droplet-vitrification. Sci. Hortic. 176, 330–339. Wang, L.Y., Li, Y.D., Sun, H.Y., Liu, H.G., Tang, X.D., Wang, Q.C., Zhang, Z.D., 2017. An efficient droplet-vitrification cryopreservation for valuable blueberry germplasm. Sci. Hortic. 219, 60–69. Yamamoto, H., Sano, T., 2006. An epidemiological survey of Chrysanthemum chlorotic mottle viroid in Akita Prefecture as a model region in Japan. J. Gen. Plant Pathol. 72, 387–390. Yi, J.Y., Lee, G.A., Chung, J.W., Lee, S.Y., Lim, K.B., 2013. Efficient cryopreservation of Lilium spp. shoot tips using droplet-vitrification. Plant Breed. Biotech. 1, 131–136. Zhang, Z.X., Ge, B.B., Pan, S., Zhao, Z., Wang, H.Q., Li, S.F., 2011. Molecular detection

Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2018.09.004. References Adkar-Purushothama, C.R., Chennappa, G., Rao, K.P., Sreenivasa, M.Y., Prasad, M.N.N., Maheshwar, P.K., Sano, T., 2015a. Molecular identification of Chrysanthemum chlorotic mottle viroid infecting Chrysanthemum in Karnataka, India. Plant Dis. 99, 1868. Adkar-Purushothama, C.R., Zhang, Z., Li, S., Sano, T., 2015b. Analysis and application of viroid-specific small RNAs generated by viroid-inducing RNA silencing. In: In: Uyeda, I., Masuta, C. (Eds.), Plant Virology Protocols, Methods in Molecular Biology, vol. 1236. Humana Press, New York, pp. 135–170. Anderson, N.O., 2006. Chrysanthemum: Dendranthema x grandiflora tzvelv. In: Anderson, N.O. (Ed.), Flower Breeding and Genetics: Issues, Challenges and Opportunities for the 21st Century. Springer, Netherland, Heidelberg, pp. 389–437. Arizaga, M.V., Navarro, O.F.V., Martinez, C.R.C., Gutiérrez, E.J.C., Delgado, H.A.L., Yamamoto, S., Watanabe, K., Niino, T., 2017. Improvement to the D cryo-plate protocol applied to practical cryopreservation of in vitro grown potato shoot tips. Hort. J. 86, 222–228. Bi, W.L., Pan, C., Hao, X.Y., Cui, Z.H., Kher, M.M., Marković, Z., Wang, Q.C., Teixeira da Silva, J.A., 2017. Cryopreservation of grapevine (Vitis spp.)－a review. In Vitro Cell. Dev. Biol. Plant 53, 449–460. Bilavčík, A., Zámečník, J., Grospietsch, M., Faltus, M., Jadrná, P., 2012. Dormancy development during cold hardening of in vitro cultured Malus domestica Borkh. Plants in relation to their frost resistance and cryotolerance. Trees 26, 1181–1192. Channuntapipat, C., Collins, G., Bertozzi, T., Sedgley, M., 2000. Cryopreservation of in vitro almond shoot tips by vitrification. J. Hort. Sci. Biotech. 75, 228–232. China Pharmacopoeia Commission, 2010. Pharmacopoeia of the People’s Republic of China Vol.1 Chemical Industry Press, Beijing. Chung, B.N., Lim, J.H., Choi, S.Y., Kim, J.S., Lee, E.J., 2005. Occurance of Chrysanthemum stunt viroid in chrysanthemum in Korea. Plant Pathol. J. 21, 377–382. Engelmann, F., 2011. Use of biotechnologies for the conservation of plant biodiversity. In Vitro Cell. Dev. Biol. – Plant 47, 5–16. Flores, R., Hernández, C., Martínez de Alba, A.E., Daròs, J.A., Di Serio, F., 2005. Viroids and viroid–host interactions. Annu. Rev. Phytopathol. 43, 117–139. Flores, R., Gago, S., Serra, P., de la Peña, M., Navarro, B., 2017. Chrysanthemum chlorotic mottle viroid. In: Hadidi, A., Flores, R., Randles, J.W., Palukaitis, P. (Eds.), Viroids & Satellites. Elsevier, London, pp. 331–338. Fukai, S., 1990. Cryopreservation of chrysanthemum shoot tips. Sci. Hortic. 45, 167–174. Fukai, S., Oe, M., 1990. Morphological observations of chrysanthemum shoot tips cultured after cryoprotection and freezing. J. Japan. Soc. Hort. Sci. 59, 383–387. Fukai, S., Togashi, M., Goi, M., 1994. Cryopreservation of in vitro grown Dianthus by encapsulation-dehydration. Tech. Bull. Fac. Agric. Kagawa Univ. 46, 101–107. Gómez, G., Martínez, G., Pallás, V., 2009. Interplay between viroid-induced pathogenesis and RNA silencing pathways. Trends Plant Sci. 14, 264–269. Halmagyi, A., Fischer-Klüver, G., Mix-Wagner, G., Schumacher, H.M., 2004. Cryopreservation of Chrysanthemum morifolium (Dendranthema grandiflora Ramat.) using different approaches. Plant Cell Rep. 22, 371–375. Halmagyi, A., Deliu, C., Coste, A., 2005. Plant regeneration from potato shoot tips cryopreserved by a combined vitrification-droplet method. Cryo Lett. 26, 313–322. Hirai, D., Sakai, A., 1999. Cryopreservation of in vitro-grown axillary shoot-tip meristems of mint (Mentha spicata L.) by encapsulation vitrification. Plant Cell Rep. 19, 150–155. Hitmi, A., Barthomeuf, C., Sallanon, H., 1999. Cryopreservation of Chrysanthemum cinerariaefolium shoot tips. Effects of pretreatment conditions and retention of biosynthetic capacity. Cryo Lett. 20, 109–120. Hitmi, A., Barthomeuf, C., Sallanon, H., 2000. Cryopreservation of Chrysanthemum cinerariaefolium shoot tips. J. Plant Physiol. 156, 408–412. Hosokawa, M., Otake, A., Ohishi, K., Ueda, E., Hayashi, T., Yazawa, S., 2004. Elimination of chrysanthemum stunt viroid from an infected chrysanthemum cultivar by shoot regeneration from a leaf primordium-free shoot apical meristem dome attached to a root tip. Plant Cell Rep. 22, 859–863. Hosokawa, M., Matsushita, Y., Ohishi, K., Yazawa, S., 2005. Elimination of Chrysanthemum chlorotic mottle viroid (CChMVd) recently detected in Japan by leaf-primordia free shoot apical meristem culture from infected cultivars. J. Jpn. Soc. Hort. Sci. 74, 386–391. Jeon, S.M., Naing, A.H., Park, K.I., Kim, C.K., 2015. The effect of antifreeze protein on the cryopreservation of chrysanthemums. Plant Cell Tiss. Org. Cult. 123, 665–671. Jeon, S.M., Naing, A.H., Kim, H.H., Chung, M.Y., Lim, K.B., Kim, C.K., 2016. Elimination of chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid from infected chrysanthemum by cryopreservation. Protoplasma 253, 1135–1144. Kim, J.B., Kim, H.H., Baek, H.J., Cho, E.G., Kim, Y.H., Engelmann, F., 2005. Changes in sucrose and glycerol content in garlic shoot tips during freezing using PVS3 solution. Cryo Lett. 26, 103–112. Knop, W., 1965. Quantitative untersuchungen über den ernährungsprozesse der pflanzen.

8

Scientia Horticulturae 244 (2019) 1–9

J.-W. Li et al.

cultivars. Front. Plant Sci. 6, 53. https://doi.org/10.3389/fpls.2015.00053. Zhang, Z., Lee, Y., Sivertsen, A., Skjeseth, G., Haugslien, S., Clarke, J.L., Wang, Q.C., Blystad, D.R., 2016. Low temperature treatment affects concentration and distribution of Chrysanthemum stunt viroid in Argyranthemum. Front. Microbiol. 7, 224. https://doi.org/10.3389/fmicb.2016.00224. Zhao, M.A., Xhu, Y.Z., Dhital, S.P., Khu, D.M., Song, Y.S., Wang, M.Y., Lim, H.T., 2005. An efficient cryopreservation procedure for potato (Solanum tuberosum L.) utilizing the new ice blocking agent, Supercool X1000. Plant Cell Rep. 24, 477–481.

and sequences analysis of Chrysanthemum stunt viroid. Acta Hortic. Sinica 11, 2349–2356. Zhang, Z.B., Haugslien, S., Clark, J.L., Spetz, C., Blystad, D.R., Wang, Q.C., Lee, Y., Sivertsen, A., Skieseth, G., 2014. Cryotherapy could not eradicate Chrysanthemum stunt viroid from infected Argyranthemum maderense ‘Yellow Empire’. Acta Hortic. 1039, 201–208. Zhang, Z., Lee, Y., Spetz, C., Clarke, J.L., Wang, Q.C., Blystad, D.R., 2015. Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum

9