Shoot recovery and genetic integrity of Chrysanthemum morifolium shoot tips following cryopreservation by droplet-vitrification

Scientia Horticulturae 176 (2014) 330–339

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Shoot recovery and genetic integrity of Chrysanthemum morifolium shoot tips following cryopreservation by droplet-vitrification Ren-Rui Wang a,1 , Xiao-Xia Gao a,1 , Long Chen a , Liu-Qing Huo a , Ming-Fu Li b , Qiao-Chun Wang a,∗ a State Key Laboratory of Crop Stress Biology for Arid Areas, Key Laboratory of Genetic Improvement of Horticultural Plants of Northwest China, Ministry of Agriculture of China, College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, People’s Republic of China b Chinese Academy of Inspection and Quarantine (CAIQ), Chaoyang DistrictBeijing 100029, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 22 April 2014 Received in revised form 22 June 2014 Accepted 21 July 2014 Keywords: Chrysanthemum morifolium Droplet-vitrification FCM Histology SSR Shoot tips

a b s t r a c t We reported here an efficient, widely applicable droplet-vitrification cryopreservation for shoot tips of Chrysanthemum morifolium. Nodal segments, each being 0.5 cm in length and containing one bud positioned on nodes 3–7, were taken from 6 weeks old stock shoots and cultured on a shoot maintenance medium (SMM) for 12 days to promote bud elongation. Shoot tips (2.0 mm in size) containing 5–6 leaf primordia were excised from elongated buds and precultured on Murashige and Skoog medium (MS) containing 0.5 M sucrose for 1 day. Precultured shoot tips were loaded, dehydrated with PVS2 for 30 min at 0 ◦ C and then transferred onto droplets containing 2.5 ␮l PVS2 on aluminum foils (2 cm × 0.8 cm), prior to a direct immersion in liquid nitrogen (LN) for 1 h. Thawed shoot tips were post-cultured on shoot recovery medium containing MS supplemented with 0.05 mg L−1 GA3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. The droplet-vitrification procedure resulted in the highest (83%) and lowest (43%) shoot regrowth rates for C. morifolium ‘Japanese Red’ and ‘Xizi Qiuzhuang’, with an average rate of 68% in six C. morifolium genotypes tested. Histological observations showed that the pattern and percentage of surviving cells were similar in cryopreserved shoot tips of these two genotypes. No polymorphic bands were detected by simple sequence repeats (SSR) and ploidy levels analyzed by flow cytometry (FCM) were maintained in plantlets regenerated from cryopreserved shoot tips of the two genotypes. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Chrysanthemum (Chrysanthemum morifolium Ramat.) is globally the second most important floricultural crop following rose (Teixeira da Silva, 2004). In Asian countries like China, Japan and Korean, Chrysanthemum has also long been used as medicines, mainly due to its pharmacological functions (China Pharmacopoeia Committee, 2005). China is an original center for many Chrysanthemum species (Chen, 2012). Conservation of genetic resources is a prerequisite for breeding of novel cultivars by both classic and genetic engineering programs, and further exploitations of medicine-valued species. However, threats imposed by industrialization and urbanization that have been occurring since the last years in China are making

∗ Corresponding author. Tel.: +86 29 87081660; fax: +86 29 87081660. E-mail address: [email protected] (Q.-C. Wang). 1 These authors contributed equally to the present study. http://dx.doi.org/10.1016/j.scienta.2014.07.031 0304-4238/© 2014 Elsevier B.V. All rights reserved.

plant genetic resources including Chrysanthemum face dangers of extinction. Cryopreservation, i.e. storage of living samples at ultralow temperatures, usually in that of liquid nitrogen (LN, −196 ◦ C), has long been recognized as an ideal means for the long-term conservation of plant germplasm including ornamental species (Wang and Perl, 2006; Kulus and Zalewska, 2014). Fukai (1990) and Fukai et al. (1991) were the first to successfully cryopreserve Chrysanthemum shoot tips using two-step cooling. Since then, various cryopreservation protocols have been described, such as preculture-desiccation (Hitmi et al., 1999, 2000), encapsulation–dehydration (Sakai et al., 2000; Halmagyi et al., 2004; Martín and González-Benito, 2005; Martín et al., 2011), vitrification (Martín and González-Benito, 2005), DMSO droplet (Halmagyi et al., 2004) and droplet-vitrification (Halmagyi et al., 2004; Lee et al., 2011). Two-step cooling had to use dimethylsulfoxide (DMSO), which resulted in abnormal plants from cryopreserved shoot tips (Fukai, 1990; Fukai et al., 1991). In vitrification and encapsulation–dehydration, the stock cultures had to be cold-hardened for 3 weeks (Sakai et al., 2000; Martín and

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

González-Benito, 2005; Martín et al., 2011), which requires expensive growth chamber and is time-consuming. In addition, genotype-dependent response is still very common, and efficient and widely applicable cryopreservation protocol is still lacking for Chrysanthemum (Martín and González-Benito, 2009). Droplet-vitrification has been proved to be a suitable protocol for cryopreservation of a wide range of genotypes within the same species such as Musa (Panis et al., 2005), Solanum (Kim et al., 2006), Malus (Halmagyi et al., 2010) and Allium (Kim et al., 2012). Highly effective and user-friendlier characteristics of droplet-vitrification have been demonstrated in Chrysanthemum (Lee et al., 2011). However, a droplet-vitrification cryopreservation for diverse Chrysanthemum genotypes has not yet been reported, thus limiting routine applications of cryopreservation to establishment of cryo-banking of Chrysanthemum germplasm (Martín and González-Benito, 2009). One of the most concerned issues is genetic stability in regenerants recovered form cryopreservation. Studies have been conducted on assessments of genetic stability in regenerants of Chrysanthemum following cryopreservation by encapsulation– dehydration and vitrification (Martín and González-Benito, 2005; Martín et al., 2011). Cryo-injury varied with cryo-procedures (Wang et al., 2005, 2013, 2014), which may result in differences in genetic stability in regenerants recovered from different cryopreservation protocols (Martín and González-Benito, 2005). However, data have been quite limited on assessments of genetic stability in regenerants from droplet-vitrification cryopreservation (Lee et al., 2011). Therefore, it is necessary to assess genetic stability in regenerants following droplet-vitrification, in order for this cryo-procedure to be applied for establishment of cryo-banking of Chrysanthemum germplasm. The objective of the present study was, therefore, to develop an efficient droplet-vitrification cryopreservation for shoot tips of diverse Chrysanthemum genotypes. Histological observations on cell survival pattern, and assessments of genetic stability by single sequence repeats (SSR) and by flow cytometry (FCM) in the regenerants following cryopreservation were also conducted. 2. Materials and methods 2.1. Plant materials

331

on MS enriched with 0.25, 0.5, 0.75 M sucrose for 1 day, to select an optimal sucrose concentration for cryopreservation. Precultured shoot tips were treated for 20 min at room temperature with a loading solution composed of MS containing 0.4 M sucrose and 2 M glycerol contained in sterile plastic Petri dishes (9 cm in diameter). Loaded shoot tips were exposed to plant vitrification solution 2 (PVS2) (Sakai et al., 1990) at 0 ◦ C for 10–40 min. PVS2 is composed of MS supplemented with 30% (w/v) glycerol, 15% (w/v) ethylene glycol, 15% (w/v) DMSO and 0.4 M sucrose (pH 5.8). Each shoot tip was transferred onto a droplet containing 2.5 ␮l PVS2 carried on an aluminum foil (2 cm × 0.8 cm) (Fig. 1b), followed by a direct immersion in LN. After staying in LN for a few minutes, the foils with shoot tips were transferred into a 2 ml cryotube filled with LN for cryostorage for 1 h. Frozen foils with shoot tips were moved out from LN and immediately placed into an unloading solution containing liquid MS containing 1.2 M sucrose at room temperature for 20 min. Based on our preliminary studies, cryopreserved shoot tips were post-cultured for shoot recovery on three shoot recovery medium (SRM): (1) on SRM1 containing SMM supplemented with 1.0 mg L−1 6-benzylaminopurine (BA) and 2.0 mg L−1 ␣-naphthalene acetic acid (NAA) under standard culture conditions, as described by Hitmi et al. (1999, 2000); (2) on SRM2 containing SMM supplemented with 1.0 mg L−1 BA and 0.1 mg L−1 NAA under standard culture conditions, as described by Halmagyi et al. (2004); (3) on SRM3 containing SMM supplemented with 0.05 mg L−1 gibberellic acid-3 (GA3 ) in the dark for 3 days and then transferred on the same medium under standard culture conditions. Filter-sterilized GA3 was added to the medium after autoclaving, while BA and NAA to the medium before autoclaving. Survival was expressed as the percentage of shoot tips showing any green tissues of the total samples used for cryopreservation after 7 days of post-culture (Fig. 1c), while shoot regrowth was defined as percentage of shoot tips regenerating into shoots ≥0.5 mm of the total samples after 4 weeks of post-culture. Shoots (≥0.5 cm in length) were transferred on SMM for further shoot growth and root development. Shoots with roots developed after 8 weeks on SMM were acclimated and transferred to soil under greenhouse conditions, according to a method described by Wang et al. (2005). 2.3. Improvement of shoot recovery

C. morifolium ‘Japanese Red’ was used for optimizing the parameters in droplet-vitrification procedure. Five additional genotypes were subsequently used for testing the developed dropletvitrification procedure. Of the six genotypes, ‘Fall Color’, ‘Japanese Red’ and ‘Xizi Qiuzhuang’ are used as pot flowers, and ‘Roma Red’ and ‘Jinba’ as cut flowers. ‘Hangju’ is of pharmacological functions and mainly used as medicine in China (China Pharmacopoeia Committee, 2005). In vitro stock shoots were maintained on a shoot maintenance medium (SMM) composed of Murashige and Skoog (1962) medium (MS) supplemented with 30 g L−1 sucrose and 7 g L−1 agar (Sigma Chemical Co., USA). The pH of the medium was adjusted to 5.8 prior to autoclaving at 121 ◦ C for 20 min. The stock cultures were maintained at 22 ± 2 ◦ C under a 16-h photoperiod with a light intensity of 50 ␮mol s−1 m−2 provided by cool-white fluorescent tubes (standard culture conditions). Subculture was done once every 4 weeks.

When we applied the droplet-vitrification procedure established above to other five Chrysanthemum genotypes, shoot regrowth rates were low and some genotypes even failed to shoot regrowth. In addition, shoot tips from terminal buds were used, meaning that only one shoot tip can be taken from each of in vitro stock shoots. Therefore, an experiment was further designed in order to improve cryopreservation efficiency in terms of shoot recovery rate and shoot tip production. Nodal segments, each being about 0.4 cm in length and containing one bud, were taken from nodes positioned from 1 (youngest, apical bud) to 8 (oldest, axillary bud) of 4 and 6 weeks old stock shoots and numbered as 1–8 (Fig. 1d). The segments were cultured on SMM to promote bud elongation (Fig. 1e). After 12 days of culture, shoot tips (2.0 mm in size) containing 5–6 LPs were excised from the elongated buds (Fig. 1e1) and used for cryopreservation using the optimized parameters as described above.

2.2. Cryopreservation and shoot recovery

2.4. Histological observation

Three sizes of shoot tips: 0.5, 1.0 and 2.0 mm (Fig. 1a) in length containing 1–2, 3–4, 5–6 leaf primordia (LPs), respectively, were excised from terminal buds of 4 weeks old stock shoots. Based on our preliminary studies, shoot tips were directly precultured

Histological observations were conducted to compare pattern and number of surviving cells in cryopreserved shoot tips of two genotypes: ‘Japanese Red’ and ‘Xizi Qiuzhuang’ that produced the highest (83%) and lowest (43%) shoot regrowth rate,

332

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

Fig. 1. Cryopreservation of shoot tips of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification. (a) A shoot tip (2.0 mm) containing 5–6 leaf primordia used for cryopreservation. (b) Droplets of 2.5 ␮l PVS2, each containing a shoot tip, carried on an aluminum foil. (c) A surviving shoot tip after 7 days of post-culture on SRM3. (d) A 6-weeks-old stock shoot with 8 nodes. (e) Segments taken from buds positioned on 1–8 nodes of 6 weeks old stock shoots and culture on SMM for 12 days to promote bud elongation (e1). (f) Massive callus developed without shoot regrowth in cryopreserved shoot tips that had been post-cultured on SRM1. (g) Leaves developed without shoot regrowth in cryopreserved shoot tips that had been post-cultured on SRM2. (h) Hyperhydric shoots regenerated from cryopreserved shoot tips that had been cultured on SRM2. (i) A shoot regenerated from cryopreserved shoot tips that had been cultured on SRM3. (j) Plants regenerated from cryopreserved and control shoot tips and established in soil.

respectively. Cryopreserved shoot tips that had been thawed and post-cultured on SRM3 for 1 day in the dark were collected, fixed with formalin–acetic–alcohol solution (FAA), dehydrated and embedded as described by Feng et al. (2013). Shoot tips that were freshly excised served as positive control, while those that were freshly excised, directly immersed in LN and post-cultured for 1 day served as negative control. Both the positive and negative controls followed all steps of fixation, dehydration and embedding as used for cryopreserved shoot tips. Five ␮m thick sections were cut from embedded samples with a microtome (Leica DM 2000, Germany), mounted on glass slides, stained with 0.01% toluidine blue (TB) (Saikai, 1973), and were observed under a light microscope (Leica DM 2235, Germany). Number of total and surviving cells was manually counted in cryopreserved shoot tips, and percentages of surviving cells were calculated and presented, according to Wang et al. (2014). 2.5. Assessment of genetic stability Plantlets of two genotypes: ‘Japanese Red’ and ‘Xizi Qiuzhuang’ that produced the highest and lowest shoot regrowth, respectively, following cryopreservation, were used for this purpose by SSR

and FCM, in order to compare genetic stability in the regenerants between the two genotypes. After 12 months of shoot regeneration, samples were taken for assessments of genetic integrity by SRR and FCM. 2.5.1. SSR Genomic DNA was extracted from 0.5 g fresh leaf tissue according to protocol of Porebski et al. (1997). Purified total DNA was quantified and its quality verified by ultraviolet spectrophotometry. Each sample was diluted to 50 ng ␮L−1 in Tris–EDTA buffer and stored at −20 ◦ C until use. Thirty-six SSR primers were screened to select suitable primers for assessment of genetic stability in the regenerants. Eight SSR primer pairs selected were used for providing PCR products. PCR was performed in a 20-␮l reaction solution containing 1 ␮l each primer (forward and reverse primer), 10 ␮l TaqMix (Cwbiotech, China), 2 ␮l DNA template and 6 ␮l ddH2 O. Conditions for PCR amplification were 94 ◦ C for 3 min, 35 cycles each at 94 ◦ C for 30 s, annealing temperature varied according to requirements of primers (Khaing et al., 2013) for 45 s, and 72 ◦ C for 1 min, followed by a final extension at 72 ◦ C for 10 min. The PCR products were separated by electrophoresis in 9% native polyacrylamide gel

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

333

electrophoresis (native-PAGE) and visualized following silver staining. The molecular marker used DNA 50 bp ladder (Cwbiotech, China) was used for estimating the size of amplified products. 2.5.2. FCM Nuclear suspensions from young leaves were prepared, as described by Huang et al. (2013) and nuclei were released from the cells by chopping samples with a razor blade in Marie’s isolation buffer (Galbraith et al., 1983). The suspension of nuclei was first filtered through a 50 ␮m nylon filter to remove cell fragments and large tissue debris, and then 50 ␮g mL−1 of propidium iodide (PI) (Sigma, St. Louis, MO, USA) and 20 ␮g ml−1 of RNAse (Sigma) were added to the samples to stain the DNA. Samples were analyzed within a 15-min period in a flow cytometer. The fluorescence of samples was measured using a BD Accuri C6 flow cytometer (BD Biosciences, California, USA). Histograms were generated after analyses of at least 5000 nuclei using the software FSC 3.0 Flow Cytometry Express. 2.6. Experimental design and statistical analysis In cryopreservation experiments, shoot tips receiving all treatments but without cooling in LN served as the treated control (−LN) and cryopreserved shoot tips served as +LN. At least 10 shoot tips were included in each treatment of three replicates. All experiments were conducted twice. Results are presented as means with their standard error. The data were analyzed using oneway ANOVA and Student’s t-test. Least significant differences (LSD) were calculated at P < 0.05. In histological observation experiments, 20 samples were used in each of two replicates. In assessment of genetic stability, 30 regenerants recovered from cryopreserved shoot tips and 30 in vitro stock shoots were randomly selected from a population of 300 cryo-derived plants and 300 in vitro culturederived plants and used for assessment of genetic stability by SSR and FCM. For SSR analysis, fingerprints were manually scored for the presence (1) and absence (0) of each band. Bands of equal molecular weight and mobility generated by the same primer were considered to represent the same locus. Both distinct monomorphic bands and polymorphic bands were scored. Electrophoretic DNA bands of low visual intensity that could not be readily distinguished were considered ambiguous markers and not scored. The experiments were repeated twice to confirm their repeatability, and only reliable and repeatable bands were included in the data analysis.

Fig. 2. Effects of time duration of exposure to PVS2 on shoot regrowth of the treated control (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification. Shoot tips (2 mm in size) containing 5–6 leaf primordia excised from terminal buds of 4 weeks old stock cultures were precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 0–40 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured on SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented as means ± SE. Data with different letters in the same line indicate significant differences at P < 0.05 by Student’s t-test.

3.3. Effects of size of shoot tips For the treated control (−LN), 1.0 mm shoot tips produced the lower shoot regrowth rate (80.3%) than 1.5 mm (91.7%) and 2.0 mm (97.9%) shoot tips (Table 1). For cryopreserved shoot tips (+LN), shoot regrowth rate significantly increased from 45.8% to 66.7% as size of shoot tips increased from 1 mm to 2 mm.

3. Results 3.1. Effects of time duration of exposure to PVS2 Shoot regrowth rate of the treated control (−LN) gradually decreased from 93.8% to 58.3% as time duration of exposure to PVS2 increased from 0 to 40 min (Fig. 2). Shoot regrowth rate of cryopreserved shoot tips (+LN) significantly increased with an increase in time duration of exposure to PVS2, reached a maximum (61.6%) at 30 min and then sharply decreased to 15.0% at 40 min (Fig. 2). 3.2. Effects of sucrose preculture Sucrose concentrations in preculture medium significantly influenced shoot regrowth. Shoot regrowth rates were 54.2%, 75.0% and 22.9% in the treated control (−LN) that had been precultured with 0.25, 0.5 and 0.75 M sucrose, respectively (Fig. 3). For cryopreserved shoot tips (+LN), the highest shoot regrowth rate (62.5%) was obtained at 0.5 M sucrose (Fig. 3). Both lower (0.25 M) and higher (0.75 M) sucrose resulted in markedly reduced shoot regrowth rate.

Fig. 3. Effects of sucrose concentrations in preculture medium on shoot regrowth rate of the treated control (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium ‘Japanese Red’. Shoot tips (2 mm in size) containing 5–6 leaf primordia excised from terminal buds of 4 weeks old stock cultures were precultured with 0.25–0.75 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured on SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented as means ± SE. Data with different letters in the different treatment indicate significant differences at P < 0.05 by Student’s t-test.

334

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

Table 1 Effects of size of shoot tips on shoot regrowth rate of the treated control (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification. Meristem size (mm) with number of LPa

Shoot regrowth rate (%)

1.0 with 1–2 LPs 1.5 with 3–4 LPs 2.0 with 5–6 LPs

−LN

+LN

80.3 ± 3.3y 91.7 ± 2.7xy 97.9 ± 2.1x

45.8 ± 4.2b 50.0 ± 4.6b 66.7 ± 4.2a

Three sizes of shoot tips excised from terminal buds of 4 weeks old stock cultures were precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured on SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented as means ± SE. Data with different letters in the same column indicate significant differences at P < 0.05 by Student’s t-test. a LP = leaf primordium

3.4. Effects of shoot recovery medium (SRM) SRM did not significantly affect survival rates, but had strong effects on shoot regrowth rates. Survival rates were similarly high in both the treated control (−LN) (>92%) and cryopreserved shoot tips (+LN) (>85%) when post-cultured on all three SRM tested (Table 2). For the treated control (−LN), SRM1, SRM2 and SRM3 gave 37.1%, 40.8% and 70.0% of shoot regrowth rates, respectively. When postcultured on SRM1, cryopreserved shoot tips (+LN) developed callus (Fig. 1f), with only 1.7% of shoot regrowth rate produced (Table 2). When post-cultured on SRM2, three types of regrowth were found in cryopreserved shoot tips. About 52% of cryopreserved shoot tips produced only leaves without shoot development (Fig. 1g). About 48% of cryopreserved shoot tips developed multiple shoots through intermediate callus formation, but majority of shoots regenerated were hyperhydric (Fig. 1h) and only 5.4% of them were normal shoots. When post-cultured on SRM3, about 60% of cryopreserved shoot tips regenerated single shoots directly without callus formation (Fig. 1i).

There were no significant differences in shoot regrowth rates (48.2–59.4%) in cryopreserved shoot tips when the samples were taken from buds positioned on nodes 1–6 of 4 weeks old stock shoots (Fig. 4). Shoot tips from buds positioned on 7 and 8 nodes produced much lower shoot regrowth rates (17.5–30.8%). Shoot tips taken from buds positioned on nodes 3–7 of 6 weeks old stock shoots produced the similarly high shoot regrowth rates (81.3–91.3%) in cryopreserved shoot tips (Fig. 4). Shoot tips taken Table 2 Effects of shoot recovery media on survival and shoot regrowth rate of the treated control (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification.

SRM1 SRM2 SRM3

Survival rate (%)

Genotypes

Origin

Main use

Survival rate (%)

‘Roma Red’ ‘Jinba’ ‘Japanese Red’ ‘Fall Color’ ‘Xizi Qiuzhuang’ ‘Hangju’

Japan Japan Japan China China China

Cut flower Cut flower Pot flower Pot flower Pot flower Medicine

75 90 93 90 65 95

Average

85

± ± ± ± ± ±

3 5 5 3 2 3

Shoot regrowth rate (%) 70 80 83 60 43 73

± ± ± ± ± ±

4 5 4 5 3 4

68

Shoot tips (2 mm in size) containing 5–6 leaf primordia were excised from elongated buds positioned on nodes 3–7 of 6 weeks old stock shoots, and precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were postcultured SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented as means ± SE.

from buds positioned on nodes 1, 2 and 8 resulted in markedly lower shoot regrowth rates. Mean shoot regrowth rate was much lower in cryopreserved shoot tips taken from 4 weeks old stock shoots (46.1%) than that (76.4%) from 6 weeks old ones (Fig. 4). 3.6. Application of the droplet-vitrification protocol to other five genotypes of C. morifolium Following cryopreservation, the highest (93%) and lowest (65%) survival rates were found in ‘Japanese Red’ and ‘Xizi Qiuzhuang’, with a mean survival rate (85%) produced in the six genotypes tested (Table 3). Shoot tips of all six genotypes were able to regenerate into shoots. The highest (83%) and lowest (43%) shoot regrowth rates were found in ‘Japanese Red’ and ‘Xizi Qiuzhuang’, with a mean rate of 68% obtained in the six genotypes tested. Almost all shoots developed roots after 4 weeks on SMM. More than 95% plantlets were successfully established in soil in greenhouse conditions. Morphologies were identical in plants regenerated between cryopreserved shoot tips and in vitro stock shoots (Fig. 1j). 3.7. Histological observations

3.5. Improvement of shoot recovery

Post-culture mediuma

Table 3 Cryopreservation of Chrysanthemum morifolium shoot tips by droplet-vitrification.

Shoot regrowth rate (%)

−LN

+LN

−LN

+LN

95.0 ± 3.4x 92.2 ± 3.7x 92.5 ± 3.1x

94.6 ± 5.2a 90.8 ± 4.4a 85.8 ± 4.5a

37.1 ± 3.0y 40.8 ± 1.9y 70.0 ± 3.2x

1.7 ± 2.1b 5.4 ± 2.5b 60.0 ± 2.6a

Shoot tips (2 mm in size) containing 5–6 leaf primordia excised from terminal buds of 4 weeks old stock cultures were precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured on SRM1-3 for shoot recovery. Results are presented as means ± SE. Data with different letters in the same column indicate significant differences at P < 0.05 by Student’s t-test. a SRM1 = MS + 1.0 mg L−1 BA + 2.0 mg L−1 NAA; SRM2 = MS + 1.0 mg L−1 BA + 0.1 mg L−1 NAA; SRM3 = MS + 0.05 mg L−1 GA3 .

In the positive control, dense TB-stained and well-preserved cytoplasm were clearly observed in the cells of shoot tips (Fig. 5a). In the negative control, nuclei were heavily condensed and structure of cells was hardly observed in the cells of shoot tips (Fig. 5b). Following cryopreservation, cells located in the basal parts of shoot tips and elder LPs 4–6 were killed, while those in apical dome (Fig. 5c and e) and LPs 1–3 (Fig. 5d and f) survived. Pattern of surviving cells was similar between ‘Japanese Red’ (Fig. 5c and d) which produced the highest shoot regrowth rate and ‘Xizi Qiuzhuang’ (Fig. 5e and f), which gave the lowest rate. Percentages of surviving cells in the apical dome and the LPs 1–3 were very similar: about 75.9% for ‘Japanese Red’ and 72.7% for ‘Xizi Qiuzhuang’. 3.8. Assessment of genetic stability 3.8.1. SSR Out of the thirty-six primers screened in the SSR analysis, eight primers produced strong, clear, reproducible bands and yielded 85 and 76 scored bands in each of plantlets regenerated from cryopreserved shoot tips of ‘Japanese Red’ (the highest shoot regrowth) and ‘Xizi Qiuzhuang’ (the lowest shoot regrowth) (Table 4 and Fig. 6a and b), with total 2550 bands and 2280 bands produced by the former and the latter, respectively, across the 30 plants analyzed. The number of bands for each primer varied from 5 to 19 for ‘Japanese Red’ and 5 to 13 for ‘Xizi Qiuzhuang’, with an average of 10.6 and 9.5 bands per primer produced by the former and the

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

335

Fig. 4. Effects of bud positions of 4 and 6 weeks old stock shoots on shoot regrowth rate of cryopreserved shoot tips of Chrysanthemum morifolium ‘Japanese Red’ by dropletvitrification. Shoot tips (2 mm in size) containing 5–6 leaf primordia excised from elongated buds positioned on different nodes of 4 and 6 weeks old stock cultures were precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦ C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured on SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented as means ± SE. Data with different letters in stock shoots at the same age indicate significant differences at P < 0.05 by Student’s t-test. Means represent average shoot regrowth rate in cryopreserved shoot tips taken from elongated buds positioned on nodes 1–8 of 4 and 6 weeks old stock shoots.

Fig. 5. Histological observations in transverse sections of shoot tips of Chrysanthemum morifolium ‘Japanese Red’ and ‘Xizi Qiuzhuang’. Living cells are indicated by white arrows, while dead cells by black arrows. (a) A positive control shoot tip. Living cells showed dense, TB-stained and well preserved cytoplasm, with nucleolus enclosed in nucleus. (b) A negative control shoot tip. Dead cells showed much weaker TB-stained cytoplasm. Nuclei were heavily condensed. (c) An apical dome (AD) of cryopreserved shoot tips of ‘Japanese Red’. (d) A leaf primordium 3 of cryopreserved shoot tip of ‘Japanese Red’. (e) An apical dome (AD) of cryopreserved shoot tips of ‘Xizi Qiuzhuang’. (f) A leaf primordium 3 of cryopreserved shoot tip of ‘Xizi Qiuzhuang’. Bars represent 50 ␮m.

336

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

Table 4 SSR primer names, primer sequences, and number of amplified bands in plantlets regenerated from cryopreserved shoot tips of ‘Japanese Red’ and ‘Xizi Qiuzhuang’. Primer name

KNUCRY-10 KNUCRY-16 KNUCRY-35 KNUCRY-59 KNUCRY-77 KNUCRY-84 KNUCRY-85 KNUCRY-98 Total

Primer sequence (5 –3 )

(GT)2 CTTCATC(CCA)3 (TG)2 (AG)3 TGAGTGTA(GT)2 GAG TGTTCACCCATT(CA)2 GCTC(CA)2 TGTATGACTAGGTGAGGTGA CCTCGCACTACTTCCAAATGA G(GA)2 (TTGT)2 TCGTATCCTT CGGTC(CT)2 CAGCCTTATTG GG(TG)5 AAGGTGCT CCCGGTTATCAT(GT)2 ATGC CGTATTTAAAGG(TT)2 CCTTTCG CTAGGCTCCTTCAGCCCTCT TCTGGACTAGCCGTCAGTTG GACCAACAAAACGGAATGCT GTTGTCGTCCGTTGGCTAGT TCACAT(CA)3 TCACTGCAA (TG)4 AGGGA(CA)2 TGA

latter (Table 4). No polymorphic bands were observed in the plants regenerated between cryopreserved shoot tips and in vitro stock shoots. 3.8.2. FCM Similar patterns of ploidy levels by FCM analysis were found in nuclei isolated from leaves of shoots regenerated from cryopreserved shoot tips and in vitro stock shoots (the control) of the two Chrysanthemum genotypes ‘Japanese Red’ (Fig. 7A) and ‘Xizi Qiuzhuang’ (Fig. 7B). These data indicated that ploidy levels were maintained in the shoots following cryopreservation, and in the two genotypes, regardless of their differences in shoot regrowth rates. 4. Discussion An efficient, widely applicable droplet-vitrification procedure was described for cryopreserved of shoot tips of C. morifolium in the present study. With this protocol, the highest (83%) and lowest (43%) shoot regrowth rates were obtained for ‘Japanese Red’ and ‘Xizi Qiuzhuang’, with a mean rate of 68% produced in the six genotypes tested. To the best of our knowledge, this is the widest applicable droplet-vitrification protocol so far

Number of amplified bands

Number of polymorphic bands

‘Japanese Red’

‘Xizi Qiuzhuang’

‘Japanese Red’

‘Xizi Qiuzhuang’

5 9 19 10 10 14 10 8 85

5 10 13 12 5 10 12 9 76

0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0

reported for cryopreservation of shoot tips of diverse C. morifolium genotypes with different uses such as pot, cut flowers, and medicine. In the present study, two significant improvements were made in cryopreservation of Chrysanthemum shoot tips, compared with the previous reports using droplet-vitrification (Halmagyi et al., 2004; Lee et al., 2011) and other cryo-procedures (Fukai et al., 1991; Hitmi et al., 1999, 2000; Halmagyi et al., 2004; Martín and González-Benito, 2005; Martín et al., 2011). First, in all previous studies, at least two plant growth regulators (RGRs) were added to the culture medium for multiplication of in vitro stock cultures before cryopreservation and shoot regrowth following cryopreservation (Fukai, 1990; Fukai et al., 1991; Hitmi et al., 1999, 2000; Halmagyi et al., 2004; Martín and González-Benito, 2005; Martín et al., 2011; Lee et al., 2011). With droplet-vitrification, Halmagyi et al. (2004) used 1 mg L−1 BA and 0.1 mg L−1 NAA in stock culture maintenance medium before cryopreservation, and shoot regrowth medium after cryopreservation. In the study of Lee et al. (2011), 0.15 mg L−1 indoleacetic acid (IAA) and 0.05 mg L−1 zeatin were added to multiplication medium, while recovery medium contained 0.15 mg L−1 IAA, 0.2 mg L−1 zeatin and 0.05 mg L−1 GA3 . In our study, SMM was composed of MS without any PGRs and SRM of MS containing only GA3 at 0.05 mg L−1 , thus largely simplifying

Fig. 6. SSR banding patter in plantlets regenerated from cryopreserved shoot tips and in vitro cultures by the primer combinations KNUCRY-84 (left) and KNUCRY-85 (right) in Chrysanthemum morifolium ‘Japanese Red’ (a) and in ‘Xizi Qiuzhuang’ (b). M marker, lanes 1–4 in vitro derived plants, lanes 5–15 plantlets regenerated from cryopreserved shoot tips.

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

337

Fig. 7. Ploidy levels of shoots regenerated from cryopreserved shoot tips and in vitro stock shoots of Chrysanthemum morifolium ‘Japanese Red’ (A) and ‘Xizi Qiuzhuang’ (B) by FCM. Control = in vitro stock shoots, +LN = shoots regenerated from cryopreserved shoot tips.

the medium required in in vitro culture steps before and after cryopreservation, thus avoiding to great degree the risks of genetic variations, which are frequently associated with use of PGRs in tissue culture of flower plants including Chrysanthemum (Teixeira ˇ da Silva, 2003; Minano et al., 2009). Second, as mentioned above, in the two previous reports on droplet-vitrification cryopreservation of Chrysanthemum, only one cultivar was used by Halmagyi et al. (2004) and Lee et al. (2011). Our study extended dropletvitrification to six genotypes with different uses, thus showing its potential applications to diverse Chrysanthemum genetic resources. Preculture with high sucrose concentration was a necessary step for obtaining optimal shoot recovery of cryopreserved shoot tips. Working on cryopreservation of Chrysanthemum shoot tips by droplet-vitrification, Halmagyi et al. (2004) used 0.5 M sucrose in preculture medium for 1 day. Lee et al. (2011) reported that the highest shoot regrowth was obtained in cryopreserved shoot tips that had been step-wise precultured with 0.3 M sucrose for 31 h, 0.5 M for 17 h and 0.7 M for 7 h. In the present study, direct preculture with 0.5 M sucrose for 1 day resulted in the highest shoot regrowth in cryopreserved shoot tips. Our results agreed with those of Halmagyi et al. (2004). Chrysanthemum is a kind of plants which are sensitive to PVS2 (Halmagyi et al., 2004; Lee et al., 2011). The optimal exposure time to PVS2 varies with plant species and depends on the temperature during exposure. Exposure to 100% PVS2 for 5 min or 60% PVS2 for 15 min at room temperature resulted in the highest shoot

regrowth rate in cryopreserved shoot tips (Halmagyi et al., 2004). However, comparing effects of several plant vitrification solutions, Lee et al. (2011) found that dehydration with PVS2 at room temperature produced the lowest shoot regrowth, while PVS3 (Nishizawa et al., 1993), which contained MS supplemented with 50% glycerol and 50% sucrose, gave the best results, with 60 min and 90 min found optimal for axillary and apical shoot tips, respectively. Dehydration with PVS3 at 0 ◦ C largely extended exposure time up to 120 min without any significant decrease in shoot regrowth rates. Our results showed that dehydration with PVS2 for 30 min at 0 ◦ C resulted in the highest shoot regrowth of cryopreserved shoot tips. In the study of Halmagyi et al. (2004), precultured shoot tips, without loading, were directly dehydrated with PVS2 at room temperature. These may explain the differences in exposure time to PVS2 between our study and that of Halmagyi et al. (2004). However, we still cannot identify the specific reason causing different response of exposure of Chrysanthemum shoot tips to PVS2 and PVS3 found between our study and that of Lee et al. (2011). Size of shoot tips was found to significantly influence shoot regrowth in cryopreserved shoot tips. For some plant species like Solanum tuberosum (Halmagyi et al., 2005), Ipomoea batatas (Wang and Volkonen, 2008) and Malus (Li et al., 2014), larger shoot tips gave higher post-cryopreservation shoot regrowth rate than smaller ones. In contrast, for some plant species like Castanea sativa (Vidal et al., 2005) and Allium sativum (Kim et al., 2005), smaller shoot tips resulted in the higher rate. Our results agreed with those

338

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339

of Halmagyi et al. (2005), Wang and Volkonen (2008) and Li et al. (2014). Therefore, it seems that suitable size of shoot tips for cryopreservation needs to be identified in a given species. Age of donor plants and bud position were demonstrated to affect shoot regrowth in cryopreserved shoot tips. With Solanum tuberosum, Halmagyi et al. (2005) found that post-cryopreservation recovery decreased as bud position increased from the terminal to the basal buds. The present study found that shoot tips taken from buds positioned on nodes 1–6 of 4 weeks old stock shoots and 3–7 of 6 weeks old stock shoots produced higher shoot regrowth than those from other nodes. In most of the studies on Chrysanthemum, shoot tips from apical buds were used (Fukai et al., 1991; Hitmi et al., 1999, 2000; Halmagyi et al., 2004; Martín and González-Benito, 2005). Only in the study of Lee et al. (2011), both apical and axillary shoot tips were tested. They found that the apical shoot tips excised from 4 weeks old shoots, while axillary ones from 5.5 to 7 weeks old shoots, produced the highest shoot recovery. There were no significant differences in the shoot regrowth rates between apical and axillary shoot tips. In the present study, apical and axillary buds taken from either 4 or 6 weeks old stock shoots were cultured for 12 days to promote bud elongation and then shoot tips were excised from the elongated buds. We found that shoot tips taken from 6 weeks old stock shoots gave higher shoot regrowth than those from 4 weeks old stock cultures. The differences in producing shoot tips used for cryopreservation between the study of Lee et al. (2011) and ours made it difficult to compare effects of age of stock cultures on shoot recovery following cryopreservation. Post-cryopreservation recovery was influenced by recovery medium. In the present study, effects of three post-culture media were investigated on shoot regrowth following cryopreservation, and the best results were obtained only when cryopreserved shoot tips were post-cultured on SRM3, which contained MS supplemented with 0.05 mg L−1 GA3 for 3 days in the dark and then under standard culture conditions. Post-culture on both SRM1 and SRM2 resulted in poor shoot recovery. In fact, SRM1 and SRM2 tested in the present study were reported by Hitmi et al. (1999, 2000) and Halmagyi et al. (2004) for shoot regrowth of cryopreserved shoot tips of Chrysanthemum. The possible reason for this might be due to genotypic effect and/or different cryo-procedures adopted between the studies of Hitmi et al. (1999, 2000) and Halmagyi et al. (2004), and ours. The present study found that the pattern and number of surviving cells were similar in the two genotypes that produced the lowest and highest shoot regrowth, respectively. The similar results were also observed in cryopreservation of Lilium shoot tips by droplet-vitrification (Yin et al., 2014). These data indicated that shoot regrowth rates were more affected by composition of the recovery medium than survival pattern and number of surviving cells, and therefore, recovery medium needs to be defined for a specific genotype, in order to achieve optimal shoot regrowth. There have been several studies on genetic stability in regenerants from cryopreserved shoot tips of Chrysanthemum (Martín and González-Benito, 2005; Martín et al., 2011; Lee et al., 2011). Assessment of genetic stability by RAPD markers did not detect any polymorphic bands in 21 regenerants from cryopreserved shoot tips by vitrification, but one in 25 regenerants by encapsulation–dehydration (Martín and González-Benito, 2005). These results confirmed again that genetic stability varies with cryo-procedures, and should be conducted when a specific cryoprocedure is used. Further assessments by RAPD and AFLP markers showed that variations started to occur from sucrose preculture step onwards (Martín et al., 2011). Polymorphic rates were 5.8% and 40.1% in regenerants from cryopreserved shoot tips by RAPD and AFLP markers, respectively (Martín et al., 2011). These results indicated that genetic variations detected in post-cryopreservation regenerants may be associated with other steps rather than

freezing in LN. SSR markers are repeats of short nucleotide sequences, usually equal to or less than six bases in length, that vary in number (Rafalski et al., 1996) and has been used to study genetic stability in regenerants from various cryopreservation protocols such as vitrification for Malus (Liu et al., 2008), encapsulation–dehydration for Pyrus (Condello et al., 2009) and slow-cooling for Rubus (Castillo et al., 2010). In this study, we used SSR markers to assess genetic stability in post cryopreservation regenerants of two Chrysanthemum genotypes representing the highest and lowest shoot regrowth, and did not detect any variations in both of them. FCM analysis conducted in the present study showed that ploidy levels were maintained in shoots regenerated from cryopreservation compared with the control. Lee et al. (2011) employed FCM for analyzing DNA content profiles in C. morifolium shoots regenerated from cryopreserved shoot tips by droplet-vitrification, and found that the profiles of relative DNA content were the same between the plants developed from cryopreserved shoot tips by dropletvitrification and by in vitro cultures. Thus, the results of Lee et al. (2011) and reported here supported each other. The similar results were also reported in regenerants derived from cryopreservation in plant species such as Oncidium flexuosum (Galdiano et al., 2013), Dendrobium (Galdiano et al., 2014) and Quercus suber (Fernandes et al., 2014). The present study further found that ploidy levels were not affected in the shoots following cryopreservation in the two Chrysanthemum genotypes ‘Japanese Red’ and ‘Xizi Qiuzhuang’, regardless of their different shoot regrowth rates. The FCM analysis is a simple and practical method for rapid evaluation of ploidy levels by fast scanning the whole genome using very small amounts of plant material. In conclusion, an efficient, widely applicable dropletvitrification cryopreservation was described for six Chrysanthemum genotypes with different uses. No genetic variations were detected by both SSR and FCM in the shoots regenerated from cryopreserved shoots tips. Therefore, results obtained here provide a technical support for establishment of cryo-banking of Chrysanthemum germplasm.

Acknowledgements We acknowledged a finical support from Chinese Academy of Inspection and Quarantine through a project “Technical Developments of the Entry-exit Inspection and Quarantine for Plants” (Project number: 2013-03). Thanks are given to Dr. Bo Hong from China Agricultural University for her kindly providing Chrysanthemum materials.

References Castillo, N.R.F., Bassil, N.V., Wada, S., Reed, B.M., 2010. Genetic stability of cryopreserved shoot tips of Rubus germplasm. In Vitro Cell. Dev. Biol. Plant 46, 246–256. China Pharmacopoeia Committee, 2005. Pharmacopoeia of the People’s Republic of China, vol. 1. China Chemical Industry Press, Beijing. Chen, J.Y., 2012. The Origin of Garden Chrysanthemum. Anhui Science & Technology Publishing House, Hefei. Condello, E., Palombi, M.A., Tonelli, M.G., Damiano, C., Caboni, E., 2009. Genetic stability of wild pear (Pyrus pyraster, Burgsd) after cryopreservation by encapsulation–dehydration. Agric. Food Sci. 18, 136–143. Feng, C.H., Cui, Z.H., Li, B.Q., Chen, L., Ma, Y.L., Zhao, Y.H., Wang, Q.C., 2013. Duration of sucrose preculture is critical for shoot regrowth of in vitro-grown apple shoot tips cryopreserved by encapsulation–dehydration. Plant Cell Tissues Organ Cult. 112, 369–378. Fernandes, P., Rodriguez, E., Pinto, G., Rolán-Ruiz, O., Loose, M., Santos, C., 2014. Cryopreservation of Quercus suber somatic embryos by encapsulation–dehydration and evaluation of genetic stability. Tree Physiol. 28, 1841–1850. Fukai, S., 1990. Cryopreservation of Chrysanthemum shoot tips. Sci. Hortic. 45, 167–174. Fukai, S., Goi, M., Tanaka, M., 1991. Cryopreservation of shoot tips of Chrysanthemum morifolium and related species native to Japan. Euphytica 54, 201–204.

R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339 Galbraith, D.W., Harkins, K.R., Maddox, J.M., Ayres, N.M., Sharma, D.P., Firoozabady, E., 1983. Rapid flow cytometric analysis of the cell-cycle in intact plant-tissues. Science 220, 1049–1051. Galdiano Jr., R.F., Macedo Lemos, E.G., Vendrame, W.A., 2013. Cryopreservation, early seedling development, and genetic stability of Oncidium flexuosum Sims. Plant Cell Tissues Organ Cult. 114, 139–148. Galdiano Jr., R.F., Macedo Lemos, E.G., Faria, R.T., Vendrame, W.A., 2014. Seedling development and evaluation of genetic stability of cryopreserved Dendrobium hybrid mature seeds. Appl. Biochem. Biotechnol. 172, 2521–2529. Halmagyi, A., Deliu, C., Coste, A., 2005. Plant regrowth from potato shoot tips cryopreserved by a combined vitrification-droplet method. Cryo Letters 26, 313–322. Halmagyi, A., Deliu, C., Isac, V., 2010. Cryopreservation of Malus cultivars: comparison of two droplet protocols. Sci. Hortic. 124, 387–392. Halmagyi, A., Fischer-klüver, G., Mix-Wagner, G., Schumacher, H.M., 2004. Cryopreservation of Chrysanthemum morifolium (Dendranthema grandiflora Ramat.) using different approaches. Plant Cell Rep. 22, 371–375. Hitmi, A., Barthomeuf, C., Sallanon, H., 1999. Cryopreservation of Chrysanthemum cinerariaefolium shoot tips: effects of pretreatment conditions and retention of biosynthetic capacity. Cryo Letters 20, 109–120. Hitmi, A., Barthomeuf, C., Sallanon, H., 2000. Cryopreservation of Chrysanthemum cinerariaefolium shoot tips. J. Plant Physiol. 156, 408–412. Huang, H., Tong, Y., Zhang, Q.J., Gao, L.Z., 2013. Genome size variation among and within Camellia species by using flow cytometric analysis. PLOS ONE 8, e64981. Khaing, A.A., Moe, K.T., Hong, W.J., Park, C.S., Yeon, K.H., Park, H.S., Kim, D.C., Choi, B.J., Jung, J.Y., Chae, S.C., Lee, K.M., Park, Y.J., 2013. Phylogenetic relationships of chrysanthemums in Korea based on novel SSR markers. Genet. Mol. Res. 12, 5335–5347. Kim, H.H., Popova, E., Shin, D.J., Yi, J.Y., Kim, C.H., Lee, J.S., Yoon, M.K., Engelmann, F., 2012. Cryobanking of Korean Allium germplasm collections: results from 10-year experience. Cryo Letters 33, 45–57. Kim, H.H., Yoon, J.W., Park, Y.E., Cho, E.G., Sohn, J.K., Kim, T.S., Engelmann, F., 2006. Cryopreservation of potato cultivated varieties and wild species: critical factors in droplet vitrification. Cryo Letters 27, 223–234. Kim, J.B., Kim, H.H., Baek, H.J., Cho, E.G., Kim, Y.H., Engelmann, F., 2005. Changes in sucrose and glycerol content in garlic shoot tips during freezing using PVS3 solution. Cryo Letters 26, 103–112. Kulus, D., Zalewska, M., 2014. Cryopreservation as a tool used in long-term storage of ornamental species – a review. Sci. Hortic. 168, 88–107. Lee, Y.G., Popova, E., Cui, H.Y., Kim, H.H., Park, S.U., Bae, C.H., Lee, S.C., Engelmann, F., 2011. Improved cryopreservation of Chrysanthemum (Chrysanthemum morifolium) using droplet-vitrification. Cryo Letters 32, 487–497. Li, B.Q., Feng, C.H., Hu, L.Y., Wang, M.R., Chen, L., Wang, Q.C., 2014. Shoot regeneration and cryopreservation of shoot tips of apple (Malus) by encapsulation–dehydration. In Vitro Cell. Dev. Biol. Plant 50, 357–368. Liu, Y.G., Liu, L.X., Wang, L., Gao, A.Y., 2008. Determination of genetic stability in surviving apple shoots following cryopreservation by vitrification. Cryo Letters 29, 7–14. Martín, C., Cervera, M.T., González-Benito, M.E., 2011. Genetic stability analysis of Chrysanthemum (Chrysanthemum × morifolium Ramat.) after different stages of an encapsulation–dehydration cryopreservation protocol. J. Plant Physiol. 168, 158–166. Martín, C., González-Benito, M.E., 2005. Survival and genetic stability of Dendranthema grandiflora Tzvelev shoot apices after cryopreservation by vitrification and encapsulation–dehydration. Cryobiology 51, 281–289.

339

Martín, C., González-Benito, M.E., 2009. Cryopreservation and genetic stability of Dendranthema grandiflora Tzvelev in vitro cultures. Agric. Food Sci. 18, 129–135. ˇ Minano, H.S., González-Benito, M.E., Martín, C., 2009. Molecular characterization and analysis of somaclonal variation in Chrysanthemum cultivars using RAPD markers. Sci. Hortic. 122, 238–243. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco cell cultures. Physiol. Plant. 15, 473–497. Nishizawa, S., Sakai, A., Amano, Y., Matsuzawa, T., 1993. Cryopreservation of asparagus (Asparagus officinalis L.) embryogenic suspension cells and subsequent plant regeneration by vitrification. Plant Sci. 91, 67–73. Panis, B., Piette, B., Swennen, R., 2005. Droplet vitrification of apical meristems: a cryopreservation protocol applicable to all Musaceae. Plant Sci. 168, 45–55. Porebski, S., Bailey, G., Baum, B.R., 1997. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol. Biol. Rep. 15, 8–15. Rafalski, J.A., Vogel, J.M., Morgante, M., Powell, W., Andre, C., Tingey, S.V., 1996. Generating and using DNA markers in plants. In: Birren, B., Lai, E. (Eds.), Nonmammalian Genomic Analysis: A Practical Guide. Academic Press, San Diego, pp. 75–134. Saikai, W., 1973. Simple method for differential staining of paraffin embedded plant material using toluidine blue O. Biotech. Histochem. 48, 247–249. Sakai, A., Kobayashi, S., Oiyama, I., 1990. Cryopreservation of nucellar cells of navel orange (Citrus sinensis Osb. var. brasiliensis Tanaka) by vitrification. Plant Cell Rep. 9, 30–33. Sakai, A., Matsumoto, T., Hirai, D., Niino, T., 2000. Newly developed encapsulation–dehydration protocol for plant cryopreservation. Cryo Letters 21, 53–62. Teixeira da Silva, J.A.T., 2003. Chrysanthemum: advances in tissue culture, cryopreservation, postharvest technology genetics and transgenic biotechnology. Biotechnol. Adv. 21, 715–766. Teixeira da Silva, J.A.T., 2004. Ornamental chrysanthemums: improvement by biotechnology. Plant Cell Tissues Organ Cult. 79, 1–18. Vidal, N., Sanchez, C., Jorquera, L., Ballestre, A., Viettez, A.M., 2005. Cryopreservation of chestnut by vitrification of in vitro-grown shoot tips. In Vitro Cell. Dev. Biol. Plant 41, 63–68. Wang, B., Wang, R.R., Li, J.W., Ma, Y.L., Sheng, W.M., Li, M.F., Wang, Q.C., 2013. Development of three vitrification-based cryopreservation procedures for shoot tips of China’s potato. Cryo Letters 34, 369–380. Wang, Q.C., Laamanen, J., Uosukainen, M., Valkonen, J.P.T., 2005. Cryopreservation of in vitro-grown shoot tips of raspberry (Rubus idaeus L.) by encapsulation–vitrification and encapsulation–dehydration. Plant Cell Rep. 24, 280–288. Wang, B., Li, J.W., Zhang, Z.B., Wang, R.R., Ma, Y.L., Blystad, D.R., Keller, E.R.J., Wang, Q.C., 2014. Three vitrification-based cryopreservation procedures cause different cryo-injuries to potato shoot tips while all maintain genetic integrity in regenerants. J. Biotechnol. 32, 583–595. Wang, Q.C., Perl, A., 2006. Cryopreservation in floricultural crops. In: Silva, J.T. (Ed.), Floricultural, Ornamental and Plant Biotechnology: Advances and Topics. Global Science Books, London, pp. 523–539. Wang, Q.C., Volkonen, J.P.T., 2008. Elimination of two viruses which interact synergistically from sweet potato by shoot tip culture and cryotherapy. J. Virol. Methods 154, 135–145. Yin, Z.F., Bi, W.L., Long, C., Zhao, B., Volk, G.M., Wang, Q.C., 2014. An efficient, widely applicable cryopreservation of Lilium shoot tips by droplet-vitrification. Acta Physiol. Plant. 36, 1683–1692.