Zn- and Mn-superoxide dismutase (SOD) from the copepod Tigriopusjaponicus: Molecular cloning and expression in response to environmental pollutants

Chemosphere 84 (2011) 1467–1475

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Cu/Zn- and Mn-superoxide dismutase (SOD) from the copepod Tigriopus japonicus: Molecular cloning and expression in response to environmental pollutants Bo-Mi Kim a,1, Jae-Sung Rhee b,1, Gyung Soo Park c, Jehee Lee d, Young-Mi Lee e,⇑, Jae-Seong Lee a,b,⇑ a

Department of Chemistry, The Research Institute for Natural Sciences, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea Department of Molecular and Environmental Bioscience, Graduate School, Hanyang University, Seoul 133-791, South Korea Department of Marine Biotechnology, College of Liberal Arts and Sciences, Anyang University, Ganghwa 417-833, South Korea d Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju 690-756, South Korea e Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743, South Korea b c

a r t i c l e

i n f o

Article history: Received 12 February 2011 Received in revised form 8 April 2011 Accepted 17 April 2011 Available online 7 May 2011 Keywords: Copepod Tigriopus japonicus Superoxide dismutase Heavy metals Benzo[a]pyrene 4-Nonylphenol

a b s t r a c t Superoxide dismutase (SOD) is an important antioxidant enzyme which catalyzes conversion of superoxide to oxygen and hydrogen peroxide in aerobic organisms. Here, we cloned and sequenced the fulllength cDNA and genomic DNA of two SODs from the copepod, Tigriopus japonicus: copper/zinc SOD (TJ-Cu/Zn-SOD) and manganese SOD (TJ-Mn-SOD). To define whether TJ-Mn-SOD is a cytosolic or a mitochondrial protein, a phylogenetic analysis was performed. The genomic structure of both TJ-SOD genes was determined with the promoter region sequences. In order to investigate their potential role in response to environmental pollutants, T. japonicus were treated with heavy metal (copper, zinc, and silver; 0, 10, 25, 50, and 100 lg L1) and industrial chemicals (benzo[a]pyrene, 4-nonylphenol, and tributyltin; 0, 1, 5, 10, and 20 lg L1) for 96 h. Subsequently, the TJ-Cu/Zn-SOD and TJ-Mn-SOD mRNA level was measured with quantitative real-time RT–PCR along with total SOD activity. The deduced amino acid residues of TJ-Cu/Zn-SOD and TJ-Mn-SOD possessed evolutionary conserved domains that are required for metal binding and Cu/ZnSOD-conserved signature sequences. The phylogenetic analysis revealed that TJ-Mn-SOD was closely clustered to mitochondrial Mn-SOD of another copepod, Lepeophtheirus salmonis. TJ-Cu/Zn-SOD gene had four exons and three introns, while the TJ-Mn-SOD gene consisted of two exons interrupted by one intron. In the 50 -flanking region of TJ-Cu/Zn-SOD and TJ-Mn-SOD, we observed several transcription regulatory elements such as p53, XRE, MRE, and ERE-half sites. In the response to heavy metals, Cu, Zn, and Ag, both TJ-Cu/Zn-SOD and TJ-Mn-SOD transcript levels along with enzyme levels were significantly increased at high concentrations (50 lg L1 and 100 lg L1). Particularly, in the Cu- and Ag-exposed group, the expression of TJ-Mn-SOD mRNA was regulated more sensitively than the TJ-Cu/ Zn-SOD mRNA level, indicating that the chemical susceptibility would be not correlated with the form of chemicals. B[a]P treatment showed a significant increase in the expression of both TJ-SODs mRNA level and enzyme level from 5 lg L1 concentration, while TBT decreased its expression at high concentrations (10 lg L1 and 20 lg L1). 4-NP increased both TJ-SODs mRNA level at 1 lg L1 concentration, and then inhibited its expression from 5 lg L1 concentration to a lower level than the control. This finding suggests that TJ-Cu/Zn-SOD and TJ-Mn-SOD would be an inducible gene upon exposure to heavy metals and B[a]P, and could be used as a potential biomarker for the risk assessment of these environmental pollutants. This is the first report to elucidate response of SOD to environmental pollutants in copepods. Therefore, this study would give a clue to better understand the mode of action of antioxidant genes and enzymes under oxidative stress in marine invertebrates. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction ⇑ Corresponding authors. Address: Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea. Fax: +82 2 2299 9450 (J.-S. Lee). E-mail addresses: [email protected] (Y.-M. Lee), [email protected] (J.-S. Lee). 1 These two authors equally contributed to this manuscript. 0045-6535/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.chemosphere.2011.04.043

Environmental pollutants released from anthropogenic resources (i.e. industrial chemicals and water wastes) enter aquatic animals via food-uptake, epidermis, and gills, and tend to accumulate in their body. Pollutants have been a great concern in aquatic systems because of their adverse effects on development,

1468

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

reproduction, and health of aquatic organisms at molecular, individual, and eventually population levels (Fent et al., 2006). Meanwhile, it is well-studied that environmental pollutants can induce oxidative stress by generating reactive oxygen species (ROS). For example, Dazy et al. (2009) reported that heavy metal stress is closely associated with the induction of oxidative stress biomarkers in aquatic bryophytes. Environmental pollutants including metals, polycyclic aromatic hydrocarbons (PAHs), pesticides, polychlorinated biphenyls (PCB), dioxins, and other xenobiotics would stimulate the toxic effects of oxidative damage in aquatic organisms (reviewed by Valavanidis et al. (2006)). ROS is normally produced via the redox cycling of oxygen metabolism in living organisms and has a function in the cellular protection from pathogens (Li et al., 2010). However, overproduction of ROS causes harmful damages to cellular macromolecules such as proteins, lipids, carbohydrates, and nucleic acids. Consequently, oxidative damage changes physiological conditions, resulting in aging, increased susceptibility to disease and reduced reproduction ability. To overcome oxidative stress conditions, aerobic organisms have developed various antioxidant defense mechanisms. Superoxide dismutase (SOD) is a representative antioxidant enzyme which catalyzes dismutation of superoxide to oxygen and hydrogen peroxide. SODs are ubiquitous and known as three forms, based on the metal cofactor in active sites: copper/zinc (Cu/Zn-SOD), iron SOD (Fe-SOD) and manganese SOD (Mn-SOD) in eukaryotes. In animals, two kinds of SODs have been commonly well-studied: cytosolic Cu/Zn-SOD and mitochondrial Mn-SOD (Gómez-Anduro et al., 2006). While their genes are well-characterized in mammals, only little information is available on SODs in marine invertebrates such as molluscs (Geret et al., 2004), abalone (Zhang et al., 2009), prawn (Cheng et al., 2006a,b), and shrimp (Gómez-Anduro et al., 2006). However, there is little information on molecular characterization of SODs in benthic and planktonic species. Thus, more information at the gene level would be helpful to obtain better insights in the role of SODs against a variety of environmental pollutants with respect to comparative biochemistry. Regarding the SOD activity along with the transcriptional regulation upon exposure to a variety of environmental pollutants, there are several reports available from heavy metals (i.e. Cd) (Geret et al., 2004) and industrial chemicals (i.e. TBT, B[a]P, surfactants) (Monari et al., 2009; Zhang et al., 2009; Zhou et al., 2010). In copepods, several researchers showed that industrial chemicals (i.e. DEA) (Hansen et al., 2010), nanomaterials (i.e. ZnO) (Wong et al., 2010) and heavy metals (i.e. Cd, Ni) (Wang and Wang, 2010) would affect the antioxidant systems. SODs, therefore, have been considered as suitable indicators for environmental risk assessments. The copepod, Tigriopus japonicus (Harpacticidae) is an intertidal copepod that inhabits splash pools. Copepods generally play an important role in food web as both primary consumers and prey to secondary consumers. With easy maintenance under laboratory conditions, other characteristics such as their small body size, sexual dimorphism, and short life cycle (approximately 14 d) have made T. japonicus a model species for a wide range of aquatic ecotoxicology studies (Kwok and Leung, 2005; Lee et al., 2007a,b; Raisuddin et al., 2007; Lee et al., 2008). Previously, we showed that heavy metals (i.e. Cu, Mn, Cd, As, Ag) influenced the expression of antioxidant-related genes including glutathione reductase (GR) and glutathione S-transferase (GST) in T. japonicus (Lee et al., 2007a,b, 2008). Recently, we obtained extensive genomic DNA sequences (10 894 unigenes) from this species using GS-FLX and GSFLX-Titanium (Lee et al., 2010) that are of utmost use for coming ecotoxicological and environmental genomics studies. In the present approach, we cloned and sequenced full-length Cu/Zn-SOD and Mn-SOD cDNA and genomic DNA, and analyzed

the sequence of the promoter region from T. japonicus. We also examined the modulation of Cu/Zn-SOD and Mn-SOD mRNA expression with total SOD activity to heavy metals and environmental chemicals stress. This is the first report of gene information about SOD and its role upon exposure to various environmental pollutants in a copepod species. This study also aims at a better understanding of the response mechanisms of aquatic animals and the chemicals they are getting exposed to. 2. Materials and methods 2.1. Culture and maintenance T. japonicus was reared and maintained at 0.2 lm-filtered sea water adjusted to 20 °C temperature, a photoperiod of 12 h:12 h light/dark and a salinity of 16. They were fed with the algae Tetraselmis suecica. Identification of the species was made by morphological characteristics and the sequence identity of mitochondrial DNA COI as a universal barcode marker. 2.2. Total RNA extraction and single-strand cDNA synthesis Whole bodies were homogenized in three volumes of TRIZOLÒ reagent (Molecular Research Center, Inc.) with a tissue grinder and stored at -80 °C until use. Total RNA was isolated from tissues according to the manufacturer’s instructions. Genomic DNA was removed using DNase I (Sigma, St. Louis, Mo). Quantity of total RNA was measured at 230, 260, and 280 nm using a spectrophotometer (Ultrospec 2100 pro, Amersham Bioscience). To check genomic DNA contamination, we loaded total RNA in a 1% agarose gel which contained ethidium bromide (EtBr) and visualized on UV transilluminator (Wealtec Corp.). Also, to verify total RNA quality, we loaded total RNA in a 1% formaldehyde/agarose gel with ethidium bromide (EtBr) staining and checked the 18/28S ribosomal RNAs integrity and band ratio. Single-strand cDNA was synthesized from total RNA using oligo (dT)20 primer for reverse transcription (SuperScript™ III RT kit, Invitrogen, Carlsbad, CA, USA). 2.3. Cloning of T. japonicus SODs genes and sequence analysis of the promoter region Partial sequences of the SOD genomic DNA were obtained from the database of genomic DNA information from T. japonicus (Lee et al., 2010). To identify the exon/intron boundary and transcript sequences, we designed the 50 - and 30 -RACE primers (Table 1) and obtained the RACE products according to the manufacturer’s instructions. To obtain the full-length SOD cDNAs, GeneRacer kit (Invitrogen, Carlsbad, CA) was used. A series of RACE were performed under the following conditions: 94 °C/4 min; 40 cycles of 98 °C/25 s, 55 °C/30 s, 72 °C/60 s; and 72 °C/10 min. The final PCR products were isolated from 1% agarose/TBE gel, cloned into pCR2.1 TA vectors (Invitrogen, Carlsbad, CA, USA) and sequenced with an ABI PRISM 3700 DNA analyzer (Bionics Co., Seoul, South Korea). The sequence of the promoter region of TJ-SODs was analyzed with Genetyx version 7.0 software. 2.4. Phylogenetic analysis To place the identified TJ-Mn-SOD protein to its phylogenetic position, we aligned it with other crustacean Mn-SOD proteins by Clustal X 1.83 with pairwise alignment parameter settings as 10 of gap opening, 0.1 of gap extension and multiple alignment parameters setting as 10 of gap opening, 0.2 of gap extension. In total, 31 sequences were retrieved from GenBank/DDBJ/EMBL databases, and were aligned. Gaps and missing data were excluded

1469

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475 Table 1 Primer list used in this study. Gene

Oligo name

Sequence (50 ? 30 )

Remarks

TJ-CuZnSOD

5GSP1 5GSP2 3GSP1 3GSP2 RT-F RT-R

GTTGGATGATATCTTGAGAATGTC GTTCATGTGAACATGAAAGCC ATGTG CATGTTCACATGAACGGACAACTTAC CAAGACATTCTCAAGATATCA TCCAAC ACTTTGGAACCTGGTCGCGAGAAC CCAATCGTGAGCCTGCGTTTC

50 -RACE

5GSP1 5GSP2 3GSP1 3GSP2 RT-F RT-R

CTGCCAGAAGATGGAATGGTTGATG GAAATCACGGGTTCCAACGCGTTGTAG GTGAACAACCTGAACATGGCCGAAG GGGCACATCAACCATTCCATCTTCTG GGTGGATCCGGTGAACCTGAAG CCGGCAGCCTTATTATAACCCAAC

50 -RACE

RT-F RT-R

GACTCAACACGGGAAATCTCACC ACCAACTAAGAACGGCCATGCAC

TJ-MnSOD

18S rRNA

from the analysis. The generated data matrix was converted to the nexus format, and the data matrix was analyzed with Mr. Bayes v3.1.2 program using a general time-reversible model. Four parallel Monte Carlo Markov chains of differentially heated chains were run for 1 000 000 generations with the posterior probabilities, and the sampling frequency assigned every 100 generations using the Jones, Taylor and Thornton amino acid substitution matrix. After analysis, the first 1000 generations were deleted as a burn-in process, a consensus tree was constructed, and then visualized with Tree View of PHYLIP. Bayesian posterior probabilities (0.50) were indicated at each branch node. 2.5. Chemical exposure study To study effects of environmental toxicant exposure on SODs gene expression, we exposed T. japonicus to three EDCs (viz., BaP, benzo[a]pyrene; 4-NP, 4-nonylphenol; TBT, tributyltin) and three metals (viz., Cu, copper; Zn, zinc; Ag, silver). All the toxicants were purchased from Sigma (Sigma–Aldrich, Inc., St. Louis, MO, USA; purity of EDCs > 99%). Stock solutions of EDCs were dissolved in dimethylsulfoxide (DMSO, Sigma), and metals were prepared in ultrapure water. The exposed concentrations of environmental toxicants were based on our previous studies on the NOEC, LC10, and LC50 of T. japonicus (Lee et al., 2007a,b, 2008; Rhee et al., 2009). To check the dose-dependent effect of different chemicals on TJ-SOD expression, we chose in a range within no observed effect concentration (NOEC) values. The following concentrations were used: B[a]P (1, 5, 10, 20 lg L1), 4-NP (1, 5, 10, 20 lg L1), TBT (1, 5, 10, 20 lg L1), Cu (as CuCl2, 10, 25, 50, 100 lg L1), Zn (as ZnCl2, 10, 25, 50, 100 lg L1), and Ag (as AgNO3, 10, 25, 50, 100 lg L1). For a control group of EDC exposure, 0.001% DMSO was used that is the same DMSO concentration with the exposed final EDC solution. The exposures were given for 96 h as static renewal cultures. A minimum of six replicates were used for each concentration containing approximately 300 adult copepods (both sexes in a balanced ratio) in each container. Fifty percent of culture water was renewed after 24 h and the desired concentrations of toxicants were maintained accordingly. DMSO was used as solvent control and its concentration was maintained at less than 0.001%. 2.6. Quantitative real-time RT–PCR To investigate specific expression patterns of SOD genes, quantitative real-time RT–PCRs were performed. Each reaction included 1 lL of cDNA and 0.2 lM primer (real-time RT-F/R and 18S rRNA RT-F/R) as shown in Table 1. Primers were designed after comparing exon/intron boundaries to genomic DNA using GENRUNNER software (Hastings Software, Inc. NY, USA) and confirmed by the

30 -RACE Real-time PCR Amplification

30 -RACE Real-time PCR Amplification 18S rRNA real-time PCR amplification

Primo 3 program (Whitehead Institute/MIT center for Genome Research). To determine the amplicon identity, all the PCR products were cloned into the pCR2.1 TA vector, and sequenced with an ABI 3700 DNA analyzer (Bionics Co., Seoul, South Korea). Optimized conditions were transferred according to the following CFX96™ real-time PCR system protocol (Bio-Rad). Reaction conditions were as follows: 95 °C/3 min; 40 cycles of 95 °C/30 s, 55 °C/ 30 s, 72 °C/30 s. To confirm the amplification of specific products, cycles were continued to check the melting curve under the following conditions: 95 °C/1 min, 55 °C/1 min, and 80 cycles of 55 °C/10 s with 0.5 °C increase per cycle. SYBRÒ Green (Molecular Probes Inc., Invitrogen) was used to detect specific amplified products. Amplification and detection of SYBRÒ Green-labeled products were performed using CFX96™ real-time PCR system (Bio-Rad, Hercules, CA, USA). Data from each experiment were expressed relative to expression levels of the 18S rRNA gene to normalize the expression levels between samples. All experiments were done in triplicate. Data were collected as threshold cycle (CT) values (PCR cycle number where fluorescence was detected above a threshold and decreased linearly with increasing input target quantity), and used to calculate DCT values of each sample. The fold change in the relative gene expression was calculated by the 2DDCT method (Livak and Schmittgen, 2001). 2.7. Measurement of total SOD enzyme activity The SOD activities were measured with an enzymatic method using SOD assay kit (Sigma–Aldrich Chemie, Switzerland). A minimum of three replicates were used for each concentration containing approximately 500 adult copepods (both sexes in a balanced ratio) in each container. After exposure to environmental toxicants for 96 h, the copepods were homogenized in ice-cold buffer (0.25 M sucrose, 0.5% triton X-100, pH 7.5) at a ratio of 1–4 (w/v) using a Teflon homogenizer. The homogenate was centrifuged at 30 000g for 30 min at 4 °C. The upper aqueous layer containing the enzyme was collected for the enzymatic assay according to the manufacturer’s protocol. The total SOD activities were then measured at an absorbance of 440 nm using a spectrophotometer (Thermo™ Varioskan Flash) at 25 °C. Enzyme activities were normalized by total protein and represented as% of control. Total proteins were determined using the Bradford method (Bradford, 1976). 2.8. Statistical analysis Data were expressed as mean ± SE Significant differences were analyzed using one-way ANOVA followed by Tukey’s test.

1470

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

P < 0.05 was considered significant. The SPSS ver. 17.0 (SPSS Inc., Chicago IL, USA) software package was used for statistical analysis.

3. Results 3.1. Sequence analysis of TJ-SOD cDNA The full-length cDNA of T. japonicus Cu/Zn-SOD (TJ-Cu/Zn-SOD) and Mn-SOD (TJ-Mn-SOD) genes were completely sequenced (Suppl. Figs. 1A and 2A) and deposited to Genbank (Accession No. HQ848279 for TJ-Cu/Zn-SOD and HQ848280 for TJ-Mn-SOD).

3.1.1. TJ-Cu/Zn-SOD The complete cDNA sequence of Cu/Zn-SOD was 810 bp in length, including 31 bp in 50 -untranslated region (UTR), 459 bp in the open reading frame (ORF), and 320 bp in 30 -UTR with a poly (A) tail (Suppl. Fig. 1A). The ORF encodes a polypeptide of 153 amino acids. The predicted molecular weight and theoretical pI of TJCu/Zn-SOD protein were calculated in 16.4 kDa and 6.02, respectively. Two Cu/Zn-SOD family conserved signature sequences were observed in the TJ-Cu/Zn-SOD: signature1 (GFHVHMNGQLT) from 38 to 48 and signature2 (GNAGSRLACGVI) from 135 to 146. Conserved domain search (CD-search) showed that TJ-Cu/Zn-SOD had evolutionarily conserved domains such as metal binding active sites for histidine residues (His40, His42, His57, His65, His74, and His117) and for aspartic acid residues (Asp77). The conserved cysteine (Cys) was detected in 51 out of 143 residues. BlastX search using the deduced amino acid sequences of TJ-Cu/Zn-SOD revealed that it shared high identity with those of the abalone belonging to the Mollusca (55%). When compared to representative species of each phylum using ClustalX, the deduced amino acid sequence of TJ-Cu/Zn-SOD showed similarities to the nematode Caenorhabditis elegans (55%), fruitfly Drosophila melanogaster (49%), zebrafish Danio rerio (58%), frog Xenopus laevis (63%), mouse Mus musculus (61%), and human Homo sapiens (59%) (Suppl. Fig. 1B).

3.2. Genomic organization of TJ-SOD gene and promoter sequence analysis 3.2.1. TJ-Cu/Zn-SOD gene TJ-Cu/Zn-SOD genomic DNA was 5522 bp in length, containing four exons and three introns. The splicing donor and acceptor sequence of the three introns was 50 -GT-AG-30 . Comparison of human, mouse, zebrafish, fruit fly, and nematode Cu/Zn-SOD genes revealed that TJ-Cu/Zn-SOD was highly conserved in genomic organization with its counterpart in nematode (Suppl. Fig. 3A). The sequence of the promoter region contained many putative transcription factor binding sites such as p53, ERE (estrogen response element)-half sites and XRE (xenobiotics response element) (Fig. 2A). 3.2.2. TJ-Mn-SOD gene TJ-Mn-SOD gene spans 8691 bp, composed of two exons interrupted by one intron with a typical splicing junction. TJ-Mn-SOD genomic structure was quite different from those of nematode, but also vertebrates such as human, mouse, zebrafish that possess five exons and four introns (Suppl. Fig. 3B). It was rather similar to that of fruitfly. Potential regulatory elements identified in the 50 genomic flanking sequence were ERE-half site, XRE, p53 and MRE (metal response element) (Fig. 2B). 3.3. Effect of heavy metals on TJ-SODs After exposure to heavy metals, Cu, Zn, and Ag with different concentration (0, 10, 25, 50, 100 lg L1) for 96 h, both TJ-SODs transcripts level highly increased at 25 lg L1 (only for Ag exposure), 50 lg L1, and 100 lg L1 of Cu, Zn, and Ag exposure, respectively (P < 0.05) (Fig. 3A). While TJ-Mn-SOD transcription was more sensitive to Cu and Ag stress, TJ-Cu/Zn-SOD responded faster to Zn stress. The expression of total SOD activity was also induced at 50 lg L1 (only for Ag exposure), and 100 lg L1 of exposure (Fig. 3B), indicating that protein level of SOD was regulated later compared to the level of transcripts. 3.4. Effect of EDCs on TJ-SODs

3.1.2. TJ-Mn-SOD The full-length cDNA region of TJ-Mn-SOD was 824 bp in length, including a 81 bp 50 -UTR, a 681-bp ORF, and a 62-bp 30 -UTR with a poly(A) tail (Suppl. Fig. 2A). The ORF encodes a polypeptide of 226 amino acids, including a signal peptide of 28 amino acids. The putative protein encoded by TJ-Mn-SOD was predicted to have Mw 24.6 kDa and a theoretical pI of 6.75. Putative N-glycosylation site was found in NXT at His102, and signature sequence was observed from 187 to 194 residues (DVWEHAYY). Conserved domains required for metal binding were detected in TJ-Mn-SOD for histidine residues (His54, His102, and His191) and for aspartic acid residues (Asp187). By BlastX search using deduced amino acid sequences, TJ-Mn-SOD was highly matched to mitochondrial MnSOD of both copepods, the salmon louse, Lepeophtheirus salmonis (75%), and Caligus clemensi (78%), green mud crab Scylla paramamosain (76%), and blue crab Callinectes sapidus (74%). Alignment of the deduced amino acid sequence of TJ-Mn-SOD with representative species of each phylum revealed that TJ-Mn-SOD had similarities to the nematode Caenorhabditis elegans (78%), fruitfly Drosophila melanogaster (72%), zebrafish Danio rerio (77%), frog Xenopus laevis (76%), mouse Mus musculus (74%), and human Homo sapiens (76%) (Suppl. Fig. 2B). The phylogenetic tree showed that TJ-Mn-SOD was clustering with mitochondrial Mn-SOD of other arthropods and closely related to the copepod Lepeophtheirus salmonis (Fig. 1).

As shown in Fig. 4A, both TJ-SODs transcript levels were steeply up-regulated after B[a]P exposure at concentrations of 5, 10, and 20 lg L1 (P < 0.05). After 4-NP exposure, the expression level of both TJ-SOD transcripts was highly increased at the concentration of 1 lg L1, and then its level was recovered at different rate; thus, slowly in TJ-Cu/Zn-SOD and quickly in TJ-Mn-SOD. TBT slightly suppressed the TJ-SODs transcript level at high exposure concentration (10 and 20 lg L1) (P < 0.05). Total SOD activity was extremely induced at higher concentration (10 and 20 lg L1) of the B[a]P-exposed group (approximately 5-fold, P < 0.05), while it was significantly reduced in the exposure to high concentration of 4NP and TBT (approx. 0.6-fold, P < 0.05) (Fig. 4B). 4. Discussion Environmental pollutants such as B[a]P, TBT, 4-NP, and heavy metals used in this study are being released into aquatic environments. These pollutants can induce oxidative stress by generating ROS that eventually adversely affect macromolecules in aquatic organisms, also leading to DNA damage. As a response, living organisms have developed defense systems consisting of several antioxidant enzymes as protective mechanisms. Among them, SOD enzymes play an essential role in catalyzing the dismutation of superoxide to oxygen and hydrogen peroxide. While the characterization of SOD enzymes has been well-studied in decapods,

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

1471

Fig. 1. Phylogenetic analysis of T. japonicus Mn-SOD compared to other species retrieved from GenBank using the Bayesian method. Numbers at branch nodes represent the confidence levels of posterior probabilities. The scale bar represents genetic distance. The amino acid sequences used in the phylogenetic analysis and their GenBank and Ensemble accession numbers were as follows: members of mitochondrial MnSOD; Bombyx mori (NM_001043834), Callinectes sapidus (AF264029), Charybdis feriatus (AF019411), Drosophila melanogaster 1 (L18947), Drosophila melanogaster 2 (L34276), Fenneropenaeus chinensis (DQ205424), Galleria mellonella (EF611125), Lepeophtheirus salmonis (AJ811940), Macrobrachium rosenbergii (DQ157765), Marsupenaeus japonicas (GQ478988), Scylla serrata (FJ605170); members of cytosolic MnSOD: Atelecyclus undecimdentatus (FM242565), Bythograea thermydron (FM242567), Callinectes sapidus (AF264030), Cancer pagurus (FM242564), Cardisoma armatum (FM242571), Cyanagraea praedator (FM242568), Dromia personata (FM242566), Litopenaeus vannamei (DQ005531), Litopenaeus vannamei 1 (DQ298206), Litopenaeus vannamei 2 (DQ298207), Litopenaeus vannamei 3 (DQ298208), Macrobrachium rosenbergii (DQ073104), Marsupenaeus japonicus (GQ181123), Necora puber (FM242563), Penaeus monodon (AY726542), Penaeus monodon 1 (BI784454), Perisesarma bidens (FM242572), Procambarus clarkii (EU254488), Segonzacia mesatlantica (FM242569), and Xantho poressa (FM242570).

there is little information about smaller crustaceans such as copepods. Common types of SOD are Cu/Zn-SOD and Mn-SOD in most eukaryotes. The enzyme Cu/Zn-SOD is cytoplasmic and Mn-SOD is of mitochondrial origin (Gómez-Anduro et al., 2006). In the present study, we cloned and sequenced the full-length Cu/Zn-SOD and Mn-SOD cDNA and genomic DNA from T. japonicus, the first time for a copepod. The obtained proteins of Cu/Zn-SOD had several common characteristics with Cu/Zn-SOD orthologues from other species. As shown in Suppl. Fig. 1B, TJ-Cu/Zn-SOD conserved seven metalbinding sites, consisting of seven His and one Asp residues which are essential for the binding of metal ion in the active sites (Zhang

et al., 2009). Also, two CuZnSOD conserved signature sequences were found in TJ-Cu/Zn-SOD. The two His residues in signature 1 (38–48 residues) represent copper ligands and the Cys residues in signature 2 (135–146 residues) are involved in forming a disulfide bond (Zhang et al., 2009). Cu/Zn-SOD is divided into two isoforms according to its localization; extracellular components or intracellular cytoplasm. While extracellular Cu/Zn-SOD has an Nterminal signal cleavage peptide, cytoplasmic Cu/Zn-SOD has no signal peptide (Folz et al., 1997). In TJ-Cu/Zn-SOD, no signal peptide was found, indicating that it would be a member of the cytoplasmic Cu/Zn-SOD family as demonstrated in the cytoplasmic Cu/ Zn-SOD of the abalone Haliotis diversicolor (Zhang et al., 2009). The homology of sequences, ranging from 49% (fruitfly) to 61%

1472

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

(A) TJ-Cu/ZnSOD promoter region p53 -2,458 (bp)

p53

ERE

+1

p53

XRE atg

p53

(B) TJ-MnSOD promoter region 500 bp

ERE -3,938 (bp)

p53 MRE

ERE +1

ERE

ERE

MRE

Relative mRNA expression

(A) SOD transcript

500 bp

7

***

***

6 ** **

5 4

**

* *

3

* *

2 1

**

*

**

**

** **

10

20

**

0

atg

XRE

CuZnSOD MnSOD

8

0

1

5

10

20

0

1

BaP

Fig. 2. (A) Schematic diagram for predicted promoter region of TJ-Cu/Zn-SOD. (B) Schematic diagram for predicted promoter region of TJ-Mn-SOD.

5

10

20

0

1

4-NP

5

(µg/L)

TBT

Relative mRNA expression

(A) SOD transcript CuZnSOD MnSOD

8

***

7 6

**

5

**

4

** **

**

**

**

*

**

3

* *

*

2 1 0 0

10

25

50 100

0

10

Cu

25

50 100

0

10

Zn

25

50 100 (µg/L)

Ag

Residual activities (% of control)

(B) Total SOD activity 600

***

500 400

**

Residual activities (% of control)

(B) Total SOD activity **

600 500 400 *

300 125 100

*

** **

-50

0 0

1

5

BaP

10

20

0

1

5

4-NP

10

20

0

1

5

TBT

10

20 (µg/L)

Fig. 4. (A) Effects of copper (Cu), zinc (Zn), and silver (Ag) for 96 h on SODs mRNA expression in the copepod, T. japonicus. SOD mRNA expressions are shown as relative to 18S rRNA which was used as a reference housekeeping gene. Data are means ± SE of three replicates of exposed copepod. The symbols (, , and ) indicate P < 0.05, P < 0.01, and P < 0.001 respectively. (B) Effects of copper (Cu), zinc (Zn), and silver (Ag) for 96 h on total SODs activity in the copepod, T. japonicus. The remaining activities were recorded as percentages relative to the control. Values are means of three replicate samples and data are shown as means ± SE Asterisks ( and ) indicate significant changes with P < 0.05 and P < 0.01, respectively.

**

300 *

200 100 0 0

10

25

Cu

50 100

0

10

25

Zn

50 100

0

10

25

Ag

50 100 (µg/L)

Fig. 3. (A) Effects of benzo[a]pyrene (B[a]P), 4-nonylphenol (4-NP), and tributiltin (TBT) for 96 h on SODs mRNA expression in the copepod, T. japonicus. SOD mRNA expressions are shown as relative to 18S rRNA which was used as a reference housekeeping gene. Data are means ± SE of three replicates of exposed copepod. The symbols (, , and ) indicate P < 0.05, P < 0.01, and P < 0.001 respectively. (B) Effects of benzo[a]pyrene (B[a]P), 4-nonylphenol (4-NP), and tributiltin (TBT) for 96 h on total SODs activity in the copepod T. japonicus. The remaining activities were recorded as percentage relative to the control. Values are means of three replicate samples and data are shown as means ± SE Asterisks (, , and ) indicate significant change with P < 0.05, P < 0.01, and P < 0.001, respectively.

(mouse), along with conserved domains and CuZnSOD conserved signature sequences suggest that this protein is the putative cytoplasmic Cu/Zn-SOD. The deduced TJ-Mn-SOD protein showed four conserved metalbinding sites (H, H, D, and H) and the signal for mitochondrial-targeting with a 28 aa peptide (Suppl. Fig. 2A). Metal-binding sites are highly conserved in the sequences of all the known Mn-SODs. The N-glycosylation site (NXST) including His102 detected in TJ-MnSOD protein is also well-conserved in the eukaryotes, except for yeast (Henkle-Duhrsen et al., 1995). In the prawn mtMn-SOD,

there were two putative N-glycosylation sites; NXT and NXS, suggesting that this protein is a glycoprotein (Cheng et al., 2006a). However, TJ-Mn-SOD had a modified NXS site; Ser103Cys from 108 to 110 residues. In the brown shrimp Farfantepenaeus aztecus and the blue crab Callinectes sapidus, this site was not observed (Brouwer et al., 2003). The CuZnSOD conserved signature (DVWHHAYY) or a manganese superoxide dismutase domain (MSD) detected from 187 to 194 was a highly conserved characteristic in mtMn-SOD in the giant freshwater prawn Macrobrachium rosenbergii (Cheng et al., 2006b) and the blue crab C. sapidus (Brouwer et al., 2003). R201 residue nearby MSD plays an important role in the activity function of Mn-SOD. Recent studies revealed that there is another type of cytosolic Mn-SOD in crustaceans that use haemocyanin for oxygen transport (Brouwer et al., 2003). Haemocyanin is found in crabs (Arp and Childress, 1981), clam (Terwilliger et al., 1983), prawn (Cheng et al., 2006a), and shrimp (Gómez-Anduro et al., 2006). To date, copepods with hemoglobin are only known from the deep-sea copepod, Attheyella crassa (reviewed by Sell, 2000). It would be possible to define the identification of TJ-Mn-SOD after alignment of the deduced amino acid sequences with cytosolic or mitochondrial Mn-SOD from other arthropods, even though the existence of respiratory pigments still remains unknown in T. japonicus. As shown in Fig. 1, TJ-Mn-SOD was closely clustering with mitochondrial Mn-SOD of the copepod, L. salmonis but was distinctly made the cluster to cytosolic Mn-SOD. Therefore, the conserved domain, signal peptides, signature, and sequence homology of TJ-Mn-SOD

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

strongly suggests that this protein is a putative functional mitochondrial Mn-SOD. The genomic structure of the TJ-Cu/Zn-SOD gene is similar to C. elegans SOD1 (Cu/Zn-SOD), containing four exons and three introns (Suppl. Fig. 3A). Compared to those of vertebrates, TJ-Cu/Zn-SOD lacks one exon and one intron with a relatively short first exon. In mammals, the first exon encoding for 24 amino acids is important for its structural stability by forming the first two antiparallel b-sheets (Getzoff et al., 1989). However, TJ-Cu/Zn-SOD had just 6 bp encoding for 2 amino acids for the first exon, while vertebrates, fruitfly, and nematode had 66–72 bp that encode for 22– 24 amino acids. Also, the genomic structure of Cu/Zn-SOD seems not to be conserved in invertebrates, compared to vertebrates. For example, the Cu/Zn-SOD gene is intronless in the human parasite, Clonorchis sinensis and has three exons and two introns in the pseudophyllidaean tapeworm Spirometra erinacei (Li et al., 2010). Meanwhile, Cu/Zn-SOD was identified in the abalone Haliotis diversicolor (Zhang et al., 2009). H. diversicolor and the bay scallop Argopecten irradians (Bao et al., 2009) have five exons and four or six introns, respectively. We found a different form of genomic organization in the copepod TJ-Mn-SOD. However, only little information is available from the genomic structure of Mn-SOD compared to Cu/Zn-SOD in marine invertebrates (Suppl. Fig. 3B). While the corresponding counterparts of other species show five exons and four introns, TJ-Mn-SOD has only two exons similar to the fruitfly. Overall, this finding indicates that Cu/Zn-SOD and Mn-SOD may have different structure and/or function in invertebrates including T. japonicus. Further studies at protein level will thus be necessary to define structure and function of TJ-SODs. Previously, most studies have shown a single SOD transcript pattern or total SOD activity after exposure to various chemicals. However, the change of total SOD activity is not indicating different expression rates of each SOD gene. Likewise, each mRNA expression pattern is not reflecting the total SOD activities. To overcome the above vulnerable point, we quantified each mRNA and checked total SOD activity upon exposure to different environmental pollutants with different concentration. In the copepod T. japonicus, we observed an increase of SOD transcripts and enzyme level after exposure to Cu and Zn at high concentrations (50 lg L1 and 100 lg L1) (Fig. 3). In fact copper and zinc, though essential, are toxic heavy metals at excess. Particularly, copper strongly induces the production of ROS. In the freshwater bivalve, Corbicula fluminea exposed to Cu/Zn-SOD, mRNA levels decrease after exposure to higher concentrations (50 lg L1) for 12 h in the gill, while it decreases at low concentrations (10 lg L1) and then increases again at high concentration (50 lg L1) in the digestive tract (Bigot et al., 2010). Hansen et al. (2006) reported that transcription levels of SOD significantly increased in the gill, while the enzyme level was modulated in all the tissues of the brown trout Salmo trutta transferred to a Cu-contaminated river. Kim et al. (2007) showed that the 24 h and 72 h Cu and Zn (5 and 10 lM) treatment also increased the expression of both SODs at transcription level in various tissues of the disk abalone, H. discus discus. Farombi et al. (2007) also showed that the activity of SOD after exposure to Cu and Zn was significantly increased in the liver and kidney of the African catfish, Clarias gariepinus where it reached high levels at high Cu and Zn concentrations. Meanwhile, in bivalves exposed to Zn (19.68 lg L1), SOD activity was elevated by 13.3% (Zhang et al., 2010). Overall, these findings imply that modulation of SOD genes at the transcription level would depend on isoforms, tissue type, and assay methods based on semi-quantitative and/or real-time RT–PCR assays. In the present study, the TJ-Mn-SOD transcription level increased at low concentration of Ag (25 lg L1), indicating that this isoform would be more sensitive to Ag exposure. Ag is present in

1473

many commercial products such as water filters, food packaging, shampoo, household appliances, and medical devices due to its antibacterial properties (Volker et al., 2004. Compared to Cu and Zn, the toxic effect of Ag remains still unknown in aquatic animals. The silver (I) perchlorate salt (AgClO4) increased GR1 and Mn-SOD mRNA levels and their activities in yeast Candida albicans (Rowan et al., 2010). More recent studies suggested that Ag-conjugated nanoparticles (AgNP) release Ag+ in solution, and the dissolved Ag+ ion can induce oxidative stress. For examples, Rho et al. (2009) demonstrated that the soil nematode, AgNPs-exposed Caenorhabditis elegans showed an increase in the expression of SOD-3, suggesting that oxidative stress may mediate the mode of action of AgNP-induced toxicity. Choi et al. (2010) reported that AgNPreleasing Ag free radicals induced endogenous antioxidant GSH activity and reduced catalase and glutathione peroxidase mRNA levels in zebrafish liver, indicating AgNP-induced oxidative damage. Meanwhile, our previous study revealed that Ag treatment upregulated the expression of GST isoforms which is involved in antioxidant mechanisms in T. japonicus (Lee et al., 2008). Overall, Ag may modulate antioxidant enzymes at transcription and translation levels, resulting in the accumulation of oxyradicals which cause oxidative damage. To investigate the relationship between heavy metal exposure and TJ-SODs transcripts, we analyzed the promoter region of the TJ-SODs gene, as shown in Fig. 2. In a 2489 bp and 4019 bp of 50 flanking region upstream from the start codon (ATG) of TJ-Cu/ZnSOD and TJ-Mn-SOD, respectively, several transcription factor binding motifs were found: p53, ERE, and XRE for TJ-Cu/Zn-SOD gene and p53, ERE-half site, XRE, nd MRE for TJ-Mn-SOD gene. In the Mn-SOD gene, the presence of p53, XRE, and MRE was reported previously (Cho et al., 2009). The motifs such as p53, AP-1, CREB, C/EBP, USF, and NF-AT that are found in mammalian Mn-SOD are known to play important roles in the modulation of Mn-SOD during stimulation (Kaneko et al., 2004; Qiu et al., 2008) and many motifs were also detected (data not shown) in the TJ-SODs gene. In general, the p53 gene is activated by oxidative stress-inducing agents and translocated into mitochondria where it mediates the reduction of superoxide by interacting with Mn-SOD (Zhao et al., 2005). In human hepatoma cells, functional analysis of the mutant Cu/Zn-SOD gene revealed that the existence of the MRE in the promoter region requires for the activation of Cu/Zn-SOD gene by metal ions (Yoo et al., 1999). In our present study, the presence of the MRE site on the promoter region of TJ-Mn-SOD is closely related to the expression level of TJ-Mn-SOD mRNA higher than that of TJ-Cu/ Zn-SOD after exposure to heavy metals. XRE is a binding site of the aryl hydrocarbon receptor (AhR) and is involved in differential SOD modulation during exposure to xenobiotic compounds in teleosts (Shi et al., 2005; Cho et al., 2009). The presence of ERE is regulated by ER which is involved in estrogen action by endocrine disrupting chemicals. These previous researches support the modulation of TJ-SODs transcripts levels after exposure to environmental chemicals such as B[a]P, 4-NP, and TBT that may be regulated by the interaction of these chemicals with the XRE and ERE-half site, as shown in Fig. 2. Wang et al. (2009) demonstrated that B[a]P binds AhR when Cu/Zn-SOD and catalase are overexpressed, and then these induced enzymes subsequently upregulate phase I and phase II enzymes such as CYP1A1 and GST. This finding indicates that the overexpressed TJ-Cu/Zn-SOD and TJ-Mn-SOD transcript may be involved in B[a]P detoxification. However, the effect of B[a]P on the SOD activity did not show consistent trends with previous reports. For examples, Monari et al. (2009) reported that Mn-SOD activity decreased in response to B[a]P (0.5 mg L1 for 24 h and 7 d), while Cu/Zn-SOD activity increased at the B[a]P-exposed group in the haemocytes of the mollusc Chamelea gallina. Also, in the coral Montastraea faveolata, its activity significantly increased at 72 h post B[a]P exposure

1474

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475

(Ramos and Garcia, 2007). Pan et al. (2006) showed that SOD activities were induced at low concentration (0.5 lg L1 and 1.0 lg L1) but turned to a basal level at high concentrations (10 lg L1 and 50 lg L1) in the scallop, Chlamys ferrari. However, we observed that SOD activities were extremely induced at high concentration (10 lg L1 and 20 lg L1) after exposure to B[a]P for 96 h. These findings indicate that the modulation of SOD activity by exposure to B[a] P may be quite different depending on species and isoforms. In 4-NP-exposed T. japonicus, the transcripts level of both TJSODs highly increased at low concentrations (1 lg L1 and 5 lg L1), while the SOD activity changed not significantly at the same concentrations (Fig. 4). In general, 4-NP used in plastic industries has been shown to disrupt normal reproductive processes in dimorphic species (Lee et al., 1996). The previous studies suggested that NP may enhance the generation of ROS by inhibition of cytochrome P450 activity (Griveau et al., 1995; Lee et al., 1996). In unfertilized eggs of Chinese rare minnow, Gobiocypris rarus, 4-NP induced ROS generation but SOD activity was significantly decreased in the 50–200 lg L1 concentrations (Zhang et al. 2008). 4-NP also inhibited significantly SOD activity in both gills and the digestive gland from the lowest concentration (0.025 mg L1) in the clam, Tapes philippinarum (Matozzo et al., 2004). Moreover, NP-treated rats showed a significant decrease in SOD activity (Chitra et al., 2002). Inhibition of TJ-SOD at transcription and translation level was also observed in the TBT-exposed group at high concentrations (10 and 20 lg L1) (Fig. 4). TBT is used in antifouling paints and known to induce imposex by pertubating the hormone metabolism in aquatic animals. As shown in our study, TBT decreased the Cu/Zn-SOD mRNA level significantly at 1.75 lg L1 concentration in the abalone, Haliotis diversicolor supertexta after 12 h and 24 h exposure (Zhang et al., 2009). After 30 d exposure, TBT-treated abalone showed an inhibition of SOD activity at 50 ng L1 by 0.5-fold of the control (Zhou et al., 2010). In TBT and 4-NP exposure, the reduced SOD level may reflect a loss of the protective cellular capacity to scavenge superoxide (Matozzo et al., 2004). In the present study, the heavy metals-, B[a]P-, and TBT-exposed T. japonicus showed consistent expression patterns of the TJ-SOD genes between transcription and translation levels. However, in 4-NP-treated T. japonicus, the transcript level of both TJSODs highly increased at low concentration (1 lg L1 and 5 lg L1) while the SOD activity was not significantly changed at the same concentration. This finding suggests that the SOD enzyme level may be regulated during post-translational and transcriptional processes, even though all the exposure concentrations were maintained in the range of NOEC values. Overall, the modulation of SOD may be distinctly regulated depending on species, tissue type, exposure concentration, exposure time, and type of contaminants as Matozzo et al. (2004) suggested. In conclusion, we successfully cloned and sequenced the fulllength TJ-Cu/Zn-SOD and TJ-Mn-SOD from T. japonicus. Both TJSOD genes showed well-conserved domains that are required for metal binding and several common characteristics. In the 50 -flanking region of the TJ-Cu/Zn-SOD and TJ-Mn-SOD genes, we observed several transcriptional regulatory elements such as p53, XRE, MRE, and ERE-half site, suggesting that both TJ-SODs genes are possibly modulated by the interaction of these motifs with environmental pollutants. Heavy metals (Cu, Zn, and Ag) elevated both TJ-Cu/ZnSOD and TJ-Mn-SOD mRNA levels and total SOD activities. B[a]P treatment showed a significant increase in TJ-SOD at the transcription and translation level. These findings demonstrate that TJ-SODs are inducible genes and potential biomarkers indicating these pollutants in their environmental settings. However, the study on mode of action of 4-NP and TBT on the decrease of TJ-SODs mRNA at gene and enzyme level would require further study. Its applica-

bility as a molecular marker for environmental health could further be shown through studies in mesocosms or the field. Acknowledgements We thank Dr. Hans-U. Dahms for his critical comments on the manuscript. This work was supported by a grant from Eco-Technopia 21 (2009) funded to Jae-Seong Lee, and also supported by a grant of the R&D of the Ministry of Land, Transportation and Marine Affairs of Korea (2010) funded to Gyung Soo Park. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.chemosphere.2011.04.043. References Arp, A.J., Childress, J.J., 1981. Functional characteristics of the blood of the deep-sea hydrothermal vent brachyuran crab. Science 214, 559–561. Bao, Y., Li, L., Wu, Q., Zhang, G., 2009. Cloning, characterization, and expression analysis of extracellular copper/zinc superoxide dismutase gene from bay scallop Argopecten irradians. Fish Shellfish Immunol. 27, 17–25. Bigot, A., Minguez, L., Giambérini, L., Rodius, F., 2010. Early defense responses in the freshwater bivalve Corbicula fluminea exposed to copper and cadmium: transcriptional and histochemical studies. Environ. Toxicol. (DOI 10.1002/ tox.20599). Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brouwer, M., Brouwer, T.H., Grater, W., Brown-Peterson, N., 2003. Replacement of a cytosolic cooper/zinc superoxide dismutase by a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport. Biochem. J. 374, 219–228. Cheng, W., Tung, Y.H., Chiou, T.T., Chen, J.C., 2006a. Cloning and characterisation of mitochondrial manganese superoxide dismutase (mtMnSOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol. 21, 453– 466. Cheng, W., Tung, Y.H., Liu, C.H., Chen, J.C., 2006b. Molecular cloning and characterisation of copper/zinc superoxide dismutase (Cu, Zn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol. 21, 102–112. Chitra, K.C., Latchoumycandane, C., Mathur, P.P., 2002. Effect of nonylphenol on the antioxidant system in epididymal sperm of rats. Arch. Toxicol. 76, 545–551. Cho, Y.S., Lee, S.Y., Bang, I.C., Kim, D.S., Nam, Y.K., 2009. Genomic organization of mRNA expression of manganese superoxide dismutase (Mn-SOD) from Hemibarbus mylodon (Teleostei, Cypriniformes). Fish Shellfish Immunol. 27, 571–576. Choi, J.E., Kim, S., Ahn, J.H., Youn, P., Kang, J.S., Park, K., Yi, J., Ryu, D.Y., 2010. Induction of oxidative stress and apoptosis by silver nanoparticles in the liver of adult zebrafish. Aquat. Toxicol. 100, 151–159. Dazy, M., Masfaraud, J.F., Férard, J.F., 2009. Induction of oxidative stress biomarkers associated with heavy metal stress in Fontinalis antipyretica Hedw. Chemosphere 75, 297–302. Farombi, E.O., Adelowo, O.A., Ajimoko, Y.R., 2007. Biomarkers of oxidative stress and heavy metal levels as indicators of environmental pollution in African cat fish (Clarias gariepinus) from Nigeria Ogun river. Int. J. Environ. Res. Public Health 4, 158–165. Fent, K., Weston, A.A., Caminada, D., 2006. Ecotoxicology of human pharmaceuticals. Aquat. Toxicol. 76, 122–159. Folz, R.J., Guan, J., Seldin, M.F., Oury, T.D., Enghild, J.J., Crapo, J.D., 1997. Mouse extracellular superoxide dismutase: primary structure, tissue-specific gene expression, chromosomal localization, and lung in situ hybridization. Am. J. Respir. Cell Mol. Biol. 17, 393–403. Geret, F., Manduzio, H., Company, R., Leboulenger, F., Bebianno, M.J., Danger, J.M., 2004. Molecular cloning of superoxide dismutase (Cu/Zn-SOD) from aquatic molluscs. Mar. Environ. Res. 58, 619–623. Getzoff, E.D., Tainer, J.A., Stempien, M.M., Bell, G.I., Hallewell, R.A., 1989. Evolution of Cu/Zn superoxide dismutase and the Greek key beta-barrel structural motif. Proteins 5, 322–336. Gómez-Anduro, G.A., Barillas-Mury, C.V., Peregrino-Uriarte, A.B., Gupta, L., GollasGalván, T., Hernández-López, J., Yepiz-Plascencia, G., 2006. The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression. Dev. Comp. Immunol. 30, 893–900. Griveau, J.F., Dumont, E., Renard, P., Callegari, J.P., LeLannou, D., 1995. Reactive oxygen species, lipid peroxidation and enzymatic defense systems in human spermatozoa. J. Reprod. Fert. 103, 17–26. Hansen, B.H., Rømma, S., Søfteland, L.I., Olsvik, P.A., Andersen, R.A., 2006. Induction and activity of oxidative stress-related proteins during waterborne Cu-exposure in brown trout (Salmo trutta). Chemosphere 65, 1707–1714.

B.-M. Kim et al. / Chemosphere 84 (2011) 1467–1475 Hansen, B.H., Altin, D., Booth, A., Vang, S.H., Frenzel, M., Sørheim, K.R., Brakstad, O.G., Størseth, T.R., 2010. Molecular effects of diethanolamine exposure on Calanus finmarchicus (Crustacea: Copepoda). Aquat. Toxicol. 99, 212–222. Henkle-Duhrsen, K., Tawe, W., Warnecke, C., Walter, R.D., 1995. Characterization of the manganese superoxide dismutase cDNA and gene from the human parasite Onchocerca volvulus. Biochem. J. 308, 441–446. Kaneko, M., Takahashi, T., Niinuma, Y., Nomura, Y., 2004. Manganese superoxide dismutase is induced by endoplasmic reticulum stress through IRE1-mediated nuclear factor (NF)-kB and AP-1 activation. Biol. Pharm. Bull. 27, 1202–1206. Kim, K.-Y., Lee, S.Y., Cho, Y.S., Bang, I.C., Kim, K.H., Kim, D.S., 2007. Molecular characterization and mRNA expression during metal exposure and thermal stress of copper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotis discus discus. Fish Shellfish Immunol. 23, 1043–1059. Kwok, K.W., Leung, K.M., 2005. Toxicity of antifouling biocides to the intertidal harpacticoid copepod Tigriopus japonicus (Crustacea, Copepoda): effects of temperature and salinity. Mar. Pollut. Bull. 51, 830–837. Lee, P.C., Patra, S.C., Stelloh, C.T., Lee, W., Struve, M., 1996. Interaction of nonylphenol and hepatic CYP1A in rats. Biochem. Pharmacol. 52, 885–889. Lee, K.-W., Raisuddin, S., Hwang, D.-S., Park, H.G., Lee, J.-S., 2007a. Acute toxicities of trace metals and common xenobiotics to the marine copepod Tigriopus japonicus: evaluation of its use as a benchmark species for routine ecotoxicity tests in western pacific coastal regions. Environ. Toxicol. 22, 532–538. Lee, Y.-M., Lee, K.-W., Park, H., Park, H.G., Raisuddin, S., Ahn, I.-Y., Lee, J.-S., 2007b. Sequence, biochemical characteristics and expression of a novel sigma-class of glutathione S-transferase from the intertidal copepod, Tigriopus japonicus with a possible role in antioxidant defense. Chemosphere 69, 893–902. Lee, K.-W., Raisuddin, S., Rhee, J.-S., Hwang, D.-S., Yu, I.-T., Lee, Y.-M., Park, H.G., Lee, J.-S., 2008. Expression of glutathione S-transferase (GST) genes in the marine copepod Tigriopus japonicus exposed to trace metals. Aquat. Toxicol. 89, 158– 166. Lee, J.-S., Rhee, J.-S., Kim, R.-O., Hwang, D.-S., Han, J., Choi, B.-S., Park, G.-S., Kim, I.-C., Park, H.G., Lee, Y.-M., 2010. The copepod Tigriopus japonicus genomic DNA information (574 Mb) and molecular anatomy. Mar. Environ. Res. 69, S21–23. Li, A.H., Na, B.K., Ahn, S.K., Cho, S.H., Pak, J.H., Park, Y.K., Kim, T.S., 2010. Functional expression and characterization of a cytosolic copper/zinc-superoxide dismutase of Spirometra erinacei. Parasitol. Res. 106, 627–635. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCt method. Methods 25, 402–408. Matozzo, V., Ballarin, L., Marin, M.G., 2004. Exposure of the clam Tapes philippinarum to 4-nonylphenol: changes in anti-oxidant enzyme activities and re-burrowing capability. Mar. Pollut. Bull. 48, 563–571. Monari, M., Foschi, J., Matozzo, V., Marin, M.G., Fabbri, M., Rosmini, R., Serrazanetti, G.P., 2009. Investigation of EROD, CYP1A immunopositive proteins and SOD in haemocytes of Chamelea gallina and their role in response to B[a]P. Comp. Biochem. Physiol. C 149, 382–392. Pan, L.Q., Ren, J., Liu, J., 2006. Responses of antioxidant systems and LPO level to benzo(a)pyrene and benzo(j)fluoranthene in the haemolymph of the scallop Chlamys ferrari. Environ. Pollut. 141, 443–451. Qiu, X., Aiken, K.J., Chokas, A.L., Beachy, D.E., Nick, H.S., 2008. Distinct functions of CCAAT enhancer-binding protein isoforms in the regulation of manganese superoxide dismutase during interleukin-1beta stimulation. J. Biol. Chem. 283, 25774–25785. Raisuddin, S., Kwok, K.W., Leung, K.M., Schlenk, D., Lee, J.-S., 2007. The copepod Tigriopus: a promising marine model organism for ecotoxicology and environmental genomics. Aquat. Toxicol. 83, 161–173.

1475

Ramos, R., Garcia, E., 2007. Induction of mixed-function oxygenase system and antioxidant enzymes in the coral Montastraea faveolata on acute exposure to benzo(a)pyrene. Comp. Biochem. Physiol. C 144, 348–355. Rhee, J.-S., Raisuddin, S., Lee, K.-W., Seo, J.S., Ki, J.-S., Kim, I.-C., Park, H.G., Lee, J.-S., 2009. Heat shock protein (Hsp) gene responses of the intertidal copepod Tigriopus japonicus to environmental toxicants. Comp. Biochem. Physiol. C 149, 104–112. Rho, J.Y., Sim, S.J., Yi, J., Park, K., Chung, K.H., Ryu, D.Y., Choi, J., 2009. Ecotoxicity of silver nanoparticles on the soil nematode Caenorhabditis elegans using functional ecotoxicogenomics. Environ. Sci. Technol. 43, 3933–3940. Rowan, R., McCann, M., Kavanagh, K., 2010. Analysis of the response of Candida albicans cells to silver (I). Med. Mycol. 48, 498–505. Sell, A.F., 2000. Life in the extreme environment at a hydrothermal vent: haemoglobin in a deep-sea copepod. Proc. Roy. Soc. Lond. B 267, 2323–2326. Shi, H., Sui, Y., Wang, X., Luo, Y., Ji, L., 2005. Hydroxyl radical production and oxidative damage induced by cadmium and naphthalene in liver of Carassius auratus. Comp. Biochem. Physiol. C 140, 115–121. Terwilliger, R.C., Terwilliger, N.B., Arp, A.J., 1983. Thermal vent clam (Calyptogena magnica) haemoglobin. Science 219, 981–983. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64, 178–189. Volker, A., Thorsten, B., Peter, S., Michael, W., Peter, S., Elvira, D., Eugen, D., Reinhard, S., 2004. An in vitro assessment of the antibacterial properties and cytotoxicity of nanoparticulate silver bone cement. Biomaterials 25, 4383–4391. Wang, M.H., Wang, G.Z., 2010. Oxidative damage effects in the copepod Tigriopus japonicus Mori experimentally exposed to nickel. Ecotoxicology 19, 273– 284. Wang, Z., Yang, H., Ramesh, A., Roberts, L.J., Zhou, L., Lin, X., Zhao, Y., Guo, Z., 2009. Overexpression of Cu/Zn-superoxide dismutase and/or catalase accelerates benzo(a)pyrene detoxification by upregulation of the aryl hydrocarbon receptor in mouse endothelial cells. Free Rad. Biol. Med. 47, 1221–1229. Wong, S.W., Leung, P.T., Djurisic´, A.B., Leung, K.M., 2010. Toxicities of nano zinc oxide to five marine organisms: influences of aggregate size and ion solubility. Anal. Bioanal. Chem. 396, 609–618. Yoo, H.Y., Chang, M.S., Rho, H.M., 1999. Heavy metal-mediated activation of the rat Cu/Zn superoxide dismutase gene via a metal-responsive element. Mol. Gen. Genet. 262, 310–313. Zhang, X., Yang, F., Cai, Y.Q., Xu, Y., 2008. Oxidative damage in unfertilized eggs of Chinese rare minnow (Gobiocypris rarus) exposed to nonylphenol. Environ. Toxicol. Chem. 27, 213–219. Zhang, K., Wang, G., Zou, Z., Jia, X., Wang, S., Lin, P., Chen, Y., Zhang, Z., Wang, Y., 2009. Cloning, characterization and TBT exposure response of CuZn superoxide dismutase from Haliotis diversicolor supertexta. Mol. Biol. Rep. 36, 583– 594. Zhang, Y., Song, J., Yuan, H., Xu, Y., He, Z., 2010. Concentrations of cadmium and zinc in seawater of Bohai Bay and their effects on biomarker responses in the bivalve Chlamys farreri. Arch. Environ. Contam. Toxicol. 59, 120–128. Zhao, Y., Chaiswing, L., Velez, J.M., Batinic-Haberle, I., Colburn, N.H., Oberley, T.D., St Clair, D.K., 2005. P53 translocation to mitochondria precedes its nuclear translocation and targets mitochondrial oxidative defense protein-manganese superoxide dismutase. Cancer Res. 65, 3745–3750. Zhou, J., Zhu, X.S., Cai, Z.H., 2010. Tributyltin toxicity in abalone (Haliotis diversicolor supertexta) assessed by antioxidant enzyme activity, metabolic response, and histopathology. J. Hazard. Mater. 183, 428–433.