Zn- and Mn-superoxide dismutase (SOD) in response to environmental biocides

Chemosphere 120 (2015) 470–478

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Modulated expression and enzymatic activity of the monogonont rotifer Brachionus koreanus Cu/Zn- and Mn-superoxide dismutase (SOD) in response to environmental biocides Bo-Mi Kim a,1, Jin Wuk Lee a,1, Jung Soo Seo b, Kyung-Hoon Shin c, Jae-Sung Rhee d,⇑, Jae-Seong Lee a,⇑ a

Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746, South Korea Pathology Team, National Fisheries Research & Development Institute, Busan 619-902, South Korea Department of Marine Sciences and Convergent Technology, College of Science and Technology, Hanyang University, Ansan 426-791, South Korea d Department of Marine Science, College of Natural Sciences, Incheon National University, Incheon 406-772, South Korea b c

h i g h l i g h t s  Isolation of Cu/Zn-SOD and Mn-SOD genes from rotifer.  Modulation of SOD expressions in response to biocides.  Reduction of SOD enzymatic activity in response to biocides.

a r t i c l e

i n f o

Article history: Received 26 June 2014 Received in revised form 8 August 2014 Accepted 14 August 2014

Handling Editor: A. Gies Keywords: Monogonont rotifer Brachionus koreanus Superoxide dismutase Biocides Enzymatic activity

a b s t r a c t Superoxide dismutases (SODs) are important antioxidant enzymes whose expression levels are often used as biomarkers for oxidative stress. To investigate the biomarker potential of the monogonont rotifer Brachionus koreanus SOD genes, the full-length Cu/Zn-SOD (Bk-Cu/Zn-SOD) and Mn-SOD (Bk-Mn-SOD) genes were cloned from genomic DNA and characterized. All amino acid residues involved in the formation of tertiary structure and metal binding in Bk-Cu/Zn-SOD and Bk-Mn-SOD were highly conserved across species. Phylogenetic analysis revealed that Bk-Mn-SOD, in particular, was closely clustered with mitochondrial Mn-SOD. Transcript analysis after exposure to six different biocides (alachlor, chlorpyrifos, dimethoate, endosulfan, lindane, and molinate) revealed that the transcriptional level of Bk-Cu/Zn-SOD was significantly increased in a dose-dependent manner. In contrast, the level of Bk-Mn-SOD transcript was significantly increased compared with control cells in response to chlorpyrifos, endosulfan, and molinate at their no observed effect concentrations (NOECs). However, exposure to alachlor, chlorpyrifos, and molinate significantly reduced the enzymatic activity of total SOD protein, while a decreased pattern was observed in all biocide treatments. Taken together, these results indicate that exposure to waterborne environmental biocides induces the transcription of Bk-Cu/Zn-SOD and Bk-Mn-SOD, but inhibits the enzymatic activity of Bk-SODs. These results contribute to our understanding of the modes of action of oxidative stress-mediating biocides on rotifer. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction The superoxide dismutases (SODs) are a group of metalloenzymes that catalyze the conversion of reactive superoxide anions into hydrogen peroxide, which is an essential reactive oxygen species (ROS). SODs are regarded as essential antioxidant enzymes, and have been observed in all aerobic organisms examined to date ⇑ Corresponding authors. Tel.: +82 31 290 7011. 1

E-mail addresses: [email protected] (J.-S. Rhee), [email protected] (J.-S. Lee). These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.chemosphere.2014.08.042 0045-6535/Ó 2014 Elsevier Ltd. All rights reserved.

(Stegeman et al., 1992; Hayes and McLellan, 1999). Based on their metal cofactor, SODs are classified as copper–zinc SOD (Cu/ZnSOD), iron SOD (Fe-SOD), or manganese SOD (Mn-SOD) (Fridovich, 1997). The expression of SODs is significantly modulated in response to a variety of stressors, including pollutants (Doyotte et al., 1997). Thus, their responses have been considered to be potential biomarkers for environmental pollutants (Hayes and McLellan, 1999). Organic chemicals are continuously loaded into the aquatic environment upon release from urban communities and industries. Among these pollutants, biocides also are being released into

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

aquatic ecosystem at an increasingly rapid rate (Wauchope, 1978; Konstantinou et al., 2006). Many biocides are known to cause oxidative stress by generating ROS (Valavanidis et al., 2006). Particularly, biocides such as chlorpyrifos, dimethoate, endosulfan, lindane, alachlor, and molinate are commonly used worldwide and have been detected in the aquatic environment. Moreover, these biocides have been shown to cause oxidative stress and to alter SOD activity in aquatic organisms (Ishii et al., 2004; Yi et al., 2007; Woo et al., 2009; Galhano et al., 2011; Shao et al., 2012; Ali et al., 2014). Endosulfan induces ROS and inhibits SOD activity in zebrafish (Shao et al., 2012). On the other hand, alachlor stimulates the activities of SOD, GST, and catalase in crucian carp (Yi et al., 2007). Dimethoate increases lipid peroxidation and the amount of glutathione, while it inhibits SOD activity in Indian carp Channa punctatus (Ali et al., 2014). Interestingly, chlorpyrifos has been shown to induce apoptosis and to stimulate ROS-dependent SOD activity in fruit flies and nematodes (Ishii et al., 2004; Gupta et al., 2010), whereas molinate has been shown to increase the ROS-dependent production of malonedialdehyde (MDA) and to inhibit SOD activity in cyanobacteria (Galhano et al., 2011). Similarly, lindane reduces ROS-dependent SOD activity in rat livers (Radosavljevic et al., 2009). Taken together, these findings suggest that these biocides, which were used in this study, are suitable stimuli for studies of SOD expression and enzymatic activity in the monogonont rotifer Brachionus koreanus. Invertebrates constitute 95% of all species in the animal kingdom and are key components of marine and estuarine ecosystems. Thus, comprehensive investigations of the potential impacts of environmental pollutants on marine invertebrates are needed to safeguard the sustainability of these ecosystems (Leung et al., 2001). Among the marine invertebrates, the monogonont rotifer Brachionus sp. is a suitable species for ecotoxicological studies due to its wide distribution along coastal lines, including marine and estuarine waters; vast availability; ease of cultivation; small size; and short generation cycle (Snell and Janssen, 1995; Dahms et al., 2011). As an important producer and secondary consumer, rotifers play a bridging role as an energy transmitter and as a toxicant transporter in aqueous food webs. Another aspect of rotifers that makes it suitable for gene expression biomarker studies of environmental pollutants is extensive genomic information available (Lee et al., 2011; Kim et al., 2013). Thus, B. koreanus as a Korean strain of the monogonont rotifer would be an ideal organism for the monitoring of environmental biocides. Detailed studies of SODs in B. koreanus would help develop robust assessments for the risk of environmental pollutantinduced oxidative stress. However, a comprehensive characterization of the responses of B. koreanus SOD genes and enzymatic activities in response to different biocides has not yet been performed. Here, we report the cloning and sequencing of the full-length Bk-SOD genes. We also describe the effects of exposure to waterborne biocides on the transcript levels and the enzymatic activities of Bk-SODs with the aim of identifying biomarker potential in the rotifer B. koreanus.

2. Materials and methods 2.1. Rotifer culture and maintenance The rotifer B. koreanus was collected at Uljin, South Korea (36°580 43.0100 N, 129°240 28.4000 E). A single individual was isolated, reared, and maintained in 0.2 lm-filtered artificial seawater (TetraMarine Salt Pro, Tetra™, Blacksburg, VA, USA). Cultures were maintained at 25 °C with a light:dark 12:12 h photoperiod and 15 practical salinity units (psu) of salinity. The green algae Chlorella

471

vulgaris (Daesang Corporation, Seoul, South Korea) was used as a live diet (approximately 6  104 cells mL1). Relative short generation cycle is observed in B. koreanus within approximately 24 h. We assume that the rotifer B. koreanus reproduces by parthenogenesis without a sexual cycle, as we have never observed any males or resting eggs, even under harsh environmental conditions. Species identification of B. koreanus was confirmed by morphological assessment (algometry analysis using lorica characteristics and mean body length), mitochondrial genome analysis, and phylogenetic analysis (mitochondrial CO1 and nuclear rDNA ITS1 genes) as described in Hwang et al. (2013a,b). 2.2. Molecular cloning of Bk-SOD genes Partial sequences of SOD genes were obtained from B. koreanus genomic DNA databases (Lee et al., 2011). To identify exon/intron boundaries and transcript sequences, 50 - and 30 -RACE primers were synthesized (Table 1) according to the manufacturer’s instructions. To obtain full-length SOD cDNA, a GeneRacer kit (Invitrogen, Carlsbad, CA, USA) was employed. A series of RACE reactions were performed under the following conditions: 1 cycle of 94 °C/4 min; 40 cycles of 98 °C/25 s, 55 °C/30 s, 72 °C/60 s; and 1 cycle of 72 °C/ 10 min. Amplified PCR products were extracted from 1% agarose/ TBE gels, subcloned into pCR™2.1 TA vector (TA CloningÒ Kit; Invitrogen, Carlsbad, CA, USA) and sequenced with an ABI PRISM 3700 DNA analyzer (Bionics Co., Seoul, South Korea). 2.3. Phylogenetic analysis For phylogenetic analysis of Bk-Mn-SOD, its amino acid sequence was aligned with those of other invertebrate Mn-SOD proteins. Alignments were performed with Clustal X (ver. 1.83) using the following parameter settings: pairwise alignment – gap opening of 10, gap extension of 0.1; multiple alignment – gap opening of 10, gap extension of 0.2. In total, 33 sequences were retrieved from the GenBank/DDBJ/EMBL databases and were aligned. Gaps and missing data were excluded from the analysis. The resultant data matrix was converted to the nexus format, and the matrix was analyzed with MrBayes (ver 3.1.2) using a general time-reversible model. Four parallel Monte Carlo Markov differentially heated chains were run for 1 000 000 generations with the appropriate posterior probabilities. Sampling frequencies were assigned every 100 generations using the Jones, Taylor, and Thornton amino acid substitution matrix. After analysis, the first 10 000 generations were deleted as the burn-in process and a consensus tree was constructed. The consensus tree was visualized in the Tree View mode of PHYLIP. Bayesian posterior probabilities (0.50) were determined for each branch node. 2.4. Biocide exposure To study the molecular and biochemical effects of environmental biocides on the mRNA expression levels and enzymatic activities of SODs, B. koreanus was exposed to six biocides (alachlor, chlorpyrifos, dimethoate, endosulfan, lindane, and molinate). All biocides were purchased from Sigma (St. Louis, MO, USA; purity > 99%). Stock solutions were dissolved in dimethylsulfoxide (DMSO; Sigma), and the final solvent concentration did not exceed 0.5% in any exposure test. To determine the toxicity values in response to biocide exposure, neonates (less than 12 h old) were placed in 12-well culture plates (SPL Life Sciences, Seoul, South Korea) at a density of ten neonates/well (working volume, 4 ml). Neonates were separated from the adults through sieving with a 70 lm mesh. The neonates were then exposed to a wide range of concentrations of each biocide for 24 h in static culture with three replicates performed for

472

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

Table 1 List of primers used in this study. Gene

Oligo name

Sequence (50 ? 30 )

Remarks

Bk-CuZnSOD

5GSP1 5GSP2 3GSP1 3GSP2 RT-F RT-R

GACCACTCCTTTCACTGTTTCGC CTAATGCATCCGTTAGTTGTATC GACCTAGGCAACATTACTGCTG CTCGGACCCTGACGATCTAG GGCGAAACAGTGAAAGGAGTGG GTGAATGTGAAAGCCGTGTTGC

50 -RACE

5GSP1 5GSP2 3GSP1 3GSP2 RT-F RT-R

CTATTTGATCAGTAACTGAACC CAGCGACTAACATATCTACCATGC GCTCCAGCACTTAAATTTAATGGTG GTCCAAATCAAGATCCATTACAAGC TGCCTCAACTGGTATTCAAGGATC TAATGGATCTTGATTTGGACATGCAG

50 -RACE

RT-F RT-R

TCGGGCTGTCTCGTTCGTGATTC TGCCACAGTCGACAGTTGATAGG

18S rRNA real-time PCR amplification

Bk-MnSOD

18S rRNA

each concentration at 25 °C, and their survival at 24 h was monitored using a stereomicroscope. During the experiments, the neonates were not fed. Concentrations chosen for all subsequent exposure experiments were based on no observed effect concentration (NOEC) values for B. koreanus (Table 2). To examine whether different biocides exerted dose-dependent effects on either the mRNA expression levels or the enzymatic activities of Bk-SODs, the following biocides and concentrations were used; alachlor (0.3, 3, 30, and 300 lg L1), chlorpyrifos (0.5, 5, 50, and 500 lg L1), dimethoate (29, 290, 2900, and 29 000 lg L1), endosulfan (0.1, 1, 10, and 100 lg L1), lindane (1.4, 14, 140, and 1400 lg L1), and molinate (3, 30, 300, and 3000 lg L1). As a control, 0.1% DMSO was administered to achieve the same DMSO concentration as was present in the most concentrated final biocide solution. Rotifers were exposed for 24 h in static culture. Three experimental replicates were performed for each concentration with approximately 1000 rotifers in each container. 2.5. Total RNA extraction and single-stranded cDNA synthesis Whole bodies (approximately 500 rotifers) were homogenized in three volumes of TRIZOwwLÒ reagent (Invitrogen, Paisley, Scotland) with a tissue grinder, and the resultant homogenates were stored at 80 °C until use. Total RNA was isolated from the rotifer homogenates according to the manufacturer’s instructions. Genomic DNA was removed using a non-specific endonuclease, DNase I (Sigma, St. Louis, MO, USA). The quantity of the isolated RNA was assessed at 230, 260, and 280 nm using a spectrophotometer (Ultrospec 2100 pro, Amersham Bioscience, Freiburg, Germany). To check for genomic DNA contamination, the total RNA was resolved on 1% agarose gels containing ethidium bromide (EtBr) and then visualized using a UV transilluminator (Wealtec Corp., Sparks, NV, USA). As an additional measure for assessing the quality of the isolated total RNA, the integrity of the 18S ribosomal RNA (rRNA) and two fragments separated by an endogenous break of

30 -RACE Real-time PCR amplification

Real-time PCR amplification

28S rRNA were determined on 1% formaldehyde/agarose gels. Single-stranded cDNA was synthesized from the total RNA using oligo (dT)20 primers for reverse transcription (SuperScript™ III RT kit, Invitrogen, Carlsbad, CA, USA). 2.6. Real-time RT-PCR To investigate the specific expression patterns of SOD genes, real-time RT-PCR was performed. Each reaction included 1 ll of cDNA (synthesized with 2 lg of the total RNA) and 0.2 lM of each primer (real-time RT-F/R and 18S rRNA RT-F/R), which are shown in Table 1. Primers were designed by comparing exon/intron boundaries to the genomic DNA sequence using GENRUNNER software (Hastings Software, Inc., NY, USA), and then confirmed using Primer 3 (Whitehead Institute for Biomedical Research, Cambridge, MA, USA). Optimized conditions were used according to the following CFX96™ real-time PCR system protocol (Bio-Rad, Hercules, CA, USA): one cycle of 95 °C/3 min, followed by 40 cycles of 95 °C/ 30 s, 55 °C/30 s, and 72 °C/30 s. To confirm the amplification of specific products, melt curve analysis was performed using the following thermocycling conditions: 95 °C/1 min, 55 °C/1 min, and 80 cycles of 55 °C/10 s, with 0.5 °C increase per cycle. SYBRÒ Green (Molecular Probes, Eugene, OR, USA) was used to detect specific amplified products. Amplification and detection of SYBRÒ Greenlabeled products was performed using a CFX96™ real-time PCR system (Bio-Rad, Hercules, CA, USA). Data from each experiment are expressed relative to the expression levels of the 18S rRNA gene in order to normalize the expression levels between samples. All experiments were performed in triplicate. Data were collected as threshold cycle (CT) values (PCR cycles at which the fluorescence was detected above a threshold and then decreased linearly with increasing input target quantity), and used to calculate the DCT values of each sample. The fold change in relative gene expression was calculated using the 2DDCt method (Livak and Schmittgen, 2001).

Table 2 Acute toxicities of environmental biocides after 24 h exposure.

Alachlor Chlorpyrifos Dimethoate Endosulfan Lindane Molinate

30 -RACE

Tested concentration (mg L1)

NOEC (mg L1)

LC50 (95% CI; mg L1)

0.05–50 0.01–20 0.1–100 0.01–20 0.05–50 0.05–50

0.3 0.5 29 0.1 1.4 3

13 3.9 70 4 14 19

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

2.7. Measurement of total SOD enzymatic activity The overall procedures for measuring the SOD enzyme activity were prepared according to our previous study (Kim et al., 2011). The enzymatic activities of the SODs were measured using a SOD assay kit (Sigma–Aldrich Chemie, Buchs, Switzerland). A minimum of three replicates were performed for each concentration with approximately 1000 rotifers in each container. After exposure to environmental biocides for 24 h, the rotifers were homogenized in ice-cold buffer (0.25 M sucrose, 0.5% Triton X-100, pH 7.5) at a ratio of 1–4 (w/v) using a Teflon homogenizer. The homogenates were centrifuged at 3000g for 30 min at 4 °C. The upper aqueous layers, containing SOD enzymes, were collected for enzymatic assays. Assays were performed according to the manufacturer’s protocol. The total SOD activities at 25 °C were measured at an absorbance of 440 nm using a spectrophotometer (Thermo™ Varioskan Flash, MA, USA). Enzymatic activities were normalized to the amount of total protein and are presented as % of control samples. Total protein concentrations were determined using the Bradford method (Bradford, 1976).

473

bp 50 -UTR, a 663-bp ORF, and a 95-bp 30 -UTR with a poly (A) tail (GenBank Accession No. KF855320) (Suppl. Fig. 2A). The Bk-MnSOD gene spans 972 bp, and is composed of 2 exons, interrupted by 1 intron with a typical splicing junction (Suppl. Fig. 2B). The genomic structure of the B. koreanus Mn-SOD gene was similar to those of the homologous Tigriopus japonicus and Drosophila melanogaster genes. However, the Caenorhabditis elegans and vertebrate Mn-SOD genes contained more exons and introns than the B. koreanus gene. The ORF of Bk-Mn-SOD encodes a polypeptide of 221 amino acids, which includes a signal peptide of 25 amino acids, a large a-hairpin domain, and a C-terminal domain (Fig. 1B). The putative molecular weight and the theoretical pI of Bk-Mn-SOD were determined to be 24.8 kDa and 8.34, respectively. A putative N-glycosylation site of Bk-Mn-SOD was found in the NXT sequence at His96, and a conserved signature sequence (DVWEHAYY) was observed from residues 181 to 188. Conserved domains for metal binding in Bk-Mn-SOD were detected in three histidine residues (His48, His96, and His185) and one aspartic acid residue (Asp181) (Fig. 1B). 3.3. Similarity of B. koreanus Cu/Zn-SOD and Mn-SOD genes

2.8. Statistical analysis Data are expressed as means + SD. Significant differences were analyzed using one-way ANOVA followed by Tukey’s test. P values < 0.05 were considered to be statistically significant. The SPSS ver. 17.0 (SPSS Inc., Chicago, IL, USA) software package was used for all statistical analysis. 3. Results 3.1. B. koreanus Cu/Zn-SOD gene The full-length B. koreanus Cu/Zn-SOD (Bk-Cu/Zn-SOD) gene was completely sequenced and deposited to GenBank (Accession No. KF855319). The complete cDNA sequence of Bk-Cu/Zn-SOD was determined to be 554 bp in length, including a 21-bp 50 -untranslated region (UTR), a 462-bp open reading frame (ORF), and a 71bp 30 -UTR with a poly (A) tail (Suppl. Fig. 1A). The Bk-Cu/Zn-SOD genomic DNA sequence is 798 bp in length, and contains 3 exons and 2 introns (Suppl. Fig. 1B). The splicing donor and acceptor sequences of the three introns conform to the 50 -GT-AG-30 rule. Comparisons of the genomic structure of B. koreanus Cu/Zn-SOD with those of the copepod, nematode, fruit fly, zebrafish, mouse, and human Cu/Zn-SODs revealed that Bk-Cu/Zn-SOD has a unique genomic structure, with a different number of introns. The conserved Arg79–Asp101 for salt bridge and the Cys57–Cys146 for disulfide bridge, which stabilize the electrostatic loop regions, were also observed (Suppl. Fig. 1A). The ORF of Bk-Cu/Zn-SOD encodes a polypeptide of 154 amino acid residues. The predicted molecular weight and theoretical pI of Bk-Cu/Zn-SOD were calculated to be 16.3 kDa and 5.44, respectively. Two conserved signature sequences of the Cu/Zn-SOD family were observed in Bk-Cu/ZnSOD (Suppl. Fig. 1A); signature 1 (GFHIHQFGDTT) was found from amino acids 44 to 54, and signature 2 (GNAGGRLACGVI) was found from amino acids 138 to 149. Conserved domain searches (CD-searches) revealed that Bk-Cu/Zn-SOD contains several evolutionarily conserved domains, such as metal-binding active sites composed of histidine residues (His46, His48, His63, His71, His80, and His120) and of aspartic acid residues (Asp83) (Fig. 1A). 3.2. B. koreanus Mn-SOD gene The complete cDNA sequence of B. koreanus Mn-SOD (Bk-MnSOD) was determined to be 921 bp in length, and includes a 163-

A BlastX search, performed using the deduced amino acid sequence of Bk-Cu/Zn-SOD, revealed that it shares high identity (87%) with the rotifer Brachionus calyciflorus Cu/Zn-SOD. Alignments with representative species from each phylum revealed that the deduced amino acid sequence of Bk-Cu/Zn-SOD shows moderate similarities to the Cu/Zn-SOD sequences of the copepod T. japonicus (46%), the nematode C. elegans (55%), the fruit fly D. melanogaster (56%), zebrafish (61%), the frog Xenopus laevis (58%), mouse (57%), and human (55%) (Fig. 1A). A BlastX search using the deduced amino acid sequence revealed that Bk-Mn-SOD was highly similar to the mitochondrial MnSODs of the rotifers Brachionus plicatilis (85%) and B. calyciflorus (82%). Alignments of the deduced amino acid sequence of Bk-MnSOD with those of the Mn-SODs of representative species from each phylum revealed that Bk-Mn-SOD was similar to the MnSODs of the copepod T. japonicus (64%), the nematode C. elegans (62%), the fruit fly D. melanogaster (53%), zebrafish (60%), African clawed frog (60%), mouse (58%), and human (61%) (Fig. 1B). A phylogenetic tree revealed that Bk-Mn-SOD was clustered with the mitochondrial Mn-SOD proteins of other invertebrates, and was closely related to the Mn-SOD of the rotifer B. calyciflorus (Fig. 2). 3.4. Effect of biocides on Bk-SOD transcripts After exposure to biocides, Bk-Cu/Zn-SOD transcript levels were highly elevated at the NOEC values of all biocides (P < 0.05) (Fig. 3A–F), whereas Bk-Mn-SOD transcript levels were relatively insensitive to alachlor, dimethoate, and lindane (Fig. 3A, C, and E). Strikingly, the transcript levels of both Bk-SODs were significantly upregulated in response to chlorpyrifos, endosulfan, and molinate at the NOEC values tested (P < 0.05) (Fig. 3B, D, and F). 3.5. Total enzymatic activities of Bk-SODs in response to biocides The total enzymatic activities of SODs were significantly reduced in response to alachlor, chlorpyrifos, and molinate at their NOEC values (P < 0.05) (Fig. 4A, B, and F). After exposure to endosulfan and lindane, total SOD activities showed slightly reduced patterns (Fig. 4D and E), while significance was not observed in dimethoate-exposed rotifers even though the tendency seemed to be decreased at the highest concentration (29 000 lg L1) (Fig. 4C).

474

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

(A) Cu/ZnSOD B. koreanus B. calyciflorus T. japonicus C. elegans D. pulex D. melanogaster D. rerio X. laevis M. musculus H. sapiens

B. koreanus B. calyciflorus T. japonicus C. elegans D. pulex D. melanogaster D. rerio X. laevis M. musculus H. sapiens

Cu2+ binding site Zn2+ binding site Cu2+ , Zn2+ binding site

B) MnSOD

Alpha-hairpin domain

)

B. koreanus B. calyciflorus T. japonicus C. elegans D. pulex D. melanogaster D. rerio X. laevis M. musculus H. sapiens

C-terminal domain B. koreanus B. calyciflorus T. japonicus C. elegans D. pulex D. melanogaster D. rerio X. laevis M. musculus H. sapiens

Mn2+ binding site Fig. 1. Alignment of amino acid sequences of B. koreanus (A) Cu/Zn-SOD and B) Mn-SOD with other species. The metal binding sites are labeled with each colored arrow. The following sequences were used in the alignments: rotifer (Brachionus calyciflorus, AGH07916), copepod (Tigriopus japonicus, AEM66981), nematode (Caenorhabditis elegans, CAA54318), fruit fly (Drosophila melanogaster, AAA28906), zebrafish (Danio rerio, CAA72925), African clawed frog (Xenopus laevis, NP_001080933), mouse (Mus musculus, AAA40121), and human (Homo sapiens, AAB05661). (B) Alignment of B. koreanus Mn-SOD with the Mn-SODs of other species. The metal binding sites are labeled with red colored arrow. The following sequences were used in the alignment: rotifer (Brachionus calyciflorus, AFO11499), copepod (Tigriopus japonicus, AEM66982), nematode (Caenorhabditis elegans, BAA12821), fruit fly (Drosophila melanogaster, AAF57955), zebrafish (Danio rerio, AAP34300), African flowed frog (Xenopus laevis, NP_001083968), mouse (Mus musculus, CAA79308), and human (Homo sapiens, CAA32502) (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

4. Discussion The deduced amino acid sequences of the Bk-SODs share several common characteristics such as conserved signature sequences, N-linked glycosylation sites, and metal-binding sites with SOD orthologs from rotifers and other invertebrates. All amino acid residues in Bk-Cu/Zn-SOD and Bk-Mn-SOD involved in the formation of tertiary structure, metal binding, and enzymatic activities were highly conserved across species, indicating that both SODs would have similar functions to other SOD enzymes. Particularly, Mn-SODs are predominantly found in the mitochondria of eukaryotes (Alscher et al., 2002). However, studies have revealed that cytosolic Mn-SODs only appear in crustaceans, which use hemocyanin for oxygen transport (Brouwer et al., 2003). Phylogenetic analysis revealed that Bk-Mn-SOD was clustered with the Mn-SOD of other rotifer B. calyciflorus within the mitochondrial Mn-SOD clade.

Six biocides [organophosphate biocides (lindane, chlorpyrifos), organochlorine biocides (dimethoate, endosulfan), chloroacetanilide biocide (alachlor), and thiocarbamate biocide (molinate)] were used in this study induce ROS and antioxidant expression, as reported in other aquatic organisms (Ishii et al., 2004; Yi et al., 2007; Woo et al., 2009; Galhano et al., 2011; Shao et al., 2012; Ali et al., 2014). ROS have been significantly modulated the mRNA expression level of SODs. Treatment with hydrogen peroxide (H2O2) caused a statistically significant change in the Cu/Zn-SOD mRNA expression level of the rotifer B. calyciflorus (Yang et al., 2013a). Similarly, iprobenfos (an organophosphorous pesticide) significantly increased the mRNA expression level of SOD via oxidative stress induction in marine medaka (Woo et al., 2009). Likewise, dichlorodihpenyltrichloro (an organochlorine pesticide) induced the production of ROS, upregulated the amount of transcript, and stimulated the enzymatic activity of SODs both in vivo and in vitro (Perez-Maldonado et al., 2004; Zhao et al., 2012). As

475

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

A. undecimdentatus

60 79

C. pagurus

84

D. personata

41

N. puber

30

X. poressa

0.05

B. thermydron

86

27

Crab

S. mesatlantica

28

C. paredator P. bidens

99

C. armatum 32

C. sapidus P. clarkii

78

M. rosenbergii

100

Crayfish Prawn

Cytosolic MnSOD

20

P. monodon 1

88

P. monodon 2

100

M. japonicus L. vannamei 3

67

L. vannamei

73 40

L. vannamei 2

B. koreanus

100

Shrimp

L. vannamei 1

88

Rotifer

B. calyciflorus 100

D. melanogaster 1

39

Insect

G. mellonella

95

B. mori 47

T. japonicus

57

Copepod

L. salmonis 68

47

C. sapidus

100

C. feriatus

Crab

S. serrata

96

M. rosengergii 99 98

Mitochondrial MnSOD

D. melanogaster 2

Prawn

M. japonicus F. chinensis

Shrimp

Fig. 2. Phylogenetic analysis of B. koreanus Mn-SOD and the Mn-SODs from other species, as retrieved from GenBank, using the Bayesian method. Numbers at branch nodes represent the confidence levels of the posterior probabilities. The scale bar represents the genetic distance. The amino acid sequences used in the phylogenetic analysis and their GenBank and Ensemble accession numbers are as follows: mitochondrial Mn-SODs: Bombyx mori NM_001043834), Brachionus calyciflorus (AFO11499), Callinectes sapidus (AF264029), Charybdis feriatus (AF019411), Drosophila melanogaster 1 (L18947), Drosophila melanogaster 2 (L34276), Fenneropenaeus chinensis (DQ205424), Galleria mellonella (EF611125), Lepeophtheirus salmonis (AJ811940), Macrobrachium rosenbergii (DQ157765), Marsupenaeus japonicus (GQ478988), Scylla serrata (FJ605170), and Tigriopus japonicus (AEM66982); cytosolic Mn-SODs: Atelecyclus undecimdentatus (FM242565), Bythograea thermydron (FM242567), Callinectes sapidus (AF264030), Cancer pagurus (FM242564), Cardisoma armatum (FM242571), Cyanagraea praedator (FM242568), Dromia personata (FM242566), Litopenaeus vannamei (DQ005531), Litopenaeus vannamei 1 (DQ298206), Litopenaeus vannamei 2 (DQ298207), Litopenaeus vannamei 3 (DQ298208), Macrobrachium rosenbergii (DQ073104), Marsupenaeus japonicus (GQ181123), Necora puber (FM242563), Penaeus monodon (AY726542), Penaeus monodon 1 (BI784454), Perisesarmabidens (FM242572), Procambarus clarkia (EU254488), Segonzacia mesatlantica (FM242569), and Xanthoporessa (FM242570).

shown in Fig. 3, six biocides induced a significant increase in the transcript level of B. koreanus Bk-SOD at the highest concentration. Thus, transcriptional induction of Bk-SOD could be mediated by ROS-triggered oxidative stress, which is produced by biocides. This modulation of transcriptional expression can potentially serve as a biomarker for oxidative stress. Bk-Mn-SOD and Bk-Cu/Zn-SOD showed different patterns of transcriptional regulation. The fold induction of Bk-Mn-SOD in treated groups compared with control groups was lower than the fold induction of Bk-Cu/Zn-SOD. These findings are consistent with several previous results. For example, in the rotifer B. calyciflorus, different transcriptional upregulation patterns of Cu/Zn-SOD and Mn-SOD were observed in response to H2O2 (0.1 mM) (Yang

et al., 2013a). However, during aging of the rotifer B. calyciflorus, the opposite transcriptional patterns were observed for Cu/ZnSOD and Mn-SOD (Yang et al., 2013b). In polychaetes, transcription of Mn-SOD was not induced as strongly as Cu/Zn-SOD in response to copper (Rhee et al., 2011). In copepods, Mn-SOD mRNA was induced to a lower extent than Cu/Zn-SOD in response to copper, zinc, silver, benzo(a)pyrene, and 4-nonylphenol (Kim et al., 2011). Similarly, in pufferfish, transcription of Mn-SOD was not induced as highly as Cu/Zn-SOD in response to copper (Kim et al., 2010). This kind of differential susceptibility for expression patterns and dose–response relationships for Cu/Zn-SOD and Mn-SOD has even been observed in mammals (Crapo et al., 1992; Bodor et al., 2006; Kim et al., 2007). Thus, these results suggest that

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

Relative mRNA expression

(A)

3.5

MnSOD CuZnSOD

3.0

*

2.5 2.0 1.5 1.0 0.5

(B)

3.5

Relative mRNA expression

476

3.0

0.0

MnSOD CuZnSOD

2.0 1.5 1.0 0.5

0.3

3

30

0

300

MnSOD CuZnSOD

5

*

*

4 3 2 1

(D)

3.0

Relative mRNA expression

Relative mRNA expression

6

2.5

0

5

50

500

MnSOD CuZnSOD

* * *

2.0 1.5 1.0 0.5 0.0

0

29

290

2,900

29,000

0

2.5

MnSOD CuZnSOD

*

2.0

0.1

1

10

100

Endosulfan exposure (µg/L)

1.5 1.0 0.5 0.0

(F)

3.5

Relative mRNA expression

Dimethoate exposure (µg/L)

Relative mRNA expression

0.5

Chlorpyrifos exposure (µg/L)

Alachlor exposure (µg/L)

(E)

*

*

2.5

0.0 0

(C)

*

3.0

MnSOD CuZnSOD

* *

2.5

*

2.0 1.5 1.0 0.5 0.0

0

1.4

14

140

1,400

Lindane exposure (µg/L)

0

3

30

300

3,000

Molinate exposure (µg/L)

Fig. 3. Effects of biocide treatment for 24 h on SOD transcription in the monogonont rotifer Brachionus koreanus. (A) Alachlor, (B) chlorpyrifos, (C) dimethoate, (D) endosulfan, (E) lindane, and (F) molinate. The mRNA expression levels of SOD are expressed relative to those of 18S rRNA, which was used as a reference housekeeping gene. Data are presented as means + SD of three replicates of copepod exposure. Asterisks (*) indicate significant differences (P < 0.05).

Bk-Mn-SOD and Bk-Cu/Zn-SOD may play different roles in the oxidative stress response, and Cu/Zn-SOD is likely the most important SOD enzyme in B. koreanus. SOD activity can be stimulated in response to biocides. For example, SOD activity was significantly stimulated in fruit flies exposed to chlorpyrifos (Gupta et al., 2010). In crucian carp, alachlor was shown to increase the enzymatic activity of SODs at the highest concentration (500 lg L1) (Yi et al., 2007). Thus, biocides presumably invoke an oxidative stress response that involves in the stimulation of SOD activity. However, in B. koreanus, overall tendency of SOD enzyme activity is a decrease in response to the highest concentrations of six biocides (Fig. 4). In Channa punctatus and zebrafish, endosulfan and dimethoate reduced SOD activity in a dose-dependent manner (Shao et al., 2012; Ali et al., 2014). Orga-

nophosphate biocides and malathion also significantly reduced Cu/ Zn-SOD and Mn-SOD activity in sea bream after a 72-h exposure (Pedrajas et al., 1995). In cyanobacteria, 2 mM molinate was also shown to significantly reduce SOD activity after a 72-h exposure (Galhano et al., 2011). Inhibitory effects of enzyme activity in response to alachlor, chlorpyrifos, and lindane have been reported in mammals and plants (Stajner et al., 2003; Zama et al., 2007; Sharma and Singh, 2012). One possible explanation for these results is that the transformation of superoxide radicals to hydrogen peroxide has been increased the amount of hydrogen peroxide radicals, which could strongly oxidize the cysteine residues in SODs, thereby decreasing their activity (Dimitrova et al., 1994). B. koreanus showed the highest sensitivity to chlorpyrifos, lindane, and dimethoate exposure when we compared toxicity values

477

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

(A)

(B)

30

30

25

c

c

bc ab

20

a

15

SOD activity (U/µg)

SOD activity (U/µg)

c

10

25

b 20

a 15

10 0

0.3

3

30

300

0

25

(D)

a

a

a

a a

20

15

10 29

290

2,900

25

500

ab b

ab

ab

a

20

15

29,000

0

(F) b

ab

ab

ab a

20

0.1

1

10

100

Endosulfan exposure (µg/L)

15

10

SOD activity (U/µg)

SOD activity (U/µg)

25

50

30

Dimethoate exposure (µg/L) 30

5

10 0

(E)

0.5

Chlorpyrifos exposure (µg/L)

SOD activity (U/µg)

30

SOD activity (U/µg)

Alachlor exposure (µg/L)

(C)

c

c

30

b

b

25

b

b

20

a

15

10 0

1.4

14

140

1,400

Lindane exposure (µg/L)

0

3

30

300

3,000

Molinate exposure (µg/L)

Fig. 4. Effects of biocide treatment for 24 h on total SOD activity in the monogonont rotifer Brachionus koreanus. (A) Alachlor, (B) chlorpyrifos, (C) dimethoate, (D) endosulfan, (E) lindane, and (F) molinate. Three replicates were performed; data are expressed as means + SD. Values significantly different from the lowest value (P < 0.05) are indicated by small letters on the bars.

with those of other rotifers B. calyciflorus and B. plicatilis (Ferrando and Andreu-Moliner, 1991; Fernandez-Casalderrey et al., 1991; Guo et al., 2012) (Table 2), suggesting that the detoxification capacities of different rotifers can be different in response to biocides. Thus, comparison of biocide-induced changes in SOD expression and activity between rotifers would be helpful for a better understanding on the mechanisms of the antioxidant response in rotifers. Overall, our results indicate that biocide-induced increases in Bk-SOD transcription but biocide-triggered decreases in SOD activity occur through ROS-dependent mechanism. Modulation of Bk-SODs is probably part of a defense response on the levels of transcription and enzymatic activity to counteract the biocides-

induced oxidative stress. The upregulated-transcriptional regulation and the downregulated-enzymatic activity can be used as potential biomarkers in B. koreanus to assess the risk of waterborne organophosphate, organochlorine, chloroacetanilide, and thiocarbamate biocide contamination of seawater. Acknowledgements We thank Prof. Hans-U. Dahms for his valuable comments on the manuscript and also thank two anonymous reviewers for their constructive comments on the previous manuscript. This work was supported by a Grant from the National Research Foundation (2012R1A1A2000970; South Korea) to Jae-Seong Lee.

478

B.-M. Kim et al. / Chemosphere 120 (2015) 470–478

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.chemosphere. 2014.08.042. References Ali, D., Kumar, P.G., Kumar, S., Ahmed, M., 2014. Evaluation of genotoxic and oxidative stress response to dimethoate in freshwater fish Channa punctatus (Bloch). Chem. Speciation Bioavailability 26, 111–118. Alscher, R.G., Erturk, N., Heath, L.S., 2002. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 53, 1331–1341. Bodor, C., Matolcsy, A., Bernath, M., 2006. Elevated expression of Cu, Zn-SOD and Mn-SOD mRNA in inflamed dental pulp tissue. Int. Endod. J. 40, 128–132. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brouwer, M., Brouwer, T.H., Grater, W., Brown-Peterson, N., 2003. Replacement of a cytosolic cooper/zinc superoxide dismutase by a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport. Biochem. J. 374, 219–228. Crapo, J.D., Oury, T., Rabouille, C., Slot, J.W., Chang, L.Y., 1992. Copper, zinc superoxide dismutase is primarily a cytocolic protein in human cells. Proc. Natl. Acad. Sci. USA 89, 10405–10409. Dahms, H.-U., Hagiwara, A., Lee, J.-S., 2011. Ecotoxicology, ecophysiology, and mechanistic studies with rotifers. Aquat. Toxicol. 101, 1–12. Dimitrova, M.S., Tishinova, V., Velcheva, V., 1994. Combined effect of zinc and lead on the hepatic superoxide dismutase catalase system in carp (Cyprinus carpio). Comp. Biochem. Physiol. C 108, 43–46. Doyotte, A., Cossu, C., Jacquin, M., Babut, M., Vasseur, P., 1997. Antioxidant enzymes, glutathione and lipid peroxidation as relevant biomarkers of experimental or field exposure in the gills and the digestive gland of the freshwater bivalve Unio tumidus. Aquat. Toxicol. 39, 93–110. Ferrando, M.D., Andreu-Moliner, E., 1991. Acute lethal toxicity of some pesticides to Brachionus calyciflorus and Brachionus plicatilis. Bull. Environ. Contam. Toxicol. 47, 479–484. Fernandez-Casalderrey, A., Ferrando, M.D., Gamon, M., Andreu-Moliner, E., 1991. Acute toxicity and bioaccumulation of endosulfan in rotifers (Brachionus calyciflorus). Comp. Biochem. Physiol. C 100, 61–63. Fridovich, I., 1997. Superoxide anion radical (O 2 ), superoxide dismutases, and related matters. J. Biol. Chem. 272, 18515–18517. Galhano, V., Gomes-Laranjo, J., Peixoto, F., 2011. Exposure of the cyanobacterium Nostoc muscorum from Portuguese rice fields to molinate (OrdramÒ): effects on the antioxidant system and fatty acid profile. Aquat. Toxicol. 101, 367–376. Guo, R., Ren, X., Ren, H., 2012. Assessment the toxic effects of dimethoate to rotifer using swimming behavior. Bull. Environ. Contam. Toxicol. 89, 568–571. Gupta, S.C., Mishra, M., Sharma, A., Deepak Balaji, T.G.R., Kumar, R., Mishra, R.K., Chowdhur, D.K., 2010. Chlorpyrifos induces apoptosis and DNA damage in Drosophila through generation of reactive oxygen species. Ecotoxicol. Environ. Saf. 73, 1415–1423. Hayes, J.D., McLellan, L.I., 1999. Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free Rad. Res. 31, 273–300. Hwang, D.-S., Dahms, H.-U., Park, H.G., Lee, J.-S., 2013a. A new intertidal Brachionus and intrageneric phylogenetic relationship among Brachionus as revealed by allometry and CO1–ITS1 gene analysis. Zool. Stud. 52, 13. Hwang, D.-S., Suga, K., Sakakura, Y., Park, H.G., Hagiwara, A., Rhee, J.-S., Lee, J.-S., 2013b. Complete mitochondrial genome of the monogonont rotifer, Brachionus koreanus (Rotifera, Brachionidae). Mitochondrial DNA 25, 29–30. Ishii, N., Senoo-Matsuda, N., Miyake, K., Yasuda, K., Ishii, T., Hartman, T., Furukawa, S., 2004. Coenzyme Q10 can prolong C. elegans lifespan by lowering oxidative stress. Mech. Ageing Dev. 125, 41–46. Kim, B.-M., Rhee, J.-S., Park, G.S., Lee, J., Lee, Y.-M., Lee, J.-S., 2011. Cu/Zn- and Mnsuperoxide dismutase (SOD) from the copepod Tigriopus japonicus: molecular cloning and expression in response to heavy metals and environmental pollutants. Chemosphere 84, 1467–1475. Kim, J.-H., Rhee, J.-S., Lee, J.S., Dahms, H.-U., Lee, J., Han, K.-N., Lee, J.-S., 2010. Effect of cadmium exposure on expression of antioxidant gene transcripts in the river pufferfish, Takifugu obscurus (Tetraodonitiformes). Comp. Biochem. Physiol. C 152, 473–479.

Kim, K.Y., Lee, S.Y., Cho, Y.S., Bang, I.C., Kim, K.H., Kim, D.S., 2007. Molecular characterization and mRNA expression during metal exposure and thermal stress of copper/zinc- and manganese-superoxide dismutases in disk abalone. Haliotis discus discus. Fish Shellfish Immunol. 23, 1043–1059. Kim, R.-O., Kim, B.-M., Jeong, C.-B., Nelson, D.R., Lee, J.-S., Rhee, J.-S., 2013. Expression pattern of entire cytochrome P450 genes and response of defensomes in the benzo(a)pyrene-exposed monogonont rotifer Brachionus koreanus. Environ. Sci. Technol. 47, 13804–13812. Konstantinou, I.K., Hela, D.G., Albanis, T.A., 2006. The status of pesticide pollution in surface waters (rivers and lakes) of Greece. Part I. Review on occurrence and levels. Environ. Pollut. 141, 555–570. Lee, J.-S., Kim, R.-O., Rhee, J.-S., Han, J., Hwang, D.-S., Choi, B.-S., Lee, C.J., Yoon, Y.-D., Lim, J.-S., Lee, Y.-M., Park, G.S., Hagiwara, A., Choi, I.-Y., 2011. Sequence analysis of genomic DNA (680 Mb) by GS-FLX-Titanium sequencer in the monogonont rotifer, Brachionus ibericus. Hydrobiologia 662, 65–75. Leung, K.M.Y., Wheeler, J.R., Morritt, D., Crane, M., 2001. Endocrine disruption in fishes and invertebrates: issues for saltwater issues for saltwater ecological risk assessment. In: Roberts, M.H., Newman, M.C., Hale, R.C. (Eds.), Coastal and Estuarine Risk Assessment. CRC Press, Boca Raton, FL, USA, pp. 190–208. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Pedrajas, J.R., Peinado, J., Lopez-Barea, J., 1995. Oxidative stress in fish exposed to model xenobiotics. Oxidatively modified forms of Cu, Zn-superoxide dismutase as potential biomarkers. Chem. – Biol. Interact. 98, 267–282. Perez-Maldonado, I.N., Fernando, D.B., Fuente, H., Gonzalez-Amaro, R., Calderon, J., Yanez, L., 2004. DDT induces apoptosis in human mononuclear cells in vitro and is associated with increased apoptosis in exposed children. Environ. Res. 94, 38– 46. Radosavljevic, T., Mladenovic, D., Jakovljevic, V., Vucevic, D., Rasic-Markovic, A., Hrncic, D., Djuric, D., Stanojlovic, O., 2009. Oxidative stress in liver and red blood cells in acute lindane toxicity in rats. Hum. Exp. Toxicol., 1–11. Rhee, J.-S., Won, E.-J., Kim, R.-O., Lee, J., Shin, K.-H., Lee, J.-S., 2011. Expression of superoxide dismutase (SOD) genes from the copper-exposed polychaete, Neanthes succinea. Mar. Pollut. Bull. 63, 277–286. Shao, B., Zhu, L., Dong, M., Wang, J., Wang, J., Xie, H., Zhang, Q., Du, Z., Zhu, S., 2012. DNA damage and oxidative stress induced by endosulfan exposure in zebrafish (Danio rerio). Ecotoxicology 21, 1533–1540. Sharma, P., Singh, R., 2012. Dichlorvos and lindane induced oxidative stress in rat brain: protective effects of ginger. Pharmacol. Res. 4, 27–32. Snell, T.W., Janssen, C., 1995. Rotifers in ecotoxicology: a review. Hydrobiologia 313 (314), 231–247. Stajner, D., Popovic, M., Stajner, M., 2003. Gerbicide induced oxidative stress in lettuce, beans, pea seeds and leaves. Biol. Plant. 47, 575–579. Stegeman, J.J., Brouwer, M., Richard, T.D.G., Forlin, L., Fowler, B.A., Sanders, B.M., van Veld, P.A., 1992. Molecular responses to environmental contamination: enzyme and protein systems as indicators of chemical exposure and effect. In: Huggett, R.J., Kimerly, R.A., Mehrle, P.M., Bergman, H.L., Jr. (Eds.), Biomarkers: Biochemical, Physiological and Histological Markers of Anthropogenic Stress. Lewis Publishers, Chelsea, MI, USA, pp. 235–335. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64, 178–189. Wauchope, R.D., 1978. The pesticide content of surface water draining from agricultural fields: a review. J. Environ. Qual. 7, 459–472. Woo, S., Yum, S., Kim, D.W., Park, H.S., 2009. Transcripts level responses in a marine medaka (Oryzias javanicus) exposed to organophosphorus pesticide. Comp. Biochem. Physiol. C 149, 427–432. Yang, J., Dong, S., Jiang, Q., Si, Q., Liu, X., Yang, J., 2013a. Characterization and expression of cytoplasmic copper/zinc superoxide dismutase (Cu/Zn SOD) gene under temperature and hydrogen peroxide (H2O2) in rotifer Brachionus calyciflorus. Gene 518, 388–396. Yang, J., Dong, S., Jiang, Q., Kuang, T., Huang, W., Yang, J., 2013b. Changes in expression of manganese superoxide dismutase, copper and zinc superoxide dismutase and catalase in Brachionus calyciflorus during the aging process. PloS One 8, e57186. Yi, X., Ding, H., Lu, Y., Liu, H., Zhang, M., Jiang, W., 2007. Effects of long-term alachlor exposure on hepatic antioxidant defence and detoxifying enzyme activities in crucian carp. Chemosphere 68, 1576–1581. Zama, D., Meraihi, Z., Tebibel, S., Benayssa, W., Benayache, F., Benayache, B., Vlietinck, A.J., 2007. Chlorpyrifos-induced oxidative stress and tissue damage in the liver, kidney, brain and fetus in pregnant rats: the protective role of the butanolic extract of Paronychia argenteaL. Indian J. Pharmacol. 39, 145–150. Zhao, M., Wang, C., Zhang, C., Wen, Y., Liu, W., 2012. Enantioselective cytotoxicity profile of o, p0 -DDT in PC12 cells. PLoS One 7, e43823.