CypD deficiency confers neuroprotection against mitochondrial abnormality caused by lead in SH-SY5Y cell

Journal Pre-proof CypD deficiency confers neuroprotection against mitochondrial abnormality caused by lead in SH-SY5Y cell Fang Ye, Xiaoyi Li, Yawen Liu, Anli Jiang, Xintong Li, Luoyao Yang, Wei Chang, Jing Yuan, Jun Chen

PII:

S0378-4274(19)30419-9

DOI:

https://doi.org/10.1016/j.toxlet.2019.12.025

Reference:

TOXLET 10664

To appear in:

Toxicology Letters

Received Date:

18 June 2019

Revised Date:

28 November 2019

Accepted Date:

18 December 2019

Please cite this article as: Ye F, Li X, Liu Y, Jiang A, Li X, Yang L, Chang W, Yuan J, Chen J, CypD deficiency confers neuroprotection against mitochondrial abnormality caused by lead in SH-SY5Y cell, Toxicology Letters (2019), doi: https://doi.org/10.1016/j.toxlet.2019.12.025

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

CypD deficiency confers neuroprotection against mitochondrial abnormality caused by lead in SH-SY5Y cell Fang Yea,b*, Xiaoyi Li c, Yawen Liua,b, Anli Jianga,b, Xintong Lia,b, Luoyao Yang a,b, Wei Changd, Jing Yuana,b, Jun Chena,b*

a

Department of Occupational and Environmental Health, School of Public Health, Tongji Medical

College, Huazhong University of Science and Technology, Wuhan, PR China. b

Ministry of Education Key Lab for Environment and Health, School of Public Health, Tongji

c Center

ro of

Medical College, Huazhong University of Science and Technology, Wuhan, PR China. for Translational Medicine, Wuhan Union Hospital, Huazhong University of Science and

Technology, Wuhan, PR China. d

Department of Public Health, Medical College, Wuhan University of Science and Technology,

authors

Email: Jun Chen: [email protected]

Jo

ur

na

Graphical abstract

lP

Fang Ye: [email protected]

re

* Corresponding

-p

Wuhan, PR China.

Highlights 

CypD deficiency inhibits Pb-induced MPTP opening



CypD deficiency alleviates mitochondria damage and fragmentation caused by Pb



Pb-induced energy supply impairment is magnified by CypD deficiency



CypD deficiency reduces Pb-induced ROS accumulation and apoptosis

ro of

1. Introduction Lead (Pb), a ubiquitous environmental and industrial pollutant that can be detected in almost all phases of environmental and biological systems, causes air, water, and

-p

soil contamination worldwide (Patrick 2006). Pb-induced neurotoxicity is mainly due to the perturbation of mitochondrial function ,which is vital in energy metabolism,

re

oxidative phosphorylation, oxidative stress, cell death, and determination of cell fate

lP

during external noxious stimuli exposure (Bernardi et al. 2015). Mitochondrial dysfunction and adverse effects, such as oxidative stress and cell death, have been

na

extensively observed in different cell lines, organs and species exposed to Pb (Hassan et al. 2019; Zhang et al. 2019).

ur

Mitochondrial permeability transition pore (MPTP), a large and nonspecific pore

Jo

which is permeable to molecules smaller than 1.5 kD, opens in the inner mitochondrial membrane. MPTP acts as a high conductance channel across the mitochondrial membrane, whose open-close transition is required to maintain normal mitochondrial functions, such as adenosine triphosphate (ATP) production and maintenance of an electrochemical gradient for respiration (Giorgio et al. 2010). When cells undergo stress, such as reactive oxygen species (ROS) and Ca2+ overload,

MPTP will open, allowing small solutes (<1.5 kD), as well as water, to transport in mitochondrial matrix. Consequently, it leads to mitochondrial membrane potential (MMP) collapse, mitochondrial swelling, outer mitochondrial membrane (OMM) rupture, and release of apoptosis-related factors into the cytosol, such as apoptosis-inducing factor (AIF), cytochrome c and endonuclease G, inducing programmed cell death (Tsujimoto and Shimizu 2007; Vaseva et al. 2012). Persistent

ro of

MPTP opening under stress conditions induces metabolic disorders, redox imbalance,

and even cell death. However, the precise components of MPTP remain unclear.

Previous study indicated that MPTP might comprise F1F0-ATPase and spastic

-p

paraplegia 7, and was proposed to be regulated by voltage-dependent anion channel

re

and cyclophilin D (CypD) (Izzo et al. 2016). Among them, CypD, which locates in the mitochondrial matrix and is encoded by the nuclear gene ppif, is the key regulator of

lP

MPTP opening. Accordingly, CypD has been determined to be the crucial target in

na

MPTP open-close transition control. Additionally, mitochondria isolated from mice lacking ppif were more resistant to MPTP induction than those from wild-type mice,

ur

in which MPTP opening was detected at high Ca2+ levels and cell death rate was reduced in response to oxidative stress (Baines et al. 2005; Nakagawa et al. 2005).

Jo

Baines et al. (Baines et al. 2005) found that CypD overexpression led to mitochondrial swelling, MPTP opening, and spontaneous cardiac apoptosis. Whereas, cells

from

mice lacking cardiac CypD

exhibited low death

rate after

ischemia/reperfusion injury. In aging models, CypD expression, which was enhanced with advancing age, was associated with high oxidative stress and increasing

apoptotic DNA fragmentation (Marzetti et al. 2008). Therefore, the inhibition of MPTP opening by targeting CypD is a promising strategy in treating and preventing neurological disorders. In our previous study, PbAc treatment upregulates CypD via post-translational modification; cyclosporin A (CSA), a special inhibitor of CypD, can alleviate cell death caused by PbAc in SH-SY5Y and PC12 cells (Ye et al. 2016). However, CSA

ro of

could also inhibit inflammation and cell death via Ca-activated phosphatase calcineurin repression, so it’s hard to draw a solid conclusion that CSA protects

against Pb neurotoxicity by inhibiting MPTP opening (Cereghetti et al. 2008). Thus,

-p

CypD should be specifically targeted via gene modification, such as CypD

re

knockdown or knockout, to clarify the role CypD played in Pb-induced neurotoxicity. Thus, in the present study, the ppif−/− SH-SY5Y cell line was generated by

lP

CRISPR/Cas9 technology to investigate the role of CypD in mitochondrial

na

abnormalities caused by Pb.

ur

2. Materials and methods 2.1 Cell culture

Jo

Human neuroblastoma SH-SY5Y cells obtained from the American Type Culture Collection (CA, USA) were cultured in DMEM/F12 medium supplemented with 10% FBS, 1% unessential amino acids, 100 U/mL penicillin, and 100 U/mL streptomycin at 37 °C in a humidified 5% CO2 atmosphere. SH-SY5Y cells with 29˗36 passages were used in current study, which were 24 passages when we received.

2.2 Materials and PbAc preparation Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) (HY-100410) was purchased from MedChemExpress, 0.3793g PbAc·3H2O (Sigma, CA, USA) powder was dissolved in 100mL boiled deionized water and few drops of acetic acid were added into PbAc solution till the solution became transparent. The concentration of stocking solution was 10mM. The antibodies used in present study were listed in

ro of

Table S1. 2.3 Stable cell line generation

The ppif knockout stable cell lines were established using the CRISPR/Cas9 method

-p

of gene editing. We constructed the pSpCas9(BB)-2A-Puro (PX459) v2.0 plasmid

re

with guide RNAs (gRNAs) targeting ppif exon basing on the study of Zhang Feng (Ran et al. 2013). Genomic DNA of SH-SY5Y cells were extracted using a mini DNA

for

sequencing

(f:

CGCGACGTCAGTTTGAGTTC,

r:

na

sent

lP

extraction kit (Tiangen, Beijing, China). Exon 1 was amplified using PCR and was

TGAGCTTTCTCCTCCACACG; 490bp). After sequence verification, guide RNAs

ur

were designed using the webtool. Guide RNAs were selected based on their scores and number of mismatches with a threshold score of 100 and zero mismatches. Guide

Jo

RNA sequences were synthesized commercially (Qingke, Wuhan, China). Guide RNAs targeting ppif exon 1 were ligated into the pSpCas9(BB)-2A-Puro (PX459) v2.0 plasmid. Plasmid was amplified as usual through transformation into competent DH5α cells (Beyotime, Biotechnology Co., China). To validate the insertion of guide RNAs into vector, we sequenced the purified plasmids by using the U6-forward

primer. Plasmids were transfected into SH-SY5Y cells by using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, CA, USA), followed by manufacturer’s protocols. Transfected cells were treated with DMEM/F12 supplemented with 1 μg/ml puromycin (Sigma, USA), and the media were changed every two days; then, the monoclonal cells were selected with limited dilution method. Finally, immunoblotting and exon sequencing were applied to identify successful ppif

ro of

knockout SH-SY5Y cells. 2.4 MPTP opening detection

MPTP opening was assessed by the Calcein-AM/cobalt method. After the indicated

-p

treatment, the cells were washed with phosphate-buffered saline (PBS) and loaded

re

with 1 mM Calcein-AM (Life Technology, CA, USA) for 20 min at 37 °C in the serum-free medium, followed by additional incubation with 1 mM CoCl2 for 1 h.

lP

After the quench process, the cells were washed using a serum-free medium and were

na

collected in PBS. Finally, the images were acquired from a fluorescence microscope (Olympus, Japan) and the mean fluorescence intensity was analyzed using Image J

ur

(NIH, USA).

2.5 ROS and MMP detection

Jo

Flow cytometry was used to analyze intracellular and mitochondrial ROS and MMP by means of fluorescence probe. The medium was replaced with fresh serum-free medium containing 10 μM of 2′,7′-dichlorodihydrofluorescein diacetate (DCFH) (Beyotime Biotechnology Co., China), 5 μM of Mito Sox (Life Technology, Carlsbad, CA, USA), or 2.5 μg/ml of JC-1 (Sigma, CA, USA). The cells were incubated for 20

min at 37 °C in the dark and washed thrice with serum-free medium. Finally, the images were acquired from a fluorescence microscope (Olympus, Japan) and the mean fluorescence intensity was analyzed using Image J (NIH, USA). For JC-1 stain, the ratio red/green fluorescence intensity was calculated for statistics, as fluorescence emission shift from green (~525 nm) to red (~590 nm) when mitochondrial depolarized.

ro of

2.6 Transmission electron microscopy (TEM)

After treatment, 1×107 wild-type or ppif−/− cells were fixed in 2.0% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) for 1 h at room temperature and were

-p

scraped using cell scraper. Ultrathin osmium-stained SH-SY5Y cell sections were

re

prepared. Imaging was performed with a Tecnai G2 20 TWIN (FEI, USA) electron

2.7 Glucose import assay treatment,

the

cells

na

After

lP

microscope.

2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)

were

incubated

with

Amino)-2-Deoxyglucose

20

μM

(2-NBDG;

ur

Invitrogen, USA) in PBS media for 1 h at 37 °C. After washed once, the cells were analyzed by flow cytometry (Yamada et al. 2007).

Jo

2.8 Western blot

Whole cell proteins were extracted with an ice-cold RIPA buffer (Beyotime Biotechnology Co., China) containing protease inhibitor cocktail (Roche, Germany). Nuclear and mitochondrial proteins were isolated by using nuclear and cytoplasmic protein extraction kit (Beyotime Biotechnology Co., China) and cell mitochondria

isolation kit (Beyotime Biotechnology Co., China) respectively following manufactory instructions. Protein concentrations were determined via BCA protein assay kit (Pierce, Rockford, IL, USA) as described by the manufacturer. We applied Western blot to detect the indicated protein shown in Table 1. The density of the immunoreactive band was analyzed by Gel-pro (Media Cybernetics, USA). 2.9 ATP, Na+-K+-ATPase, MDA, GSH, and SOD assay

ro of

Cells were seeded in plates and left overnight. After the indicated treatment,

sonication was carried out. The cellular levels of ATP, reduced GSH and MDA and the activities of total SOD and Na+-K+-ATPase were detected by ATP assay kit (S0026,

-p

Beyotime Biotechnology Co., China), reduced GSH assay kit (Colorimetric method)

re

(A006-2-1, Jiancheng, Nanjing, China), Cell MDA assay kit (Colorimetric method) (A003-4-1, Jiancheng, Nanjing, China), SOD Assay Kit - WST (S311, Dojindo, Japan)

lP

Na+-K+-ATPase assay kit for cells (A070-2-2, Jiancheng, Nanjing, China) respectively

na

following the protocols. The absorbance or luminescence was measured on an automated microplate reader (Synergy 2, Bio-Tec, CA, USA). All samples were

ur

normalized to protein concentration. 2.10 Real-time PCR

Jo

We extracted RNA from SH-SY5Y cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The quality and quantity of RNA were measured by NanoDrop 1000 (Thermo Scientific, USA). Approximately 2 μg extracted total RNA was used for cDNA synthesis with Omniscript RT Kit (Thermo Scientific, USA). RT-PCR was performed in 10 μL containing 100 nM primers (Table

1) purchased from Invitrogen (CA, USA) and SYBR green PCR master mix (Life Technology, CA, USA). Amplification was conducted in a sequence detection system (ABI 7900HT, Life Technology). 2.11 Cell viability, lactate dehydrogenase (LDH) leakage and Caspase 3/7 activity assay The cell viability of SH‐SY5Y cells were assessed by the Cell Counter Kit‐8 assay

ro of

(Dojindo Laboratories, Japan) according to the following manufacturer’s instructions.

The cells were seeded in a 96-well plate and were left to attach overnight. After the

indicated treatments, 10 μM Cell Counter Kit-8 solution dissolved using serum-free

-p

medium was added to each well. The cells were incubated for 1 h in an incubator. And

re

absorbance at 450 nm was quantified on an automated microplate reader. LDH leakage assay (Beyotime Biotechnology, China) was performed with a

lP

microplate reader according to the manufacturer’s instructions. After the treatment

na

with PbAc, the 96-well plate was centrifuged at 200 rpm for 5 min. Subsequently, 100 μL of the cell supernatant was transferred to a fresh plate. After added 100 μL of the

ur

reaction solution, the cells were incubated for 30 min at 37 °C before the absorbance at 490 nm was read.

Jo

Caspase 3/7 activity was measured with commercial kits (AAT Bioquest, Sunnyvale, CA, USA). Wild type and ppif-/- SH‐SY5Y cells planted in the 96‐well plate received PbAc treatments, and then reacted with DEVD‐AMC substrate in the reaction buffer. The cells were incubated at room temperature for 1 hour in the dark. The cell plate was centrifuged at 68 g for 2 minutes and then monitored by an automated microplate

reader at excitation/emission = 350/450 nm. The results were normalized to the numbers of cells present to obtain the average caspase 3/7 activity. 2.12 Apoptosis assay Pb-induced apoptosis was determined by flow cytometry with Annexin V-FITC apoptosis detection kit (BioVision, CA, USA) as described by the manufacturer. Briefly, SH-SY5Y cells were seeded into six-well plates. At the end of the treatment,

ro of

the cells were collected by centrifugation at 1000 rpm for 5 min and were washed twice with ice-cold PBS. The cells were resuspended in 500 μL of binding buffer and

were stained with 5 μL of Annexin V-FITC solution and 5 μL of propidine iodide

-p

solution for 15 min at room temperature in the dark. Then, the samples were analyzed

re

by flow cytometry (LSRII, Becton Dickinson, San Jose, CA, USA). A total of 10,000 cells were analyzed for each sample. The percentage distributions of early (FITC +PI−)

na

2.13 Immunofluorescence

lP

and late apoptosis (FITC+PI+) were calculated for comparison.

Cells were plated on glass cover slips into 24-well plates for 1 day or on glass bottom

ur

cell culture dishes (CAT: 801002, NEST, China) for confocal microscopy. After treatment, cells were fixed for 30 min in 4% paraformaldehyde, permeabilized with

Jo

10% triton, and were blocked with goat serum for 30 min. Then, the cells were incubated overnight with AIF antibody (1:50) or TOM20 (1:50) at 4 °C. Cover slips and dishes were washed with PBS (5 min, three times) and were incubated in anti-rabbit Alexa Fluor 488 (1: 200, Molecular Probes, Netherlands) for 1 h at room temperature. Finally, the cover slips were stained with DAPI (Roche, Germany) for 5

min. The images were acquired from a fluorescence microscope (Olympus, Japen) or confocal microscope (A1, Nikon, Japen). 2.14 Static analysis All experiments were repeated at least three times. Data were presented as mean ± SE. The results were analyzed by one-way ANOVA with posthoc Dunnett’s test or LSD’s

ro of

test. P<0.05 was considered significant.

3. Results

3.1 CypD deficiency resulted in inhibition of Pb-induced MPTP opening

-p

Pb treatment increased the protein level of CypD in a post-translational modification

re

dependent manner in SH-SY5Y and PC12 cells (Ye et al. 2016). In this study, the ppif−/− SH-SY5Y cell line was successfully generated using CRISPR/Cas9 technology.

lP

Western blot results showed that CypD protein cannot be detected in ppif−/− cells (Fig.

na

1A). And the base deletion in Exon1 were detected by sequencing additionally (Fig. S1A). CypD knockout did not change the morphology of SH-SY5Y cells according to

ur

examination by optical microscope (Fig. 1B) and TEM (Fig. S1B) but did enhance cell proliferation. After 72 h of incubation, the cell numbers of the ppif−/− cells were

Jo

30% higher than those of wild-type cells (Fig. S1C). CypD is an important regulator of MPTP. Thereby, with the knockout of CypD, MPTP opening inhibition were successfully induced by PbAc treatment. As demonstrated in Figs. 1C–E, 25 μM PbAc treatment induced MPTP opening by decreasing fluorescence intensity to only 20% of control in wild-type SH-SY5Y cells, while PbAc hardly induced MPTP

opening in ppif−/− cells. The MMP level, which is closely related to MPTP opening, was much higher in ppif−/− cells than in wild-type cells when exposed to PbAc.

3.2 CypD deficiency inhibited Pb-induced mitochondria damage and mass loss The PbAc-induced impairment of mitochondrial morphological structure in SH-SY5Y cells was examined using TEM in wild-type and ppif−/− cells. As shown in Fig. 2A, a

ro of

large number of mitochondria in wild-type cells swelled and ruptured after PbAc

exposure. Meanwhile, most of the mitochondria in the ppif−/− cells survived, only few of which was damaged. Results from mitochondrial DNA content showed that

-p

mitochondrial DNA content in wild type cells decreased 20% after 24 h treatment,

re

indicating that PbAc treatment resulted in mitochondria loss. Meanwhile, PbAc did not induce the reduction of mitochondrial DNA content in ppif−/− cells (Fig. 2B).

lP

Mitochondria fusion/fission and autophagy are closely related to mitochondria loss

na

(Zorov et al. 2019). Intriguingly, Mitochondria fission in SH-SY5Y cells were notably induced by PbAc after 24 h treatment, but CypD knockout can eliminate such adverse

ur

effect (Fig. 2C). The p-Drp1/Drp1 ratio increased after PbAc treatment in a dose-dependent manner in wild-type cells (Fig. 2D), but not in ppif-/- cells (Fig. 2E),

Jo

supporting the role of CypD in mitochondria fission inhibition. 3.3 CypD deficiency attenuated energy metabolism disturbance caused by Pb Mitochondria is the main organelle producing ATP. The impairment of mitochondria would result in energy metabolism disturbance. In wild-type SH-SY5Y cells, PbAc caused 40% reduction of cellular ATP after 24 h treatment. However, CypD knockout

significantly attenuated the adverse effects, maintaining the cellular ATP supply (Fig. 3A). Sufficient ATP supply in cells is required in normal physiological processes. The activity of Na+-K+-ATPase, one of the main enzymes participating in maintenance of neuronal membrane potential, was weakened after PbAc treatment, while CypD knockout can alleviate this impairment given that the ATP supply was sufficient (Fig. 3B). Additionally, cellular energy metabolism can also be regulated by glycose import.

ro of

Results from 2-NBDG monitoring glucose uptake in cells showed that ppif−/− cells exhibited strong glucose import ability to satisfy high glucose demand by producing

additional ATP (Figs. 3A and D–E). After PbAc treatment, glucose import ability was

-p

partially impaired in wild-type SH-SY5Y cells, but was not affected in ppif−/− cells.

re

Glut3, which is highly expressed in neurons, together with Glut1 were analyzed by Western blot and PCR, which showed that PbAc reduced the mRNA and protein

lP

levels of Glut1 and Glut3 in a dose-dependent manner (Fig. S2A–B). However, PbAc

na

exerted no influence on the expressions of Gluts in ppif−/− cells, in which levels of Glut1 and Glut3 proteins were higher than those in wild-type cells (Fig. 3C) (Yamada

ur

et al. 2007). However, AMPK, the energy sensor which can be activated by AMP, was inhibited instead of activated by Pb, even though PbAc treatment caused ATP

Jo

reduction in cells. ppif−/− cells exhibited persistent AMPK activation whether treated with PbAc or not (Fig. 3F). These results suggested that Pb caused energy metabolism disturbance, which can be alleviated by CypD knockout.

3.4 CypD deficiency attenuated Pb-induced oxidative stress

Mitochondria are the main place producing ROS in cell. The mitochondrial and cellular ROS levels increased by approximately three- or six-folds respectively after Pb treatment (Figs. 4A–B). The MDA level, which is the indicator of cellular lipid peroxidation, also increased in wild-type cells after PbAc treatment, and CypD knockout could partially alleviate the MDA increase (Fig. 4C). The ROS levels and MDA content were significantly lower than those in Pb-treated wild-type SH-SY5Y

ro of

cells. In contrast to oxidative index, antioxidative index, such as reduced GSH content and total SOD activity, was downregulated by PbAc, which was inhibited by CypD

knockout (Fig. 4D–E). Thus, our results suggested that CypD deficiency partially

re

-p

attenuated Pb-induced oxidative stress.

3.5 CypD deficiency reduced cell apoptosis caused by Pb

lP

MPTP persistent opening would result in releasing of mitochondrial pro-apoptosis

na

proteins, such as Cyto C and AIF. Under the stimulation of PbAc, the protein levels of cytoplasmic Cyto C (Fig. 5A) and nuclear AIF (Fig. 5B and Fig. S3A) significantly

ur

increased in wild type SH-SY5Y cells. Cyto C in the cytoplasm activated caspases, thereby inducing caspase-dependent apoptosis (Fig. 5C). Meanwhile, AIF in the

Jo

nucleus caused DNA damage, the p-H2AX level in nucleus, acting as the marker of DNA damage, increased in a dose-dependent manner in SH-SY5Y cells (Fig. S3B). Given that MPT played a key role in the process, the inhibition of MPTP by CypD deficiency could obviously restrain the release of Cyto C and AIF from mitochondria, resulting in decrease of the Caspase 3/7 activity and p-H2AX level in nucleus (Fig.

5A-C and Fig. S3C). Further investigation showed that the cell viability of wild-type SH-SY5Y cells declined in a dose-dependent manner, with only 55% cell surviving at 25 μM concentration. Whereas the cell viability of the ppif−/− cells at this concentration was 85%, which was significantly higher than that of wild-type cells (Fig. 5D). PbAc treatment also caused much more severe LDH leakage (Fig. S3D) and cell apoptosis detected by flow cytometry (Fig. 5E-F) in wild-type cells than in

ro of

ppif−/− cells. Taken together, CypD deficiency could reduce cell apoptosis caused by Pb.

-p

4. Discussion

re

In the present study, ppif−/− cell line was generated to investigate the role of CypD in Pb neurotoxicity. CypD knockout can inhibit Pb-caused MPTP opening, and

lP

mitigate Pb-induced mitochondria damage and fragmentation. The results of energy

na

metabolism indicated that ppif−/− cell had high energy supply and resisted against Pb-induced ATP reduction and glycose import inhibition. Pb-caused oxidative stress,

ur

DNA damage, and even cell apoptosis can also be alleviated by CypD deficiency, thereby resulting in cell survival.

Jo

MPT are early reactions in cells when cells suffer from mitochondrial toxic

substance. We found PbAc significantly induced MPTP opening and MMP collapse, but CypD knockout could largely inhibit these effects. CypD is the main regulator during MPTP opening, based on its association with mitochondrial inner membrane and conformational changes in the ANT (Mazzeo et al. 2009). Pb2+ can mimic Ca2+

binding to the site of divalent metal (Me2+) on the matrix side of the MPTP, hence further induce its opening (Mazzeo et al. 2009; Toman and Fiskum 2011). Pb exposure also increases CypD protein level in a post-transcriptional manner to promote MPTP opening (Ye et al. 2016). Persistent activation of MPTP is associated with the impairment of mitochondrial morphology and function, affecting the processes of mitochondrial fission/fusion, autophagy, energy metabolism and cell

ro of

death (Santos et al. 2010; Vasquez-Trincado et al. 2016; Webster 2012; Zhang et al.

2008). Pb impaired the mitochondrial morphological structure and initiated mitochondrial fragmentation. Mitochondrial morphological structure damage causes

-p

mitochondria loss function, resulting in Oxidative phosphorylation disorder and

re

oxidative stress. In addition, release of mitochondria content into cytoplasm might initiate mitochondria associated apoptosis (Sprenger and Langer 2019). Zhang et al.

lP

(Zhang et al. 2012) reported that the expression of Grp78, ATF4 and Caspase-3 were

na

dramatically induced by Pb-caused mitochondria structure damage. These Pb-induced mitochondrial structure damage can be eliminated by CypD knockout, which is

ur

consistent with the results from previous study that mitochondria isolated from synaptosomes in ppif−/− mice are more resistant to ROS and Ca2+ overload (Naga et al.

Jo

2007). Mitochondrial fission/fusion is also important for mitochondria function and elaborately regulated by fission proteins (Drp1, Fission 1) and fusion proteins (MFN, OPA1) to keep dynamic balance (Kraus and Ryan 2017). Pb-induced mitochondria fragmentation might be due to the high level of activated form of Drp1 (p-Drp1), promoting the scission of the mitochondrion by binding to receptors, such as Fission 1

and mitochondrial fission factor (Kraus and Ryan 2017). CypD knockout could attenuate Pb-induced mitochondria fragmentation by inhibiting MMP collapse, since loss of MMP by carbonyl cyanide m-chlorophenylhydrazone (CCCP) treatment increased the recruitment of Drp1 to mitochondria, resulting in fragmentation (Park et al. 2018). The low membrane potential and mitochondria fragmentation can result in ATP

ro of

depletion (Kim et al. 2007; Twig et al. 2008). In the present study, PbAc caused ATP reduction and affected physiological functions which required high energy supply in

neuron, such as Na+-K+-ATPase activity. These results were consistent with those of

-p

other studies, stating Pb exposure causes Na+-K+-ATPase and Ca+2-ATPase activity

re

inhibition and enhances lipid peroxidation (Yucebilgic et al. 2003). CypD knockout increased ATP supply, thereby inhibited Pb-induced reduction of Na+-K+-ATPase

lP

activity. Besides the mitochondria issue, Pb decreased glucose import ability by

na

downregulating Glut1 and Glut3 resulting in ATP depletion. Gluts are the superfamily of membrane glucose and/or fructose transporters in various tissues and cell types

ur

(Mueckler and Thorens 2013). In the present study, the upregulation of Glut1 in ppif−/− cells led to additional glucose import, which met the energy demand of cell

Jo

proliferation (Fig. 1B) and reversed the decrease in ATP content induced by Pb. ATP reduction would cause cellular reaction, including the activation of several important energy sensors, such as AMPK signaling pathways (Jeon 2016). ATP depletion induced by Pb, however, was accompanied with AMPK/Raptor signaling pathway inhibition instead of activation. Similar results are also observed in the brains of

Pb-exposed rats and primary rat proximal tubular cells (Song et al. 2017; Zhang et al. 2017). Pb may induce AMPK inhibition by competing with Ca2+ binding to CaMMK, thereby resulting in decreased AMPK phosphorylation by CaMMK. AMPK is known to stimulate energy production, by increasing Gluts activity, boosting ATP production via PGC1α activation, and switching off biosynthetic pathways, such as protein synthesis (Herzig and Shaw 2018). Therefore, AMPK inhibition might make a

ro of

contribution to Pb-induced energy shortage. CypD knockout can activate AMPK in SH-SY5Y cells to reverse ATP depletion and Gluts downregulation caused by Pb

treatment. This activation can also be proofed in the liver and kidney of ppif−/− mice

-p

with high metabolic level. Accordingly, we speculated that AMPK activation may

re

mediate several beneficial effects of CypD deficiency by regulating energy metabolism, such as quick wound-healing process requiring high energy supply

lP

(Klawitter et al. 2017; Tavecchio et al. 2015). However, some studies reported that

na

ppif−/− cell possessed high ATP level by reacting to mitochondrial Ca2+ accumulation. The potential mechanism may lie in the reduction of cell energy demand and

ur

redistribution of metabolic pathways, such as the suppression of fatty acid β-oxidation (Gutierrez-Aguilar and Baines 2015), instead of mitochondrial respiration stimulation

Jo

(Nadtochiy et al. 2015). Thus, the detailed mechanism is still unclear and requires further exploration. The opening of the MPTP in the physiological state plays a central role in cell metabolism. But excessive MPTP opening leads to mitochondrial stress, which is characterized by impaired mitochondrial respiratory chain function, activation of

mitochondrial swelling, and ROS generation. An increase in the ROS level can trigger a feed-forward loop involving a progressive Ca2+ surge, which further promotes ROS generation and prolongs MPTP opening (Rasola and Bernardi 2011). It is suggested that ROS accumulation and MPTP opening promote each other during PbAc treatment (Ye et al. 2016). Here, we observed CypD deficiency improved mitochondrial function and reduced ROS accumulation in SH-SY5Y cells, which was

ro of

also verified in mouse cerebral cortex (Du et al. 2008). ROS accumulation activates several downstream events, such as DNA damage, aging, and even cell death

(Martinou and Green 2001). MPTP opening mediates Cytochrome C release into

-p

cytoplasm causing caspase-dependent apoptosis and AIF translocation from the

re

mitochondria to the nucleus resulting in DNA damage. Persistent DNA damage eventually triggers cell death. While CypD knockout significantly attenuated

lP

Pb-caused DNA damage and cell death by blocking MPTP, which restricted the

na

apoptotic factors in the mitochondria and reduced ROS accumulation. It is reported that SIRT3 attenuates cognitive impairment and neuroapoptosis, protect the integrity

ur

of mitochondrial membrane from damage, and downregulate IL-6, TNF-α and caspase-3 expression by decreasing CypD (Sun et al. 2017). Thus, CypD knockout

Jo

can effectively alleviate cell apoptosis caused by Pb. However, current results were insufficient to draw the final conclusion. The protective effects were only tested in one cell line, and SH-SY5Y cells are not normal neuronal cells, though they are widely used as a model of neurons in many studies. In addition, studies in vivo should be carried out to further clarify the protection against Pb neurotoxicity.

Our results provide direct evidence that MPTP opening inhibition by targeting CypD alleviates Pb-induced mitochondria abnormality and maintains ATP supply, which reduces oxidative stress and cell apoptosis. Declaration of interests ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

may be considered as potential competing interests:

-p

Conflicts of interest statement

ro of

☐The authors declare the following financial interests/personal relationships which

lP

Author contributions

re

There are no conflicts of interest for any of the authors.

J.C., J.Y., W.C. and F.Y. conceived the project and designed experiments; F.Y., Y.L.

na

and A.J. performed most of the experiments; X.L. performed the flow cytometry experiments; X.L performed the confocal microscope. F.Y. analyzed the data and wrote the manuscript; J.C. and L.Y. assisted in data interpretation and edited the

Jo

ur

manuscript.

Acknowledgement This work was supported by the National Natural Science Foundation of China (Grant NO. 81703180 and 81273019) and the Fundamental Research Funds for the Central Universities (NO. 2019kfyXJJS031).

Reference Baines, C.P., Kaiser, R.A., Purcell, N.H., Blair, N.S., Osinska, H., Hambleton, M.A., Brunskill, E.W., Sayen, M.R., Gottlieb, R.A., Dorn, G.W., Robbins, J. and Molkentin, J.D. 2005. Loss of cyclophilin D reveals a critical role for mitochondrial permeability transition in cell death. Nature 434, 658-662. Bernardi, P., Rasola, A., Forte, M. and Lippe, G. 2015. The Mitochondrial Permeability Transition Pore: Channel Formation by F-ATP Synthase, Integration in Signal Transduction, and Role in Pathophysiology. Physiological reviews 95, 1111-1155. Cereghetti, G.M., Stangherlin, A., Martins de Brito, O., Chang, C.R., Blackstone, C., Bernardi, P. and Scorrano, L. 2008. Dephosphorylation by calcineurin regulates translocation of Drp1 to mitochondria. Proceedings of the National Academy of Sciences of the United States of America 105, 15803-15808. Du, H., Guo, L., Fang, F., Chen, D., Sosunov, A.A., McKhann, G.M., Yan, Y., Wang, C., Zhang, H., Molkentin, J.D., Gunn-Moore, F.J., Vonsattel, J.P., Arancio, O., Chen, J.X. and Yan, S.D. 2008. and memory in Alzheimer's disease. Nature medicine 14, 1097-1105.

ro of

Cyclophilin D deficiency attenuates mitochondrial and neuronal perturbation and ameliorates learning Giorgio, V., Soriano, M.E., Basso, E., Bisetto, E., Lippe, G., Forte, M.A. and Bernardi, P. 2010. Cyclophilin D in mitochondrial pathophysiology. Biochimica et biophysica acta 1797, 1113-1118.

Gutierrez-Aguilar, M. and Baines, C.P. 2015. Structural mechanisms of cyclophilin D-dependent 2041-2047.

-p

control of the mitochondrial permeability transition pore. Biochimica et biophysica acta 1850,

Hassan, E., Kahilo, K., Kamal, T., El-Neweshy, M. and Hassan, M. 2019. Protective effect of diallyl sulfide against lead-mediated oxidative damage, apoptosis and down-regulation of CYP19 gene

re

expression in rat testes. Life sciences 226, 193-201.

Herzig, S. and Shaw, R.J. 2018. AMPK: guardian of metabolism and mitochondrial homeostasis.

lP

Nature reviews. Molecular cell biology 19, 121-135.

Izzo, V., Bravo-San Pedro, J.M., Sica, V., Kroemer, G. and Galluzzi, L. 2016. Mitochondrial Permeability Transition: New Findings and Persisting Uncertainties. Trends in cell biology 26, 655-667.

na

Jeon, S.M. 2016. Regulation and function of AMPK in physiology and diseases. Experimental & molecular medicine 48, e245.

Kim, I., Rodriguez-Enriquez, S. and Lemasters, J.J. 2007. Selective degradation of mitochondria by mitophagy. Archives of biochemistry and biophysics 462, 245-253.

ur

Klawitter, J., Pennington, A., Klawitter, J., Thurman, J.M. and Christians, U. 2017. Mitochondrial cyclophilin D ablation is associated with the activation of Akt/p70S6K pathway in the mouse kidney. Scientific reports 7, 10540.

Jo

Kraus, F. and Ryan, M.T. 2017. The constriction and scission machineries involved in mitochondrial fission. Journal of cell science 130, 2953-2960. Martinou, J.C. and Green, D.R. 2001. Breaking the mitochondrial barrier. Nature reviews. Molecular cell biology 2, 63-67. Marzetti, E., Wohlgemuth, S.E., Lees, H.A., Chung, H.Y., Giovannini, S. and Leeuwenburgh, C. 2008. Age-related activation of mitochondrial caspase-independent apoptotic signaling in rat gastrocnemius muscle. Mechanisms of ageing and development 129, 542-549. Mazzeo, A.T., Beat, A., Singh, A. and Bullock, M.R. 2009. The role of mitochondrial transition pore, and its modulation, in traumatic brain injury and delayed neurodegeneration after TBI. Experimental neurology 218, 363-370.

Mueckler, M. and Thorens, B. 2013. The SLC2 (GLUT) family of membrane transporters. Molecular aspects of medicine 34, 121-138. Nadtochiy, S.M., Urciuoli, W., Zhang, J., Schafer, X., Munger, J. and Brookes, P.S. 2015. Metabolomic profiling of the heart during acute ischemic preconditioning reveals a role for SIRT1 in rapid cardioprotective metabolic adaptation. Journal of molecular and cellular cardiology 88, 64-72. Naga, K.K., Sullivan, P.G. and Geddes, J.W. 2007. High cyclophilin D content of synaptic mitochondria results in increased vulnerability to permeability transition. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 7469-7475. Nakagawa, T., Shimizu, S., Watanabe, T., Yamaguchi, O., Otsu, K., Yamagata, H., Inohara, H., Kubo, T. and Tsujimoto, Y. 2005. Cyclophilin D-dependent mitochondrial permeability transition regulates some necrotic but not apoptotic cell death. Nature 434, 652-658. Park, Y.S., Choi, S.E. and Koh, H.C. 2018. PGAM5 regulates PINK1/Parkin-mediated mitophagy via DRP1 in CCCP-induced mitochondrial dysfunction. Toxicology letters 284, 120-128.

ro of

Patrick, L. 2006. Lead toxicity part II: the role of free radical damage and the use of antioxidants in the

pathology and treatment of lead toxicity. Alternative medicine review : a journal of clinical therapeutic 11, 114-127.

Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A. and Zhang, F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature protocols 8, 2281-2308.

-p

Rasola, A. and Bernardi, P. 2011. Mitochondrial permeability transition in Ca(2+)-dependent apoptosis and necrosis. Cell calcium 50, 222-233.

Santos, R.X., Correia, S.C., Wang, X., Perry, G., Smith, M.A., Moreira, P.I. and Zhu, X. 2010. A

re

synergistic dysfunction of mitochondrial fission/fusion dynamics and mitophagy in Alzheimer's disease. Journal of Alzheimer's disease : JAD 20 Suppl 2, S401-412.

Song, X., Li, Z., Liu, F., Wang, Z. and Wang, L. 2017. Restoration of autophagy by puerarin in

lP

lead-exposed primary rat proximal tubular cells via regulating AMPK-mTOR signaling. Journal of biochemical and molecular toxicology 31.

Sprenger, H.G. and Langer, T. 2019. The Good and the Bad of Mitochondrial Breakups. Trends in cell biology 29, 888-900.

na

Sun, F., Si, Y., Bao, H., Xu, Y., Pan, X., Zeng, L. and Jing, L. 2017. Regulation of Sirtuin 3-Mediated Deacetylation of Cyclophilin D Attenuated Cognitive Dysfunction Induced by Sepsis-Associated Encephalopathy in Mice. Cellular and molecular neurobiology 37, 1457-1464.

ur

Tavecchio, M., Lisanti, S., Bennett, M.J., Languino, L.R. and Altieri, D.C. 2015. Deletion of Cyclophilin D Impairs beta-Oxidation and Promotes Glucose Metabolism. Scientific reports 5, 15981. Toman, J. and Fiskum, G. 2011. Influence of aging on membrane permeability transition in brain

Jo

mitochondria. Journal of bioenergetics and biomembranes 43, 3-10. Tsujimoto, Y. and Shimizu, S. 2007. Role of the mitochondrial membrane permeability transition in cell death. Apoptosis : an international journal on programmed cell death 12, 835-840. Twig, G., Elorza, A., Molina, A.J., Mohamed, H., Wikstrom, J.D., Walzer, G., Stiles, L., Haigh, S.E., Katz, S., Las, G., Alroy, J., Wu, M., Py, B.F., Yuan, J., Deeney, J.T., Corkey, B.E. and Shirihai, O.S. 2008. Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. The EMBO journal 27, 433-446. Vaseva, A.V., Marchenko, N.D., Ji, K., Tsirka, S.E., Holzmann, S. and Moll, U.M. 2012. p53 opens the mitochondrial permeability transition pore to trigger necrosis. Cell 149, 1536-1548. Vasquez-Trincado, C., Garcia-Carvajal, I., Pennanen, C., Parra, V., Hill, J.A., Rothermel, B.A. and

Lavandero, S. 2016. Mitochondrial dynamics, mitophagy and cardiovascular disease. The Journal of physiology 594, 509-525. Webster, K.A. 2012. Mitochondrial membrane permeabilization and cell death during myocardial infarction: roles of calcium and reactive oxygen species. Future cardiology 8, 863-884. Yamada, K., Saito, M., Matsuoka, H. and Inagaki, N. 2007. A real-time method of imaging glucose uptake in single, living mammalian cells. Nature protocols 2, 753-762. Ye, F., Li, X., Li, F., Li, J., Chang, W., Yuan, J. and Chen, J. 2016. Cyclosporin A protects against Lead neurotoxicity through inhibiting mitochondrial permeability transition pore opening in nerve cells. Neurotoxicology 57, 203-213. Yucebilgic, G., Bilgin, R., Tamer, L. and Tukel, S. 2003. Effects of lead on Na(+)-K(+) ATPase and Ca(+2) ATPase activities and lipid peroxidation in blood of workers. International journal of toxicology 22, 95-97. Zhang, H., Bosch-Marce, M., Shimoda, L.A., Tan, Y.S., Baek, J.H., Wesley, J.B., Gonzalez, F.J. and hypoxia. The Journal of biological chemistry 283, 10892-10903.

ro of

Semenza, G.L. 2008. Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to

Zhang, J., Cai, T., Zhao, F., Yao, T., Chen, Y., Liu, X., Luo, W. and Chen, J. 2012. The role of

alpha-synuclein and tau hyperphosphorylation-mediated autophagy and apoptosis in lead-induced learning and memory injury. International journal of biological sciences 8, 935-944.

-p

Zhang, L., Tu, R., Wang, Y., Hu, Y., Li, X., Cheng, X., Yin, Y., Li, W. and Huang, H. 2017. Early-Life Exposure to Lead Induces Cognitive Impairment in Elder Mice Targeting SIRT1 Phosphorylation and Oxidative Alterations. Frontiers in physiology 8, 446.

re

Zhang, Y., Feng, J., Gao, Y., Liu, X., Qu, L. and Zhu, L. 2019. Physiologically based toxicokinetic and toxicodynamic (PBTK-TD) modelling of Cd and Pb exposure in adult zebrafish Danio rerio: Accumulation and toxicity. Environmental pollution 249, 959-968.

lP

Zorov, D.B., Vorobjev, I.A., Popkov, V.A., Babenko, V.A., Zorova, L.D., Pevzner, I.B., Silachev, D.N., Zorov, S.D., Andrianova, N.V. and Plotnikov, E.Y. 2019. Lessons from the Discovery of Mitochondrial

ur

na

Fragmentation (Fission): A Review and Update. Cells 8.

Figure 1. CypD knockout resulted in block of MPTP opening. (A) CRISPR/Cas9

Jo

technology was applied to generate ppif−/− SH-SY5Y cell, western blot detecting CypD protein. (B) The morphology of wild type or ppif−/− cells under optical microscope. Scale bar = 100μm. (C-E) wild type or ppif−/− SH-SY5Y cells were treated with 25μM PbAc for 6h, then the MPTP opening assay (C-D) and detection of MMP by JC-1 method (C and E) were performed. Scale bar= 50μm, n=6. *** P<0.001 represents significant differences compared with the untreated wild type cells and ### P<0.001 represents significant differences between groups of wild type and

Jo

ur

na

lP

re

-p

ro of

ppif−/− cells exposed to PbAc.

Figure 2. CypD deficiency inhibited Pb-induced mitochondria fission. (A) Wild type or ppif−/− SH-SY5Y cells were treated with 25μM PbAc for 24h, then the transmission electron microscopy was applied to detect the change of mitochondrial morphological structure. White arrows represented the damaged mitochondria and black arrows

represented the healthy mitochondria. Scale bar = 2μm. (B) After treatment of PbAc for 24h, the mitochondria DNA content was analyzed, n=4. (C) Mitochondria were visualized by staining TOM22 under confocal microscope. 10μM FCCP, an inducer of MMP collapse, was used for 12h as a control. White arrow represented the fragmented mitochondria. Scale bar= 10μm (D) Wild type cells were exposed to various dose of PbAc (1, 5 or 25μM) for 24h, the protein level of p-Drp1 and Drp1 were analyzed. (E) p-Drp1 and Drp-1 proteins were also detected in PbAc-treated wild type or ppif-/- cells. * P<0.05 and ** P<0.01 represent significant differences

ro of

compared with the untreated wild type cells and # P<0.05 represents significant

Jo

ur

na

lP

re

-p

differences between groups of wild type and ppif−/− cells both exposed to PbAc.

ro of -p re lP na ur Jo

Figure 3. CypD deficiency attenuated impaired energy metabolism caused by Pb. (A-B) wild type or ppif−/− SH-SY5Y cells were treated with 25μM PbAc for 24h, then the ATP content and Na-K-ATPase activity in cells were analyzed, n=4. (C) proteins involved in AMPK signaling pathway, including p-AMPK, AMPK, p-Raptor and Raptor were detected by western blot, n=3. (D-E) The glucose import ability of cells

were analyzed by staining with 2-NBDG, n=3. (F) Glut1 and Glut3 proteins were detected, n=3. * P<0.05 and ** P<0.01 represent significant differences compared with the untreated wild type cells. # P<0.05 and ## P<0.01 represent significant

Jo

ur

na

lP

re

-p

ro of

differences between groups of wild type and ppif−/− cells both exposed to PbAc.

Figure 4. CypD deficiency attenuated Pb-induced oxidative stress. (A-B) ROS level in cell and in mitochondria were detected by staining DCHF and Mito SOX in

SH-SY5Y cells treated with 25μM PbAc for 6h, respectively. Scale bar = 50μm, n=6. (C-E) wild type or ppif−/− SH-SY5Y cells were treated with 25μM PbAc for 24h, the MDA level (n=4) (C), GSH content (n=4) (D) and SOD activity (n=3) (E) were analyzed. * P<0.05 and *** P<0.001 represent significant differences compared with the untreated wild type cells. # P<0.05, ## P<0.01 and ### P<0.001 represent significant differences between groups of wild type and ppif−/− cells both exposed to PbAc. $ P<0.05 represents significant differences between groups of ppif−/− cells

Jo

ur

na

lP

re

-p

ro of

treated and untreated with PbAc.

ro of -p re lP na ur

Jo

Figure 5. CypD deficiency reduced DNA damage and cell death caused by Pb. (A-B) wild type SH-SY5Y cells were exposed to PbAc for 24h, AIF protein levels in nucleus and mitochondria (A) and Cytochrome C protein levels in cytoplasm and mitochondria (B) were analyzed by western blot, n=3. (C) CCK8 assay was used to detect the cell viability of wild type or ppif−/− SH-SY5Y cells were treated with varied dose of PbAc (1, 5 or 25μM) for 24h, n=5. (D-E) the Caspase 3/7 activity (n=4) (D) and cell apoptosis (n=3) (E-F) were analyzed after PbAc treatment. * P<0.05, **

P<0.01 and *** P<0.001 represent significant differences compared with the untreated wild type cells and # P<0.05 and ## P<0.01 represent significant differences between groups of wild type and ppif−/− cells both exposed to PbAc. $ P<0.05 represents significant differences between groups of ppif−/− cells treated and untreated

Jo

ur

na

lP

re

-p

ro of

with PbAc.

Table 1 Gene GLUT1 GLUT3

Jo

ur

na

lP

re

-p

ro of

GAPDH

F R F R F R

Primer sequence 5′-TCACTGTCGTGTCGCTGTTT-3′ 5′-ACGATGAACCATGGGATGGG-3′ 5′-GATCCTTCCTGAGGACGTGGA-3′ 5′-CAGGAGCATTGATGACCCCA-3′ 5′-CTGACTTCAACAGCGACACC-3′ 5′-TGCTGTAGCCAAATTCGTTGT-3′