ENOS deficiency causes podocyte injury with mitochondrial abnormality

Author’s Accepted Manuscript ENOS deficiency causes podocyte injury with mitochondrial abnormality Shuko Ueda, Shota Ozawa, Kiyoshi Mori, Katsuhiko Asanuma, Motoko Yanagita, Shunya Uchida, Takahiko Nakagawa www.elsevier.com

PII: DOI: Reference:

S0891-5849(15)00296-8 http://dx.doi.org/10.1016/j.freeradbiomed.2015.06.028 FRB12488

To appear in: Free Radical Biology and Medicine Received date: 14 January 2015 Revised date: 20 May 2015 Accepted date: 8 June 2015 Cite this article as: Shuko Ueda, Shota Ozawa, Kiyoshi Mori, Katsuhiko Asanuma, Motoko Yanagita, Shunya Uchida and Takahiko Nakagawa, ENOS deficiency causes podocyte injury with mitochondrial abnormality, Free Radical Biology and Medicine, http://dx.doi.org/10.1016/j.freeradbiomed.2015.06.028 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

eNOS deficiency causes podocyte injury with mitochondrial abnormality Shuko Ueda, MD1,2, Shota Ozawa, MSc1,3, Kiyoshi Mori, MD, PhD1, Katsuhiko Asanuma, MD, PhD1, Motoko Yanagita, MD, PhD1,4, Shunya Uchida, MD, PhD2, Takahiko Nakagawa, MD, PhD1 1

TMK Project, Medical Innovation Center, Kyoto University, Kyoto, Japan

2

Department of Internal Medicine, Teikyo University School of Medicine, Tokyo, Japan

3

Pharmacology Research Laboratories II, Mitsubishi Tanabe Pharma Corporation,

Saitama, Japan 4

Department of Nephrology, Kyoto University Graduate School of Medicine, Kyoto,

Japan

Address for Correspondence: Takahiko Nakagawa Associate Professor TMK Project Medical Innovation Center Kyoto University, Kyoto, Japan 53 Shogoin Kawahara-cho, Sakyo-ku, Kyoto, 606-8397, Japan Tel: +81-75-366-7411 Fax: +81-75-751-4158 E-mail: [email protected]

1

Abstract The contribution of endothelial nitric oxide synthase (eNOS) to podocyte integrity remains unclear. This study therefore examined podocytes and mitochondrial abnormalities in eNOS deficient mice. Absence of eNOS caused glomerular hypertrophy, along with occasional glomerular sclerosis and mesangiolysis. While many glomeruli did not have such advanced lesions, ultrastructural analysis showed cellular hypertrophy, vacuolization, lysosomal enlargement, and microvillus formation in podocytes of eNOS knockout (KO) mice. Increased oxidative stress was associated with mitochondrial abnormalities, including an increase in number, coupled with a reduction in size, of mitochondria in podocytes of eNOS-KO mice. While the levels of expression of several mitochondrial proteins were not altered, the D-17 mutation in mitochondrial DNA was significantly associated with the eNOS deficiency. Renal ATP level in the renal cortex and mitochondrial respiration in the primary pdocytes were significnantly lower in eNOS-KO mice, suggesting that renal mitochondria may be functionally impaired. Podocytes cultured with endothelial conditioned medium lacking NO consistently showed a greater degree of mitochondrial fragmentation and an increase in mitochondrial oxidative stress, with these mitochondrial alterations rescued by an NO donor. In conclusion, eNOS may be necessary to maintain podocyte integrity, especially mitochondrial function. Keywords Endothelial, oxidative stress, nitric oxide, NO, glomerular, podocyte

2

Introduction Nitric oxide (NO), a free radical in the form of a highly diffusible gas, regulates renal hemodynamics. Three different forms of NO synthase (NOS) are expressed in kidneys, neuronal NOS (nNOS), inducible NOS (iNOS) and endothelial NOS (eNOS). Expression of these three isoforms is relatively cell specific, with each regulated by distinctly different mechanisms. While nNOS is located in macula densa of the tubular epithelial cells and the inner medullary collecting ducts [1], eNOS is predominantly expressed in the endothelium of intrarenal arteries, the glomerular and peritubular capillaries, the afferent/efferent arterioles, and medullary vasa recta in rodents as well as humans [1-3]. Interestingly other cell types, including proximal tubular epithelial cells and mesangial cells, might express eNOS [4, 5]. NO synthesized by each enzyme plays a key role in the kidney. In particular, endothelial NO has been shown to be protective of the vascular system owing to its antithrombogenic effects, blocking endothelial cell activation/injury induced by cytokines and promoting vasodilatation. Thus, eNOS dysfunction is often deleterious and associated with vascular disease and kidney injury. For example, diabetic nephropathy was found to be associated with eNOS dysfunction [6]. This is likely due to the ability of glucose to induce eNOS uncoupling, resulting in endothelial dysfunction [7, 8]. The role of eNOS in the glomerular disease has been examined by using eNOS deficient mice. When diabetes is induced in C57BL6 mouse, glomerular injury was further exacerbated by eNOS deficiency to exhibit mesangiolysis, glomerular capillary microaneurysms, and sclerotic nodular-like lesions, lesions that resemble diabetic glomerular injury in humans [9-11]. Interestingly, diabetic eNOS-KO mice also exhibited severe retinopathy, resembling human diabetic retinopathy [12]. Similarly, other types of renal diseases were also deteriorated by eNOS deficiency, including remnant kidney [13], anti-glomerular basement membrane (GBM) glomerulonephritis [14] and lupus prone MRL/lpr mice [15]. Thus, the absence of eNOS appears to be deleterious and enhances the existing renal injury. In contrast to the diseased kidney, the roles of endothelial NO in normal kidneys remain unclear. However, glomerular eNOS expression is completely eliminated in the mouse lacking the eNOS genel [2], suggesting that this is a suitable model to examine the role of eNOS in the normal glomerulus. A lack of NO may cause several types of intracellular disturbance, including mitochondrial dysfunction. For example, reduced mitochondrial 3

biogenesis [16] and abnormalities in β-oxidation [17] have been reported in eNOS deficient mice. This study analyzed the role of eNOS in normal podocytes, as these cells are important in maintaining normal glomerular function. Podocyte injury was examined in the kidneys of eNOS-KO mice, as was the association between podocyte damage and mitochondrial abnormalities.

4

Materials and Methods Experimental protocols: All animal experiments were performed in accordance with the Animal Experimentation Committee of Kyoto University Graduate School of Medicine. Male C57BL/6J-Nos3tm1nc (eNOS-KO) and C57BL/6J (wild type; WT) mice aged 8 weeks (Jackson Laboratory, Bar Harbor, ME) were housed for 12 weeks in our facility and were fed a standard laboratory chow ad libitum. Systolic blood pressure was measured every other week using a tail-cuff sphygmomanometer (Visitech BP-2000; Visitech Systems, Apex, NC). Urine was collected overnight from mice placed in metabolic cages. At 20 weeks of age, all mice were sacrificed to obtain blood and kidney tissue samples. Molecular analyses: Urinary albumin concentrations were measured using Albuwell M (Exocell, Philadelphia, PA) and urinary 8-OHdG was measured by enzyme-linked immunoabsorbent assay (Nikken Seil Co., Sizuoka, Japan). Creatinine concentrations in serum and urine were measured using commercial kits (Oriental Bioservice, Kyoto, Japan). Histological analysis: Formalin-fixed, paraffin-embedded sections (2 µm) were stained with periodic acid-Schiff reagent (PAS) for light microscopy. Glomeruli (50–100 per kidney) were examined on coronal sections to evaluate the degrees mesangiolysis and glomerulosclerosis. Mesangiolysis was defined as dissolution of the mesangial matrix and was calculated as the percentage of glomeruli with mesangiolysis [18]. Glomerulosclerosis was defined as obstruction of the capillary lumen caused by mesangial expansion or collapsed capillaries. All kidney sections were examined by two investigators in a blinded manner. Podocyte ultrastructural analysis: Small pieces of renal cortex were fixed in 2% glutaraldehyde/4% paraformaldehyde solution overnight, postfixed and embedded in Epon 812. Podocyte ultrastructure was assessed by scanning electron microscopy (Hitachi S4700, Tokyo, Japan) and transmission electron microscopy (TEM) at magnifications of × 1000, 4000, and 6000 (Hitachi S4700), a latter of which was used to examine a minimum of 120 podocytes from four mice per group. Percent podocyte area was determined in 20 glomeruli per group, and number of podocyte nuclei counted in glomerular areas measuring 10−3 μm2. Podocyte size was calculated by dividing podocyte area by the number of nuclei after podocyte nuclear area was subtracted from podocyte area. The percentage of injured podocytes was calculated by dividing the 5

number of podocytes containing any injuries, including lysosomal enlargement, vacuolization, microvillus formation, and pseudocyst, by the total number of podocytes. Foot processes, defined as any attached epithelial segments located in the basement membrane and separated from the cytoplasmic extensions of adjacent foot processes, were assessed in five open random capillary loops in each of five randomly selected glomeruli per specimen. The total circumference of the capillary loop was also included in images of more than 75% of samples. Foot processes were analyzed by TEM images at a magnification of ×6000, and the arithmetic means of their widths were calculated [19]. Immunohistochemistry and Immunofluorescence: Following deparaffinization, the tissue samples were incubated with 3% H2O2 for 20 min to inactivate endogenous peroxidase activity, followed by retrievals of the antigens for podocin, nephrin and 8-hydroxy-2-deoxyguanosine (8-OHdG) by incubation in 10 mM citrate buffer (pH 6.0) at 50–90°C for 30 min. The formalin-fixed, paraffin-embedded sections were subsequently incubated overnight at 4°C with primary antibodies, including (1) rabbit anti-type IV collagen (Chemicon International, Temecula, CA), (2) WT-1 (Santa Cruz Biotechnology Inc., Dallas, TX), (3) rabbit anti-podocin (Sigma Aldrich, St. Louis, MO), (4) goat anti-nephrin (R&D Systems, Minneapolis, MN), (5) mouse anti-8-OHdG (JaL CA, Sizuoka, Japan), (6) rabbit anti-nitrotyrosine (Millipore, Temecula, CA), and (7) rabbit anti-iNOS (abcam, Cambridge, MA) antibodies. The sections were washed, incubated with secondary antibodies for 30 min at room temperature and developed color with diaminobenzidine (DAB) [20]. The number of cells positive for WT-1 and iNOS was counted in all glomeruli at ×400 magnification in each section. To assess type IV collagen and podocin expression, the digital images at ×400 magnification were analyzed using Metamorph microscopy automation and image analysis software (Molecular Devices, Sunnyvale, CA). The percent positive area was determined as the number of DAB-positive pixels per glomerular tuft area of 30 glomeruli per section. The double immunofluorescence procedure used to assess expression of nephrin, 8-OHdG, nitrotyrosine and iNOS has been described [21]. Sections were incubated with Alexa Fluor 488-labeled goat anti-rabbit IgG (Invitrogen, Carlsbad, CA) or Alexa Fluor 488-labeled goat anti-mouse IgG (Invitrogen), followed by incubation with Alexa Fluor 568 donkey anti-goat IgG (Invitrogen) for 1 h at room temperature. The sections were mounted with Vectashield anti-fade mounting medium (Vector Labs, Burlingame, CA) and examined by confocal microscopy (Leica TCS SP5; Leica Microsystems, Tokyo, Japan). Overlapping signals of red fluorescent protein with green fluorescent protein 6

(GFP) yielding a yellow color were measured by Metamorph as percent positive area per glomerular tuft. Polymerase chain reaction (PCR): Total RNA was extracted from either renal cortex or primary podocytes using RNeasy Mini Kits (Qiagen, Chatsworth, CA), and first strand cDNA was synthesized from 1 µg of total RNA using Revertra Ace-α- (Toyobo, Osaka, Japan). The primers used to detect expression of mRNAs encoding mitochondrial factors are shown in Tables 2 and 3. The amplification program consisted of an initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, and extension at 72°C for 1 min (Step One Plus; Life Technologies, Waltham, MA). The amount of each PCR product was normalized relative to that of 18S rRNA. Mitochondrial assay: Mitochondrial structure was assessed by TEM examination of at least 1000 mitochondria per sample at a magnification of × 4000. Mitochondrial size and number of mitochondria per podocyte were measured, and mitochondrial density was calculated as number of mitochondria perμm2 podocyte area. Total DNA was extracted from kidney tissue and purified using DNeasy Blood &Tissue Kit (Qiagen). Diluted DNA was added to FASTStart Universal SYBR Green Master mix (Roche, Basel, Switzerland) with specific primers, followed by PCR amplification. The amplification program consisted of an initial denaturation at 95°C for 20 sec, followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 55°C (COX-II) or 57°C (UCP-2) for 30 sec, and annealing at 72°C for 1 min (StepOnePlus). The amount of COX-II per sample was normalized to that of UCP-2 to determine the ratio for mitochondrial to genomic DNA. The presence of the D-17 deletion in the cytochrome b gene of mt DNA was examined with two sets of primers (Table 3) [22, 23]. Western blotting: Briefly, cell lysates were processed for sodium dodecyl sulfate polyacrylamide gel electrophoresis, and electrotransferred onto polyvinylidene fluoride membranes. After blocking, the membranes were incubated with primary anti-eNOS antibody (Cell Signaling, Danvers, MA), washed, and incubated with horseradish peroxidase conjugated secondary antibody for 1 h at room temperature. Signals were detected with an ECL detection system (Health Care, Buckinghamshire, UK), quantified with National Institutes of LAS 4000 software (NIH, Bethesda, Maryland) and normalized to the expression of GAPDH.

7

Cell Culture: Conditionally immortalized mouse podocyte cell lines were cultured at 33 °C in RPMI-1640 medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 10 U/ml recombinant mouse interferon (INF)-γ, as described [24]. To induce differentiation, podocytes were cultured at 37 °C in the absence of INF-γ (growth restrictive conditions) in the same medium for at least 7 days. In parallel, human glomerular microvascular endothelial cells (hGECs) (Cell Systems, Kirkland, WA) were cultured in EGM-2MV (Lonza, Walkersville, MD) containing 5% fetal bovine serum and supplements. Cells between passages 5 and 9 were used for the experiments. Confluent hGECs were incubated with fresh medium with or without 1 mM L-NAME for 24 h. The endothelial cell conditioned medium was added to podocytes, which were incubated for 8 h; 10−5 M NONOate (Cayman, Ann Arbor, MI) was added to some of the dishes. To monitor NO levels, nitrite and nitrate, both of which are metabolites of NO, were measured using Colorimetric assay kits (Cayman). Mitochondria were analyzed using either Mitotracker Mitochondrion-Selective Probes to visualize mitochondrial structure or MitoSOX Red Mitochondrial superoxide indicator to detect mitochondrial oxidative stress, according to the manufacturer’s protocols (Invitrogen). Signals from a total of 80–100 cells were captured by an All-In-One fluorescence microscope (Keyence, Itasca, IL). The mean fluorescence intensity of oxidized MitoSOX in single cells was quantified by Metamorph image analysis software (Molecular Devices) [25]. Fragmented mitochondria appeared punctuate and rounded whereas normal mitochondria had a thread-like structure. Percent mitochondrial fragmentation was calculated per 100 cells, with cells with mitochondrial fragmentation defined as those containing >70% fragmented mitochondria [26]. Primary glomerular cells isolated from isolated glomeruli with the Dynabeads methods were seeded in culture in DMEM medium supplemented with 10% fetal bovine serum. After podocytes formed the colonies, the cells were harvested with trypsin and used at passage 1 in Flux analyzer. Wilms tumor 1 (WT-1) and synaptopodin were used as markers to confirm the characteristics for primary podocytes. Oxidative consumption rate: Basal oxygen consumption rate (OCR; pmol/min) in the primary podocytes was measured using a Seahorse Bioscience XF24 Extracellular Flux Analyzer (Primetech,Tokyo, Japan). Twelve wells were examined for each group. In XF24-well microplates (Seahorse Bioscience), 1 × 104 podocytes per well were seeded in DMEM containing 10% FBS. ATP-linked respiration rate was determined by the subsequent addition of oligomycin (1µM). 2µM carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) was added to induce maximal mitochondrial oxygen 8

consumption. At the end of the run, 1  μM rotenone and 1  μM antimycin were added to determine the mitochondria-independent oxygen consumption. Statistical analysis: All values are expressed as mean ± SD. Data in two groups were compared using Student’s t-tests, and data in three groups compared by analysis of variance followed by Tukey’s method. A value of P < 0.05 was considered statistically significant.

9

Results General characteristics of eNOS-KO mice At age 20 weeks, male eNOS-KO mice had significantly lower body weight and significantly higher blood pressure than WT mice. Assessments of renal function showed that BUN was slightly but significantly higher in eNOS-KO than in WT mice, but there were no differences in serum creatinine concentration and creatinine clearance. Mice lacking eNOS develop subtle glomerular injury Although eNOS deficiency was shown to accelerate the progression of glomerular injury in several types of renal disease, it was unclear whether a lack of eNOS per se causes podocyte injury in normal kidneys. We therefore evaluated podocytes in eNOS-KO mice. PAS staining demonstrated that some glomeruli exhibited severe glomerular injury, including mesangiolysis, glomerular sclerosis and mesangial expansion (Figure 1). Likewise, collagen IV deposition was higher in the glomeruli of eNOS-KO than of WT mice (Figure 1D, H, K). Moreover, urinary albumin excretion was higher in eNOS-KO than in WT mice (Figure 1L, M). Mice lacking eNOS exhibit podocyte injury Examination of the expression of the podocyte markers WT1 and podocin showed that the levels of both were significantly lower in the glomeruli of eNOS-KO than of WT mice (Figure 2A, B). Ultrastructural analysis using scanning electronic microscopy also demonstrated that foot processes of podocytes appeared swollen in eNOS-KO mice (Figure 2G–J), but had a normal appearance in WT mice (Figure 2C–F). Moreover, the pattern of foot process interdigitation was found to be impaired and disrupted in eNOS-KO mice (Figure 2G–J). Transmission electron microscopy also showed several structural abnormalities in the podocytes of eNOS-KO mice, including the accumulation of enlarged lysosomes, microvillus formation, pseudocysts and foot process effacement (Figure 3A–D). Approximately 40% of the podocytes in eNOS-KO mice exhibited structural abnormalities, including increases in lysosome number or size, microvillus formation and vacuolization/pseudocysts. Lysosomal abnormalities were most commonly observed in injured podocytes (Figure 3J, K). In addition, podocytes in eNOS-KO mice appeared hypertrophic, while the number of podocytes was lower in eNOS-KO than in WT mice (Figure 3E–I). Association of podocyte injury with oxidative stress in eNOS-KO mice

10

In order to assess oxidative stress, nitrotyrosine and 8-OHdG were examined as these factors are known to be good markers in the kidney diseases [10, 26] in association with a production of hydrogen peroxide, an immediate product under oxidative stress [27]. Nephrin was used as a marker of podocytes. Podocyte oxidative stress, as labelled with both nephrin and either nitrotyrosine or 8-OHdG, was significantly higher in eNOS-KO than in WT mice (Figure 4A–D). Moreover, urinary 8-OHdG excretion was higher in eNOS-KO mice (Figure 4E). In general, NO or peroxynitrate is generally required for nitrotysosine formation. Since eNOS is eliminated in this model, we next examined the expression of iNOS, which conceivably contributes to the nitrotyrosine formation under oxidative stress. As shown in Figure 4F, iNOS expression was barely observed in the normal glomerulus of wild type mice whereas it appeared to be increased and overlapped with nephrin, suggesting that iNOS expression was induced in the podocytes of eNOS-KO mice (Figure 4F). Consistently, the number of iNOS positive cells in glomerulus was significantly increased in the eNOS-KO mice compared to that in the wild type mice (Figure 4G). Mitochondrial fragmentation and dysfunction in podocytes of eNOS-KO mice Transmission electron microscopy showed that podocyte mitochondria were smaller in eNOS-KO than in WT mice (Figure 5A–C). In contrast, the number and density of podocyte mitochondria were significantly higher in eNOS-KO than in WT mice (Figure 5D, E), suggesting that eNOS deficiency may result in fragmentation of podocyte mitochondria. Mitochondrial DNA concentration tended to be lower in eNOS-KO than in WT mice, although the difference was not statistically significant (Figure 5F). Oxidative stress has been shown to induce deletions in mitochondrial DNA, in particular the D-17 deletion [22]. We found that the D-17 deletion in mitochondrial DNA was significantly more frequent in the renal cortex of eNOS-KO than of WT mice (Figure 5G). Moreover, renal ATP content was significantly lower in eNOS-KO than WT mice (Figure 5H), consistent with previous findings [28]. In order to further examine mitochondrial function in the podocytes, we next isolated the primary podocytes, which were confirmed by markers for synaptopodin and WT-1 (Figure 5I), and the oxygen consumption rate (OCR) was examined using Flux analyzer. As shown in Figure 5J, OCR was significantly lower at base line, during prevention of ATP synthase by oligomycin, and in the blocking of oxidative phosphorylation with rotenone/antimycin in the eNOS-KO mice compared to the wild type mice, suggesting that mitochondrial respiration was reduced by eNOS deficiency in the podocytes, and accounting for a reduction in ATP levels in the kidney. 11

Because mitochondrial structural abnormalities and dysfunction may be related to alterations in the expressions of mitochondrial composition factors, the levels of mRNA expressions of several mitochondrial components encoded by mitochondrial and nuclear DNA, and mitochondrial biogenesis factors in renal cortex and primary podocytes. Levels of all these factors were found to be identical in renal cortex or primary podocytes between eNOS-KO and WT mice (Supplemental figure). Blocking eNOS in endothelium alters mitochondrial function in cultured podocytes Our initial experiments confirmed that eNOS is expressed in hGECs, but not in cultured podocytes (Figure 6A), and that 1 mM L-NAME inhibited eNOS activity in the hGECs (Figure 6B). To determine whether endothelial derived NO can act on podocytes, we investigated the effect on podocytes of conditioned medium in which the hGECs had been cultured with/without L-NAME for 24 h. L-NAME significantly reduced levels of nitrate and nitrite, both of which are metabolites of NO, in conditioned medium of hGECs. Podocytes with condition medicum from hGEC with L-NAME exhibited greater degrees of mitochondrial fragmentation and mitochondrial oxidative stress after 8 h compared with cells in conditioned medium from hGECs without L-NAME (Figure 6C-6E). In turn, the addition of an NO donor, 10−5 M NONOate, to the cells in the former condition inhibited both mitochondrial fragmentation and the induction of mitochondrial oxidative stress (Figure 6C–6E).

12

Discussion Glomeruli appear generally normal in eNOS-KO mice, except that there are fewer glomeruli in the superficial renal cortex and those appear crowded and hypoplastic [29]. However, precise structural investigations have not been performed. To explore the effect of endothelial NO on podocyte integrity, we examined the kidneys without any diseases in the eNOS-KO mice. Despite previous assumptions, we found that eNOS deficiency per se resulted in the development of subtle glomerular disease, accompanied by podocyte injury and low grade albuminuria. Ultrastructural examination showed several abnormalities of the injured podocytes, including foot process effacement,

microvillus

formation,

vacuolization,

and

lysosomal

enlargement.

Interestingly, these structural abnormalities were associated with mitochondrial fragmentation, as shown by a reduction in mitochondrial size and an increase in number of mitochondria. These mitochondrial structural abnormalities were found to be associated with an increase in oxidative stress and a reduction in renal ATP level, indicating mitochondrial dysfunction. Indeed, mitochondrial function in the primary podocytes of the eNOS-KO mice was impaired. Our results showed that a lack of endothelial NO impaired both mitochondrial function and structure in the podocytes. Interestingly, podocyte is unlikely viewed as an exceptional cell type as Nisoli’s research group also found that mitochondria were smaller in size in association with a reduction in ATP levels in liver and gastrocnemius in the eNOSKO mice [28]. Consistently, De Palma et al showed that an inhibition of NO synthesis resulted in mitochondrial fragmentation in myogenic precursor cells [30]. These results indicate that eNOS deficiency could cause mitochondrial fragmentation. A potential mechanism could be accounted for by the ability of NO to stimulate the guanylate cyclase and cGMP pathway to suppress dynamin-related protein (Drp-1), which is a molecule necessary for mitochondrial fission [30]. In other words, a lacking eNOS could result in the stimulation of Drp-1, leading to mitochondrial fragmentation. However, some studies are against this notion and show that NO could induce mitochondrial fission through S-nitrosylation of Drp-1 [31]. Hence, NO may contribute to the both mitochondrial fission and fusion, and therefore further studies are required to understand its precise mechanisms. An addition effect of eNOS deficiency could be an increase in oxidative stress. It is found that NO itself can exert antioxidant property [32], and an eNOS activation induced by agents, such as Chinese herb, PKC inhibitor, red wine, or resveratrol, is often 13

associated with a reduction in oxidative stress [33-35]. We also previously reported that oxidative stress was enhanced by eNOS deficiency in the diseased kidney [10, 26]. The fragmented mitochondria, which are a consequence of eNOS deficiency, could produce oxidative stress [36, 37]. In turn, oxidative stress could modulate mitochondrial function and structure. Recently, Iqbal et al showed that hydrogen peroxide caused mitochondrial fragmentation in muscle cells, suggesting that mitochondrial structure can be modulated by oxidative stress [38, 39]. Taken together, eNOS deficiency, mitochondrial fragmentation and oxidative stress could be closely linked each other and likely create vicious cycles. In this study, we confirmed that the mitochondrial respiration was reduced in the primary podocytes of eNOS-KO mice despite of no alterations in mRNA expressions for mitochondrial components and biogenesis-related factors. A potential mechanism for mitochondrial dysfunction could be the mitochondrial fragmentation. Indeed, previous studies demonstrated that fragmented mitochondria induced oxidative stress [36] while oxidative stress is also able to induce mitochondrial fragmentation [38], suggesting the close relationships between oxidative stress and mitochondrial fragmentation. We next found that D-17 deletion, which is a marker of damaged mitochondrial DNA and associated with such pathological condition as aging [22], was more frequently induced in the eNOSKO mouse, indicating that the damaged mitochondrial DNA could also impair mitochondrial function in the eNOSKO mice. Finally, NO deficiency could be another mechanism for mitochondrial dysfunction as NO is likely essential for mitochondrial function and ATP production [28]. Reductions in oxygen consumption and mitochondrial β-oxidation could account for mitochondrial dysfunction in the eNOSKO mice [17]. Oxidative stress may not be necessarily pathogenic as we found very faint signals for 8-OHdG and nitrotyrosine even in the glomerulus of wild type mice. Likewise, other research groups also demonstrated certain levels of glomerular 8-OHdG and nitrotyrosine in the wild type mice [10, 27]. Furthermore, the physiological level of urinary 8-OHdG was also detected in the normal people [40]. These data suggest that the production of oxidative stress also takes place even in the normal condition in both animals and humans. Perhaps, oxidative stress at low level might play a key role to maintain physiological condition [41].

14

Inasmuch as podocytes do not express eNOS, podocyte injury may be caused by the absence of NO supplied by cells that express eNOS. Needless to say, the endothelial cell is a most likely cell type which supply NO. We therefore used the cultured endothelial cells to determine whether NO derived from endothelial cell could influence on the podocyte mitochondrial integrity. Consistent with in vivo results, we found that podocytes cultured in conditioned medium from endothelial cells unable to produce NO exhibited mitochondrial fragmentation with an increase in oxidative stress. In this study, L-NAME was used to block eNOS in the cultured endothelial cells. An issue to be discussed is that L-NAME alone may affect podocyte properties, despite these cells not expressing eNOS. To exclude this possibility, the effect of NO donor, NONOate, was examined. This reagent was able to mitigate the adverse effects of L-NAME, suggesting that the effect of L-NAME on podocytes was due to its inhibition of eNOS and that the deficient NO production by endothelial cells may have been responsible for the mitochondrial abnormalities in cultured podocytes. Given these facts, the podocyte injury observed in eNOS-KO mice is likely due to a lack of NO from endothelial cells. However, another possibility remains that other cells expressing eNOS may be responsible for podocyte integrity. For example, mesangial cells and tubular epithelial cells in the kidney express eNOS [4, 5, 42], suggesting the these non-endothelial cells may be involved in maintaining podocyte integrity. Further studies would be required to address this issue.. Vascular endothelial growth factor (VEGF) may participate in the cross-talk between podocytes and glomerular endothelial cells. VEGF is regarded as a podocyte-derived factor that acts on glomerular endothelial cells expressing VEGF receptor [43]. Indeed, this factor was found to be indispensable for glomerular endothelial cell integrity as its lack causes endothelial dysfunction and glomerular injury, such as glomerular thrombotic microangiopathy [44]. These findings suggested that glomerular endothelial cell-derived factors, such as NO, can modulate podocyte function. Conclusion A lack of eNOS was associated with podocyte abnormalities, accompanied by mitochondrial injury. Inasmuch as eNOS is highly expressed in endothelial cells, NO derived from glomerular endothelial cells may contribute to maintaining podocyte integrity. 15

Acknowledgement This study was supported by a research fund from the Mitsubishi Tanabe Pharma Corporation, a financial support from Teikyo University, and a research grant from the Uehara memorial foundation.

16

References [1]

Bachmann, S.; Bosse, H. M.; Mundel, P. Topography of nitric oxide synthesis

by localizing constitutive NO synthases in mammalian kidney. Am J Physiol 268:F885-898; 1995. [2]

Kanetsuna, Y.; Takahashi, K.; Nagata, M.; Gannon, M. A.; Breyer, M. D.; Harris,

R. C.; Takahashi, T. Deficiency of endothelial nitric-oxide synthase confers susceptibility to diabetic nephropathy in nephropathy-resistant inbred mice. Am J Pathol 170:1473-1484; 2007. [3]

Gu, X.; Herrera, G. A. Expression of eNOS in kidneys from hypertensive

patients. International journal of nephrology and renovascular disease 3:11-19; 2010. [4]

Faria, A. M.; Papadimitriou, A.; Silva, K. C.; Lopes de Faria, J. M.; Lopes de

Faria, J. B. Uncoupling endothelial nitric oxide synthase is ameliorated by green tea in experimental

diabetes

by

re-establishing

tetrahydrobiopterin

levels.

Diabetes

61:1838-1847; 2012. [5]

Thomas, S. E.; Anderson, S.; Gordon, K. L.; Oyama, T. T.; Shankland, S. J.;

Johnson, R. J. Tubulointerstitial disease in aging: evidence for underlying peritubular capillary damage, a potential role for renal ischemia. J Am Soc Nephrol 9:231-242; 1998. [6]

Komers, R.; Schutzer, W. E.; Reed, J. F.; Lindsley, J. N.; Oyama, T. T.; Buck, D.

C.; Mader, S. L.; Anderson, S. Altered endothelial nitric oxide synthase targeting and conformation and caveolin-1 expression in the diabetic kidney. Diabetes 55:1651-1659; 2006. [7]

Nakagawa, T.; Sato, W.; Sautin, Y. Y.; Glushakova, O.; Croker, B.; Atkinson, M.

A.; Tisher, C. C.; Johnson, R. J. Uncoupling of vascular endothelial growth factor with nitric oxide as a mechanism for diabetic vasculopathy. J Am Soc Nephrol 17:736-745; 2006. [8]

Du, X. L.; Edelstein, D.; Dimmeler, S.; Ju, Q.; Sui, C.; Brownlee, M.

Hyperglycemia inhibits endothelial nitric oxide synthase activity by posttranslational modification at the Akt site. J Clin Invest 108:1341-1348; 2001. [9]

Nakagawa,

T.;

Sato,

W.;

Glushakova,

O.;

Heinig,

M.;

Clarke,

T.;

Campbell-Thompson, M.; Yuzawa, Y.; Atkinson, M.; Johnson, R. J.; Croker, B. Diabetic eNOS knockout mice develop advanced diabetic nephropathy. J Am Soc Nephrol 18:539-550; 2007. [10]

Tanabe, K.; Lanaspa, M. A.; Kitagawa, W.; Rivard, C. J.; Miyazaki, M.; Klawitter,

J.; Schreiner, G. F.; Saleem, M. A.; Mathieson, P. W.; Makino, H.; Johnson, R. J.; Nakagawa, T. Nicorandil as a novel therapy for advanced diabetic nephropathy in the 17

eNOS-deficient mouse. Am J Physiol Renal Physiol 302:F1151-1160; 2012. [11]

Yuen, D. A.; Stead, B. E.; Zhang, Y.; White, K. E.; Kabir, M. G.; Thai, K.; Advani,

S. L.; Connelly, K. A.; Takano, T.; Zhu, L.; Cox, A. J.; Kelly, D. J.; Gibson, I. W.; Takahashi, T.; Harris, R. C.; Advani, A. eNOS deficiency predisposes podocytes to injury in diabetes. J Am Soc Nephrol 23:1810-1823; 2012. [12]

Li, Q.; Verma, A.; Han, P. Y.; Nakagawa, T.; Johnson, R. J.; Grant, M. B.;

Campbell-Thompson, M.; Jarajapu, Y. P.; Lei, B.; Hauswirth, W. W. Diabetic eNOS knockout mice develop accelerated retinopathy. Invest Ophthalmol Vis Sci; 2010. [13]

Nakayama, T.; Sato, W.; Kosugi, T.; Zhang, L.; Campbell-Thompson, M.;

Yoshimura, A.; Croker, B. P.; Johnson, R. J.; Nakagawa, T. Endothelial injury due to eNOS deficiency accelerates the progression of chronic renal disease in the mouse. Am J Physiol Renal Physiol 296:317-327; 2009. [14]

Heeringa, P.; van Goor, H.; Itoh-Lindstrom, Y.; Maeda, N.; Falk, R. J.; Assmann,

K. J.; Kallenberg, C. G.; Jennette, J. C. Lack of endothelial nitric oxide synthase aggravates

murine

accelerated

anti-glomerular

basement

membrane

glomerulonephritis. Am J Pathol 156:879-888; 2000. [15]

Gilkeson, G. S.; Mashmoushi, A. K.; Ruiz, P.; Caza, T. N.; Perl, A.; Oates, J. C.

Endothelial nitric oxide synthase reduces crescentic and necrotic glomerular lesions, reactive oxygen production, and MCP1 production in murine lupus nephritis. PLoS ONE 8:e64650; 2013. [16]

Nisoli, E.; Clementi, E.; Paolucci, C.; Cozzi, V.; Tonello, C.; Sciorati, C.; Bracale,

R.; Valerio, A.; Francolini, M.; Moncada, S.; Carruba, M. O. Mitochondrial biogenesis in mammals: the role of endogenous nitric oxide. Science 299:896-899; 2003. [17]

Le Gouill, E.; Jimenez, M.; Binnert, C.; Jayet, P. Y.; Thalmann, S.; Nicod, P.;

Scherrer, U.; Vollenweider, P. Endothelial nitric oxide synthase (eNOS) knockout mice have defective mitochondrial beta-oxidation. Diabetes 56:2690-2696; 2007. [18]

Nakagawa,

T.;

Sato,

W.;

Glushakova,

O.;

Heinig,

M.;

Clarke,

T.;

Campbell-Thompson, M.; Yuzawa, Y.; Atkinson, M. A.; Johnson, R. J.; Croker, B. Diabetic endothelial nitric oxide synthase knockout mice develop advanced diabetic nephropathy. J Am Soc Nephrol 18:539-550; 2007. [19]

van den Berg, J. G.; van den Bergh Weerman, M. A.; Assmann, K. J.; Weening,

J. J.; Florquin, S. Podocyte foot process effacement is not correlated with the level of proteinuria in human glomerulopathies. Kidney Int 66:1901-1906; 2004. [20]

Kosugi, T.; Heinig, M.; Nakayama, T.; Connor, T.; Yuzawa, Y.; Li, Q.; Hauswirth,

W. W.; Grant, M. B.; Croker, B. P.; Campbell-Thompson, M.; Zhang, L.; Atkinson, M. A.; Segal, M. S.; Nakagawa, T. Lowering blood pressure blocks mesangiolysis and 18

mesangial nodules, but not tubulointerstitial injury, in diabetic eNOS knockout mice. Am J Pathol 174:1221-1229; 2009. [21]

Nakayama,

T.;

Sato,

W.;

Yoshimura,

A.;

Zhang,

L.;

Kosugi,

T.;

Campbell-Thompson, M.; Kojima, H.; Croker, B. P.; Nakagawa, T. Endothelial von Willebrand factor release due to eNOS deficiency predisposes to thrombotic microangiopathy in mouse aging kidney. Am J Pathol 176:2198-2208; 2010. [22]

Tanhauser, S. M.; Laipis, P. J. Multiple deletions are detectable in mitochondrial

DNA of aging mice. J Biol Chem 270:24769-24775; 1995. [23]

Kume, S.; Uzu, T.; Horiike, K.; Chin-Kanasaki, M.; Isshiki, K.; Araki, S.;

Sugimoto, T.; Haneda, M.; Kashiwagi, A.; Koya, D. Calorie restriction enhances cell adaptation to hypoxia through Sirt1-dependent mitochondrial autophagy in mouse aged kidney. J Clin Invest 120:1043-1055; 2010. [24]

Mundel, P.; Reiser, J.; Zuniga Mejia Borja, A.; Pavenstadt, H.; Davidson, G. R.;

Kriz, W.; Zeller, R. Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236:248-258; 1997. [25]

Mbaya, E.; Oules, B.; Caspersen, C.; Tacine, R.; Massinet, H.; Pennuto, M.;

Chretien, D.; Munnich, A.; Rotig, A.; Rizzuto, R.; Rutter, G. A.; Paterlini-Brechot, P.; Chami, M. Calcium signalling-dependent mitochondrial dysfunction and bioenergetics regulation in respiratory chain Complex II deficiency. Cell Death Differ 17:1855-1866; 2010. [26]

Tanabe, K.; Tamura, Y.; Lanaspa, M. A.; Miyazaki, M.; Suzuki, N.; Sato, W.;

Maeshima, Y.; Schreiner, G. F.; Villarreal, F. J.; Johnson, R. J.; Nakagawa, T. Epicatechin limits renal injury by mitochondrial protection in cisplatin nephropathy. Am J Physiol Renal Physiol 303:F1264-1274; 2012. [27]

Dugan, L. L.; You, Y. H.; Ali, S. S.; Diamond-Stanic, M.; Miyamoto, S.;

DeCleves, A. E.; Andreyev, A.; Quach, T.; Ly, S.; Shekhtman, G.; Nguyen, W.; Chepetan, A.; Le, T. P.; Wang, L.; Xu, M.; Paik, K. P.; Fogo, A.; Viollet, B.; Murphy, A.; Brosius, F.; Naviaux, R. K.; Sharma, K. AMPK dysregulation promotes diabetes-related reduction of superoxide and mitochondrial function. J Clin Invest 123:4888-4899; 2013. [28]

Nisoli, E.; Falcone, S.; Tonello, C.; Cozzi, V.; Palomba, L.; Fiorani, M.; Pisconti,

A.; Brunelli, S.; Cardile, A.; Francolini, M.; Cantoni, O.; Carruba, M. O.; Moncada, S.; Clementi, E. Mitochondrial biogenesis by NO yields functionally active mitochondria in mammals. Proc Natl Acad Sci U S A 101:16507-16512; 2004. [29]

Forbes, M. S.; Thornhill, B. A.; Park, M. H.; Chevalier, R. L. Lack of endothelial

nitric-oxide synthase leads to progressive focal renal injury. Am J Pathol 170:87-99; 19

2007. [30]

De Palma, C.; Falcone, S.; Pisoni, S.; Cipolat, S.; Panzeri, C.; Pambianco, S.;

Pisconti, A.; Allevi, R.; Bassi, M. T.; Cossu, G.; Pozzan, T.; Moncada, S.; Scorrano, L.; Brunelli, S.; Clementi, E. Nitric oxide inhibition of Drp1-mediated mitochondrial fission is critical for myogenic differentiation. Cell Death Differ 17:1684-1696; 2010. [31]

Cho, D. H.; Nakamura, T.; Fang, J.; Cieplak, P.; Godzik, A.; Gu, Z.; Lipton, S. A.

S-nitrosylation of Drp1 mediates beta-amyloid-related mitochondrial fission and neuronal injury. Science 324:102-105; 2009. [32]

Kanner, J.; Harel, S.; Granit, R. Nitric oxide as an antioxidant. Arch Biochem

Biophys 289:130-136; 1991. [33]

Steinkamp-Fenske, K.; Bollinger, L.; Voller, N.; Xu, H.; Yao, Y.; Bauer, R.;

Forstermann, U.; Li, H. Ursolic acid from the Chinese herb danshen (Salvia miltiorrhiza L.) upregulates eNOS and downregulates Nox4 expression in human endothelial cells. Atherosclerosis 195:e104-111; 2007. [34]

Li, H.; Witte, K.; August, M.; Brausch, I.; Godtel-Armbrust, U.; Habermeier, A.;

Closs, E. I.; Oelze, M.; Munzel, T.; Forstermann, U. Reversal of endothelial nitric oxide synthase uncoupling and up-regulation of endothelial nitric oxide synthase expression lowers blood pressure in hypertensive rats. J Am Coll Cardiol 47:2536-2544; 2006. [35]

Wallerath, T.; Deckert, G.; Ternes, T.; Anderson, H.; Li, H.; Witte, K.;

Forstermann, U. Resveratrol, a polyphenolic phytoalexin present in red wine, enhances expression and activity of endothelial nitric oxide synthase. Circulation 106:1652-1658; 2002. [36]

Shenouda, S. M.; Widlansky, M. E.; Chen, K.; Xu, G.; Holbrook, M.; Tabit, C. E.;

Hamburg, N. M.; Frame, A. A.; Caiano, T. L.; Kluge, M. A.; Duess, M. A.; Levit, A.; Kim, B.; Hartman, M. L.; Joseph, L.; Shirihai, O. S.; Vita, J. A. Altered mitochondrial dynamics contributes to endothelial dysfunction in diabetes mellitus. Circulation 124:444-453; 2011. [37]

Yu, T.; Robotham, J. L.; Yoon, Y. Increased production of reactive oxygen

species in hyperglycemic conditions requires dynamic change of mitochondrial morphology. Proc Natl Acad Sci U S A 103:2653-2658; 2006. [38]

Iqbal, S.; Hood, D. A. Oxidative stress-induced mitochondrial fragmentation

and movement

in skeletal muscle myoblasts.

Am

J Physiol Cell Physiol

306:C1176-1183; 2014. [39]

Wu, S.; Zhou, F.; Zhang, Z.; Xing, D. Mitochondrial oxidative stress causes

mitochondrial fragmentation via differential modulation of mitochondrial fission-fusion proteins. The FEBS journal 278:941-954; 2011. 20

[40]

Wu, L. L.; Chiou, C. C.; Chang, P. Y.; Wu, J. T. Urinary 8-OHdG: a marker of

oxidative stress to DNA and a risk factor for cancer, atherosclerosis and diabetics. Clin Chim Acta 339:1-9; 2004. [41]

Sena, L. A.; Chandel, N. S. Physiological roles of mitochondrial reactive

oxygen species. Mol Cell 48:158-167; 2012. [42]

Herrera, M.; Silva, G.; Garvin, J. L. A high-salt diet dissociates NO synthase-3

expression and NO production by the thick ascending limb. Hypertension 47:95-101; 2006. [43]

Eremina, V.; Cui, S.; Gerber, H.; Ferrara, N.; Haigh, J.; Nagy, A.; Ema, M.;

Rossant, J.; Jothy, S.; Miner, J. H.; Quaggin, S. E. Vascular endothelial growth factor a signaling in the podocyte-endothelial compartment is required for mesangial cell migration and survival. J Am Soc Nephrol 17:724-735; 2006. [44]

Eremina, V.; Jefferson, J. A.; Kowalewska, J.; Hochster, H.; Haas, M.;

Weisstuch, J.; Richardson, C.; Kopp, J. B.; Kabir, M. G.; Backx, P. H.; Gerber, H. P.; Ferrara, N.; Barisoni, L.; Alpers, C. E.; Quaggin, S. E. VEGF inhibition and renal thrombotic microangiopathy. The New England journal of medicine 358:1129-1136; 2008.

21

Figure legends Figure 1. Glomerular injury in eNOS-KO mice. PAS staining shows that, compared with glomeruli in wild-type mice (A, B, C), eNOS-KO mice exhibit mesangial expansion (E), glomerulosclerosis (G, J), and mesangiolysis (F, I). Immunohistochemistry shows that collagen IV deposition is higher in eNOS-KO than in wild type mice (D, H, K). Urinary albumin excretion, as shown by urinary albumin-creatinine ratio (ACR) (L) and daily amount of urinary albumin excretion (M), is significantly higher in eNOS-KO than in wild-type mice. Scale bar, 50 μm. Figure 2. Podocyte injury in the eNOS-KO mice. Immunohistochemistry shows that podocin (brown) (A) and WT-1 (brown) (B) expression are significantly lower in eNOS-KO than in wild-type mice. Scanning electronic micrographs showing that podocyte foot processes appear elaborated in wild-type mice (C, D, E, F), but appear swollen (G, H, I, J) and with a disrupted pattern (I, J) in eNOS-KO mice. Scale bar, 50 μm (A, B). Figure 3. Transmission electron microscopy of podocytes in eNOS-KO mice. Transmission electron microscopy shows podocyte injury, including lysosome enlargement (A), microvillus formation (B), pseudocysts (C) and foot process effacement (D) in eNOS-KO mice. Compared with wild-type mice (E), the number of podocytes is reduced while cellular hypertrophy is prominent in eNOS-KO mice (F). PEC, parietal epithelial cells; P, podocyte. Quantification of podocyte nucleus number per 10−6 μm2 in glomeruli (G), percent podocyte area (H), and podocyte size (I) in wild-type and eNOS-KO mice are shown. The percentage of injured podocytes is significantly higher in eNOS-KO than in wild-type mice (J). Among podocyte injuries, lysosome enlargement is most frequent, followed by microvillus formation, vacuolization, hypertrophy and pseudocysts (K). Foot process effacement is also more prominent in eNOS-KO than in wild-type mice (L). Figure 4. Oxidative stress in podocytes of eNOS-KO mice. Immunofluorescence showing greater overlap of nitrotyrosine (green) (A, C) and 8OHdG (green) (B, D) with nephrin (red) expression in podocytes of eNOS-KO (KO) than wild-type (WT) mice. Urinary excretion of 8-OHdG is also higher in KO than in WT mice (E). While it is barely seen in glomerulus of wild type mice, iNOS expression appears to be overlapped with nephrin (F). Number of iNOS positive cells per glomerulus is significantly increased in eNOSKO mice compared to wild type mice (G). 22

Figure 5. Mitochondrial abnormalities in podocytes of eNOS-KO mice. Transmission electron microscopy (TEM) shows that mitochondria (white arrow) are smaller in eNOS-KO (B) than in wild-type (WT) (A) mice. Mitochondrial size (C), number of mitochondria (D), and mitochondrial density (E) in podocytes of eNOS-KO mice are shown based on TEM data. Although there are no significant differences in mitochondria DNA of WT and eNOS-KO mice (F), the D-17 deletion is significantly more frequent in renal cortex mitochondrial DNA of eNOS-KO than of WT mice (G). ATP levels are significantly lower in eNOS-KO than in WT mice (H). Most of cells isolated from glomeruli are positive for synaptopodin (Synpo; red) and Wilms tumor 1 (WT-1: green) while nuclei are stained by DAPI (blue) (I). Flux analyzer demonstrates % oxygen consumption rate (OCR) in primary podocytes of eNOS-KO mice relative to control (wild type) at 15 min (J). Twelve wells at each time points per group are examined. OCR is significantly reduced at base line, with oligomycin, and during rotenone/antimycin treatment in primary podocytes of eNOS-KO mice compared to wild type mice (J). Figure 6. Endothelial NO is required for mitochondrial integrity in cultured podocytes. eNOS expression is observed found in human glomerular microvascular endothelial cells (hGECs), but not podocytes (P) (A). Nitrite (NO2-) and nitrate (NO3-) levels in the conditioned medium of cultured hGEC is significantly reduced by 1 mM L-NAME at 24 h (B). Podocyte mitochondrial structure following incubation with endothelial cell conditioned medium (ECM), ECM plus 10−3 M L-NAME, and ECM plus L-NAME and 10−5 M NONOate (C). Podocyte mitochondria following culture in ECM are likely elongated in shape, whereas mitochondria cultured in ECM plus L-NAME are more globular, a change prevented by the addition of NONOate (C). Quantification of percent cells with mitochondrial fragmentation (D) is shown. Mitochondrial oxidative stress in the podocyte, as shown by MitoSOX (C). Signal intensity is stronger in podocytes cultured in ECM plus L-NAME than in podocytes cultured in ECM, a change prevented by the addition of NONOate (C). Quantification of MitoSOX signal intensity (E). Supplemental figure. mRNA expressions for mitochondrial factors in renal cortex and primary podocytes Quantification of mRNA expressions encoding ND1 (A, K), cytochrome b (cytb) (B, L), COX2 (C, M), ATPase6 (D, N), succinate dehydrogenase complex subunit C (SDHC) (E, O), NADH dehydrogenase Fe-S protein 2 (NDUF2) (F, P), ubiquinol-cytochrome c 23

reductase

core

protein

1

(Uqcrc1)

(G,

Q),

COX5a

(H,

R),

peroxisome

proliferator-activated receptor gamma, coactivator 1 alpha (PGC1 α ) (I, S), and transcription factor A, mitochondrial (Tfam) (J, T) are shown for renal cortex (A-J) and primary podocytes (K-T). Highlights 

Systemic eNOS deficiency results in podocyte injury in adult mouse kidney.



Podocyte injury was associated with mitochondrial injury and oxidative stress.



A lack of eNOS reduces mitochondrial respiration in the podocytes.



NO derived from eNOS is likely required to maintain podocyte integrity and mitochondrial function in mice.

24

Table

Table 1 Body weight and renal function at 20week. Wild type

eNOSKO

Age

20 week

20 week

Body weight (g)

31.8 ± 0.4

28.7 ± 0.6*

Systolic blood pressure (mmHg)

109.1 ± 7.1

127.8 ± 10.5*

Diastolic blood pressure (mmHg)

86.4 ± 5.6

97.8 ± 9.8*

Kidney weight (g)

0.17 ± 0.02

0.14 ± 0.02*

BUN (mg/dl)

24.9 ± 3.2

29.0 ± 3.7**

S Serum creatinine (mg/dl)

0.94 ± 0.021

0.102 ± 0.012

Ccr (ml/min)

0.21 ± 0.08

0.22 ± 0.10

Data are means ± SD. * p < 0.05, ** p < 0.01 vs. Wild type

1

Table 2: PCR Primers Forward

Reverse

18S

AGGGGAGAGCGGGTAAGAGA

GGACAGGACTAGGCGGAACA

ND1

CAGGATGAGCCTCAAACTCC

GGTCAGGCTGGCAGAAGTAA

Cytochrome b

ACGTCCTTCCATGAGGACAA

GAGGTGAACGATTGCTAGGG

Cox2

ACGAAATCAACAACCCCGTA

GGCAGAACGACTCGGTTATC

ATPase6

AATTACAGGCTTCCGACACAAAC

TGGAATTAGTGAAATTGGAGTTC CT

NDUFS2

TACCAAGTTCCTCCAGGAGCCA

GGCAAAACCAGGAGCCTTGATC

SDHC

ACAAATGGTCTCTTCCTATGGCA

CCCCTCCACTCAAGGCTATTC

Uqcrc1

AGTGTGGATTGACGCTGGCAGT

CCTCCTTCTCTAAGGCATTGCC

Cox5a

CTTTAAATGAATTGGGAATCTCC

GCCCATCGAAGGGAGTTTACA

AC UCP1

GCGTTCTGGGTACCATCCTAAC

GCGACCAGCCCATTGTAGA

PGC1α

CAATGAATGCAGCGGTCTTA

CTGTGAGGAGGGTCATCGTT

Tfam

GTCCATAGGCACCGTATTGC

CCCATGCTGGAAAAACACTT

Table 3: PCR primers to detect mtDNA mutation for D-17 Forward

Reverse

D-17

TCATGACCAATGAACACTCTG

AGGCTCGCGGACTAGTATAT

Cytochrome b

TCGCTTTCCACTTCATCTTAC

ATCCTGTTTCGTGGAGGAAG

2

Figure

Figure 1 PAS

Col. IV

A

B

C

D

E

F

G

H

WT

KO

I

Mesangiolysis

J

K

Glom. Sclerosis

Col Ⅳ P<0.05

P<0.01

P<0.01 6

4

2

10

% positive area

% glomeruli

% glomeruli

4

3

2

1

0

KO

WT

P<0.01

250 200 150 100 50 0 W T

KO

2

WT

M

ACR

4

KO

KO

Daily albuminuria urine albumin excretion (μg/day)

Albumin Creatinine Ratio (mg/g)

L

6

0

0

WT

8

P<0.01

80

60

40

20

0 W T

KO

Figure 2 A

B

Podocin

WT

WT-1

WT

KO

KO

P<0.01 P<0.01

15

8

% positive area

% positive area

10

6 4 2 0 WT

10

5

0

KO

WT

KO

C

D

E

F

G

H

I

J

Figure 3

P<0.05

6

4

2

0

% Podocyte area P<0.05

30

20

10

0

WT

J

KO

50

KO

WT

% Injured podocyte

K

P<0.01

FP effacement P<0.05

800

40

FP width (nm)

injured podocyte / total podocyte

H Pd area/glom area(%）

Pd nuclear number/10-3μm2

Podocyte number

30 20

600

400

200

10 0

0

WT

KO

WT

I Pd area/pd number ×10-6μm2

G

KO

Podocyte size 40

P<0.05 30

20

10

0

WT

KO

Figure 4 A

Nephrin

NT

Merge

C

Nitrotyrosine P<0.01 % positive area

15

WT

10

5

0

WT

D

KO

KO

8-OHdG P<0.01

B

Nephrin

8-OHdG

% positive area

15

Merge

10

5

0

WT

WT

E

Urine 8-OHdG

urinary8-OHdG (ng/d/10 gBW)

30

KO

KO

P<0.05

20

10

0

WT

Nephrin & iNOS WT

G KO

iNOS Positive cell /glom

F

KO

8

P<0.05

6

4

2

0

WT

KO

Figure 5 A

B KO KO

WT

D

P<0.05

6

4

2

P<0.01

60 40 20

0

0

F

KO

WT

G

Mt DNA

D-17 deletion (% WT)

4 3 2 1 0

WT

I Synpo

KO

WT-1

250

P<0.05

1.5

1.0 0.5

0

WT

KO

H

D-17 deletion

ns

5

Mt density

KO

ATP content

P<0.01

P<0.05

25

20

200

nM/g

WT

150

15

100

10

50

5

0

0

WT

KO

WT

KO

J Oligomycin FCCP Rotenon/Antimycin 200

***

150

DAPI

Merge

% OCR

cox2/UCP

E

Mt number

80

Mt number/pd

Mt mean area (X10-2μm2)

Mt size

Mt number/pd area (μm2)

C

* P<0.05

100

***

***

50

0

0

20

40

60 (min)

Figure 6

hGEC

NO2-/NO3-/protein (nM/μg)

B

A mPC

eNOS

GAPDH

0 .0 4

P<0.05

0 .0 3

0 .0 2

0 .0 1

0 .0 0

Control

L-NAME

C Mitotracker

Mitosox

ECM

P<0.01

P<0.05

E P<0.01

P<0.01 80

150

Mitosox signal intensity

% cells with mt fragmentation

D

ECM L-NAME NONOate

ECM L-NAME

60

P<0.01

P<0.01

100

40

20

0

50

0

control L-NAME L-NAME NONOate

control L-NAME L-NAME NONOate

Healthy Podocyte Normal Mitochondria

ATP

Injured Podocyte Mitochondrial abnormality

ATP

ROS

NO

ROS NO

eNOS

eNOS

Healthy Endothelium

Injured Endothelium