- Email: [email protected]
Cytokine Expression in Feline Osteoclastic Resorptive Lesions
J. Comp. Path. 2002, Vol. 127, 169±177 doi:10.1053/jcpa.2002.0577, available online at http://www.idealibrary.com on
Cytokine Expression in Feline Osteoclastic Resorptive Lesions A. DeLaurier, S. Allen*, C. deFlandre, M. A. Horton and J. S. Price* Bone and Mineral Centre, Rayne Institute, University College London, 5 University Street, London WC1E 6JJ and *The Royal Veterinary College, Royal College Street, London NW1 0TU, UK Summary Feline osteoclastic resorptive lesions (FORL) of the teeth are common in cats, and lead to pain, destruction of the periodontal ligament, and tooth loss. The expression of interleukin (IL)-1b and IL-6 mRNA was higher in teeth with FORL than in normal teeth (P , 001 and P , 0001, respectively), but no such differences were found between pathological and normal gingival tissue samples. There were no differences between teeth affected with FORL and normal teeth in respect of the expression of receptor activator of NFkB ligand (RANKL) mRNA or osteoprotegerin (OPG) mRNA. However, OPG mRNA expression was higher in gingival tissue associated with teeth affected with FORL than in normal gingival tissue (P , 005), whereas the reverse was true of RANKL mRNA expression (P , 005). OPG mRNA expression was significantly higher in teeth than in femoral and alveolar bone (P , 0001). RANKL and OPG mRNAs were detected in all tissues examined. The data suggest that the elevated expression of IL-lb and IL-6 mRNA plays a role in the mediation of osteoclast activity in advanced FORL. In contrast, OPG and RANKL do not appear to regulate osteoclasts in advanced disease. The results also suggest that OPG and RANKL mRNA play a role in mediating inflammatory responses in gingival cells, and that OPG has an inhibiting effect on tooth resorption.
# 2002 Elsevier Science Ltd. All rights reserved.
Introduction Feline osteoclastic resorptive lesions (FORL) of the tooth root are common in domestic cats and lead to pain, gingival inflammation, destruction of the periodontal attachment, and tooth loss (Lyon, 1992; Reiter, 1997). Lesions are not associated with carious activity, and the relationship between FORL and periodontal disease is unclear (Schneck and Osborn, 1976; Okuda and Harvey, 1992a; Harvey et al., 1994; Reiter, 1998). There is no parallel condition in other carnivores, but a similar, rare disease of unknown aetiology has been reported in man (George and Miller, 1986; Moody and Muir, 1991). The aetiological factors predisposing to FORL are unknown; however, diet, gender, biomechanical stress, and defects in tooth morphology are believed to play a role (Donaghue et al., 1994; Lund et al., 1998; Reiter, 1998; Burke et al., 2000). Histological studies of FORL have demonstrated the presence of large, 0021±9975/02/$ ± see front matter
multi-nucleated, tartrate-resistant acid phosphatase (TRAP)-positive osteoclasts on the external surface of the tooth root at early stages of resorption (Okuda and Harvey, 1992a). The osteoclast adhesion molecules osteopontin (OPN) and bone sialoprotein (BSP) have also been identified on the resorbing surfaces of teeth affected with FORL (Shigeyama et al., 1996). At advanced stages of disease, FORL are characterized by reduced resorbing activity, and the initiation of remodelling activity by osteoblasts (Holmstrom, 1992; Lyon, 1992; Okuda and Harvey, 1992a). To date, the factors that regulate resorption in the normal adult cat tooth microenvironment and in teeth affected with FORL remain unknown (Okuda and Harvey, 1992a). The present study explores the hypothesis that the development of FORL is associated with local changes in the expression of cytokines that increase the differentiation or activation of osteoclasts including interleukin (IL)-1b, IL-6, osteoprotegerin # 2002 Elsevier Science Ltd. All rights reserved.
170
A. DeLaurier et al.
(OPG) and receptor activator of NFkB ligand (RANKL). IL-1b and IL-6 stimulate the formation of osteoclasts from precursors and the activation of mature osteoclasts (Horowitz and Lorenzo, 1996; Roodman, 1999). In man, pathological resorption of teeth and alveolar bone due to periodontal disease is associated with the production of IL-1b and IL-6 by cells in the gingiva, gingival crevicular fluid, and periodontal ligament (Roberts et al., 1997; Rasmussen et al., 2000). RANKL and its decoy receptor OPG are novel regulators of osteoclast differentiation and activity in bone, and have also been shown to play a role in mediating osteoclast activity in teeth. RANKL is synthesized by osteoblasts and stromal cells, and binds to receptors (RANK) on pre-osteoclasts or osteoclasts, stimulating the differentiation of preosteoclasts and the activity and survival of mature cells (Lacey et al., 1998; Yasuda et al., 1998b; Burgess et al., 1999). OPG is produced by osteoblasts and stromal cells in a soluble form, and competes with RANK for RANKL, inhibiting differentiation of osteoclast precursors and impairing resorptive activity of mature osteoclasts (Yasuda et al., 1998a; Hofbauer et al., 2000). Both factors are expressed in developing murine dental follicle cells, and RANKL has been demonstrated to be required for murine tooth eruption (Kong et al., 1999; Rani and MacDougall, 2000). OPG mRNA has been identified in healthy gingival cells, periodontal ligament and pulp cells, and may play a role in regulating the resorption of dental hard tissues (Sakata et al., 1999). OPG and RANKL are expressed in human periodontal ligament affected with periodontitis, and are believed to be partly responsible for mediating resorption of teeth and alveolar bone (Liu et al., 2000; Rani and MacDougall, 2000). To date, RANKL and OPG mRNAs have not been described in the cat, and their role as potential mediators of tooth resorption in the absence of periodontal disease is unknown. The objectives of the present study were to compare, by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), the expression of IL-1b, IL-6, RANKL and OPG mRNAs in normal and FORL-affected teeth and gingival tissue and to define, for the first time, the mRNA expression of RANKL and OPG mRNAs in a range of feline tissues. Materials and Methods Tissue Collection Samples of muscle, spleen, lymph node, liver (n 3), intact femoral bone (n 3; including cortical bone,
cancellous bone and marrow), teeth (n 10; including enamel, cementum, dentine and periodontal ligament), associated gingival tissue (n 10) and alveolar bone (n 10) were dissected from 10 young adult cats with no evidence of oral disease. These cats had been humanely destroyed for ethical reasons unrelated to this research. Teeth affected with FORL (n 11), and associated gingival tissue (n 10), were collected from 11 cats undergoing clinical extraction of affected teeth. Gingival tissue could not be collected from one cat affected with FORL. The presence of FORL was diagnosed on the basis of visual examination, probing of the gingival sulcus surrounding the tooth, and radiography. The stage of disease was determined according to established clinical criteria (Lyon, 1992). All teeth affected with FORL were at an advanced stage of disease. The crown and roots were significantly resorbed, and the crowns were surrounded by inflamed gingiva. Gingival tissue associated with teeth affected with FORL was collected from the region of the tooth with evidence of resorption. It was not possible to obtain samples of alveolar bone surrounding teeth affected with FORL because the procedure for tooth extraction avoided any damage to the alveolus. All tissues were immediately snap-frozen in liquid nitrogen after collection, and stored frozen at ÿ80 C until used. Total RNA Extraction Samples (1±2 g) of soft tissue and bone (which included cancellous bone, marrow and cortical bone) were ground under liquid nitrogen with a mortar and pestle. Total RNA was extracted from 100±150 mg of tissue with TrizolTM (GibcoBRL, Paisley, UK) according to the manufacturer's instructions (1 ml Trizol/50±100 mg tissue). Whole frozen teeth (which included enamel, cementum, dentine and periodontal ligament) were mounted in a cryostat at ÿ20 C and cut with a tungsten-carbide knife into shavings (approximate 15 mm) that were placed directly in TrizolTM . This technique has been described for extracting RNA from frozen, undecalcified bone by Mason et al. (1996). Extracted mRNA was quantified with a DU 530 Life Science UV/VisTM spectrophotometer (Beckman, Fullerton, CA, USA) and ``visualized'' by electrophoresis on a 1% agarose gel to check for degradation and DNA contamination. cDNA Synthesis Random Primers (GibcoBRL) (5 ml) were annealed to 3 mg of total RNA at 65 C for 5 min. The following reagents were then added to the cDNA to give a final reaction volume of 60 ml: 6 ml of CDL-dithiothreitol
171
Cytokine Expression in FORL
(Promega, Madison, WI, USA), 3 ml of deoxynucleotide trisphosphates (dNTPs) (Promega), 2 ml of Molony Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega), 12 ml of M-MLV Reverse Transcriptase 5 reaction buffer (Promega), and dH20. cDNA was synthesized by incubation at 37 C for 1 h, followed by 75 C for 10 min to inactivate the M-MLV. cDNA samples were stored at ÿ80 C until use. RT-PCR Primers Oligonucleotide Primers for OPG and RANKL were designed from conserved regions of human and mouse homologues (see Table 1). Primers for IL-6 (Ohashi et al., 1993) and IL-lb (Daniel, Brenner, Legendre, Soloman and Rouse, 1992, unpublished) were designed from cDNA sequences for the domestic cat available online from GenBankTM . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were designed from published human cDNA sequences. Primers were synthesized by Amersham Pharmacia Biotech, UK.
and photographed on an ultraviolet transluminator (UVP, Upland, CA, USA). To ensure reproducibility of results, all RT-PCR reactions were repeated at least twice. DNA Sequencing RANKL and OPG cDNA fragments generated by PCR were purified with a StrataPrepTM PCR Purification kit (Stratagene, La Jolla, CA, USA), according to the manufacturer's instructions. DNA (5 ml) was ligated into pGEM-T EasyTM vector (Promega), and transfected into competent Escherichia coli (XL-1 Blue strain). Plasmids were prepared with the WizardTM Plus Mini-Preps DNA purification system, according to the manufacturer's instructions. Approximately 1 mg of plasmid was digested with Eco R1 (Promega) to excise the insert, and run on an agarose gel to verify insert size. Plasmids were sequenced with an ABI PrismTM automated DNA sequencer (Applied Biosystems, Foster City, CA, USA) with either a T7 or SP6 primer. Analysis
Polymerase Chain Reaction (PCR) Each PCR reaction mixture included the following: 5 ml of cDNA, 4 ml of dNTPs (Promega), 25 ml of each primer (20 mM), 02 ml of Taq Polymerase (Promega), 5 ml of Taq DNA Polymerase 10 reaction buffer (Promega) and 328 ml of dH2O. The optimal number of PCR cycles for each set of primers was established to ensure that the analysis was done on the linear phase of DNA amplification. Optimal PCR conditions were as follows: 94 C for 45 min, then 24 (GAPDH) or 35 (RANKL, OPG, IL-6, IL-1b) cycles including denaturation at 94 C for 1 min, annealing (Ta annealing temperature) for 15 min (Ta GAPDH, 55 C; RANKL, 50 C; OPG, 65 C; IL-6, 70 C; ILlb, 55 C), and extension at 72 C for 1 min, followed by a final extension period of 10 min at 72 C (DNA Thermal CyclerTM Perkin Elmer, Boston, MA, USA). Products were ``visualized'' by electrophoresis on 15% or 2% agarose gels stained with ethidium bromide,
Gels were digitally captured and band densities were quantified with gel-analysis software (LabWorksTM , UVP). Results were expressed as the ratio of the value for the product (RANKL, OPG, IL-lb or IL-6) to the GAPDH control value. To assess differences in mRNA expression between femur, alveolar bone, and teeth collected from normal cats, and between pathological and normal dental tissues, band ratios were compared by analysis of variance (ANOVA, Microsoft Excel 2000TM Microsoft, Redmond, WA, USA). Results Changes in mRNA Expression in Teeth and Gingival Tissue Affected with FORL Significantly higher levels of IL-lb and IL-6 mRNA expression (P , 001 and P , 0001, respectively) were detected in teeth affected with FORL than in control
Table 1 Primer sequences used for RT-PCR Factor
Primer A 5 0 ÿ
Primer B 5 0 ÿ
Product size
RANKL OPG IL-6 IL-1b GAPDH
AGACCTAGCTACAGAGTATC GACAGCTGGCACACCAGTGACG GCCTTCAGTCCACTCGCCTT AGTACCTGAACTCACCAGTG GGAAATCCCATCACCATCTTCCA
ACTGGCTGTAAATACGCGTG AGGCCCTTCAAGGTGTCTTGGTC CCTGCAGGCCAACTTCTACGG TAGTCCTGTGACTGTATGGC CATCACGCCACAGTTTCCCGGAG
449 bp 820 bp 500 bp 350 bp 375 bp
172
A. DeLaurier et al.
teeth (Figs 1a, b and c). No significant differences in IL-lb or IL-6 mRNA expression were detected between normal gingival tissue and gingival tissue associated with teeth affected with FORL (Figs 2a, b and c). Sequence analysis of PCR products showed feline RANKL to be 89% and feline OPG to be 88% identical with human DNA sequences over the regions amplified. RANKL and OPG mRNA expression was detected in teeth and gingival tissue (Figs 1a and 2a). However, normal teeth and those affected with FORL
Fig. 1a±e. IL-1b, IL-6, OPG and RANKL mRNA expression in teeth with FORL. (a) Agarose gel electrophoresis comparing teeth affected with FORL with control teeth in respect of IL-1b (350 bp), IL-6 (500 bp), OPG (820 bp) and RANKL (449 bp) mRNA expression. Lane 1, 100 bp ladder; lanes 2±5 teeth with FORL; lanes 6±9, control teeth; lane 10, positive control; lane 11, negative control. (b±e) Quantification of changes in mRNA expression in teeth with FORL (n 11) and control teeth (n 10). (b) Significantly higher (**P , 001) expression of IL-1b mRNA in teeth affected with FORL. (c) Significantly higher (**P , 0001) expression of IL-6 mRNA in teeth with FORL. (d) No significant change in OPG mRNA expression in teeth with FORL. (e) No significant change in RANKL mRNA expression in teeth with FORL. Bars represent the mean (SD) ratio of product to GAPDH control. Results were analysed by ANOVA.
did not differ significantly in respect of RANKL and OPG mRNA expression (Figs 1a, d and e). Significantly higher (P , 005) OPG mRNA expression was detected in gingival tissue associated with teeth affected with FORL than in gingival tissue associated with normal teeth. Significantly higher RANKL mRNA expression (P , 005) was detected
Fig. 2a±e. IL-1b, IL-6, OPG and RANKL mRNA expression in gingival tissue associated with teeth affected with FORL. (a) Agarose gel electrophoresis comparing gingival tissue associated with teeth affected with FORL with control gingival tissue in respect of IL-1b (350 bp), IL-6 (500 bp), OPG (820 bp), and RANKL (449 bp) mRNA expression. Lane 1, 100 bp ladder; lanes 2±5, gingival tissue associated with FORL; lanes 6±9, control gingival tissue; lane 10, positive control; lane 11, negative control. (b±e) Quantification of changes in mRNA expression in gingival tissue associated with teeth affected with FORL (n 10) and control gingival tissue (n 10). (b) No significant change in IL-1b mRNA expression as a result of FORL. (c) No significant change in IL-6 mRNA expression as a result of FORL. (d) Significantly higher (*P , 005) OPG mRNA expression in gingival tissue associated with teeth affected with FORL. (e) Significantly higher (*P , 005) RANKL mRNA expression in control gingival tissue. Bars represent the mean ( SD) ratio of product to GAPDH control. Results were analysed by ANOVA.
Cytokine Expression in FORL
173
in normal gingival tissue than in gingival tissue associated with teeth affected with FORL (Figs 2a, d and e). The identity of the lower band in the OPG gels is not known. Normal Tissue Distribution of RANKL and OPG mRNAs RANKL and OPG mRNAs were expressed in liver, spleen, lymph node, and muscle (Fig. 3); higher expression, however, was seen in spleen and lymph node than in liver and muscle (Fig. 3). OPG mRNA was expressed in both femoral and alveolar bone samples (Fig. 4a) but the levels of expression were significantly lower than in normal teeth (P , 0001) (Fig. 4b). In contrast, similar levels of RANKL mRNA expression were detected in teeth, alveolar bone and femur (Fig. 4c). IL-lb mRNA expression was low in alveolar bone and femur, and IL-6 mRNA expression was negligible or absent in these tissues (data not shown).
Fig. 3. OPG and RANKL mRNA expression in adult feline tissues. Agarose gel electrophoresis of PCR products. Lane 1, 100 bp ladder; lane 2, liver; lane 3, spleen; lane 4, lymph node; lane 5, muscle; lane 6, negative control.
Discussion This study demonstrated increased expression of ILlb and IL-6 mRNAs in teeth affected with FORL, suggesting that these cytokines act as local factors regulating osteoclast activity at advanced stages of disease. However, it is possible that these cytokines have no primary role in osteoclast activation but are instead associated with inflammatory changes in periodontal tissues associated with the disease. Our findings support a preliminary report describing immunolocalization of these cytokines in inflammatory cells and in TRAP-positive mononuclear and multinucleated cells of teeth with FORL as well as in gingival tissue associated with affected teeth (Okuda and Harvey, 1992b). IL-1b and IL-6 are potent stimulators of osteoclast differentiation and activity in vitro and in vivo, and may be expressed by many cell types in the bone microenvironment, including osteoblasts, osteoclasts, stromal cells, lymphocytes and macrophages (Horowitz and Lorenzo, 1996; Roodman, 1999). The role of IL-lb and IL-6 in stimulating osteoclast activity in tooth and bone resorption associated with human periodontal disease is well established (Rasmussen et al., 2000). IL-lb stimulates the expression of IL-6, and both IL-lb and IL-6 appear capable of mediating their effects by stimulating the ``downstream'' expression of other factors associated with osteoclast activation (Horowitz and Lorenzo, 1996; Roodman, 1999). For example, IL-lb mediates bone resorption by stimulating the ``upregulation'' of RANKL mRNA (Hofbauer et al., 1998, 1999). The results of this study, however, do not support a role for IL-lb and IL-6 in
Fig. 4a±c. OPG and RANKL mRNA expression in femoral and alveolar bone. (a) Agarose gel electrophoresis of PCR products. Lane 1, 100 bp ladder; lanes 2±4, femoral bone; lanes 5±7, alveolar bone; lane 8, positive control; lane 9, negative control. (b±c) Quantification of differences in OPG and RANKL mRNA expression in femoral bone (n 3), alveolar bone (n 3), and normal teeth (n 10). (b) OPG mRNA expression was significantly higher in teeth (**P , 0001). (c) No significant differences in RANKL mRNA expression detected.
mediating the expression of RANKL and OPG in teeth affected with FORL. IL-lb mRNA, but not IL-6 mRNA, expression was detected in normal alveolar and femoral bone. IL-1b
174
A. DeLaurier et al.
is expressed in healthy human bone (Ralston et al., 1994; Tao et al., 2000). Our findings were consistent with those of Vargas et al. (1996), who found IL-6 levels in normal mouse bone to be low or undetectable. Ralston et al. (1994) reported that, in human bone, IL-6 expression was variable. The expression of IL-lb and IL-6 mRNAs in alveolar bone associated with teeth affected with FORL could not be assessed in this study, as the surgical procedure used for tooth extraction avoided removal of alveolar bone. The potential role of RANKL and OPG in the pathogenesis of FORL was examined in this study, since it has recently been shown that these molecules play an important role in controlling osteoclast formation. There is also accumulating evidence that they regulate osteoclast activity in the tooth microenvironment. For example, there is a failure of tooth eruption in the RANKL ``knock out'' mouse, and RANKL synthesized by mesenchymal cells cultured from teeth stimulates osteoclast formation (Kong et al., 1999). Preliminary studies suggest that OPG produced by gingival, periodontal and pulp cells functions in a paracrine manner in the microenvironment of alveolar bone to block osteoclast differentiation (Sakata et al., 1999). In human periodontitis, RANKL is upregulated and OPG downregulated in periodontal tissues, suggesting that these factors mediate resorption in this disease (Liu et al., 2000). In the present study, RANKL and OPG mRNA expression did not appear to be altered in teeth with advanced FORL. One explanation is that the osteoclastogenic factors that play a role in FORL differ from the factors involved in stimulating resorption in human periodontal disease. Alternatively, the similarity between normal teeth and those with FORL in respect of mRNA expression of RANKL and OPG may be a reflection of the stage of disease; all teeth included in our study showed evidence of considerable resorption, and Okuda and Harvey (1992a) demonstrated histologically that osteoclast activity was decreased in advanced FORL. It is also possible that changes occur in the expression of RANKL and OPG in specific cell types associated with FORL, but that these cannot be detected with RT-PCR. Immunohistochemical studies are in progress with the aim of investigating RANKL and OPG expression at different stages of the disease. A further limitation of the RT-PCR method used in this study was that it was only semi-quantitative. PCR based on the detection of a fluorescent signal produced proportionally during the amplification of a PCR product would provide a more accurate quantification of mRNA expression. Under normal conditions mature teeth, unlike the rest of the skeleton, do not undergo extensive
resorption and remodelling by bone cells. Our finding of significantly higher expression of OPG mRNA in feline teeth than in alveolar bone and femur supports the hypothesis that OPG provides a mechanism for inhibiting resorption of mature dental tissues. Teeth, alveolar bone and femoral bone did not differ significantly in RANKL mRNA expression, providing further evidence that OPG may be a key factor in the RANKL/RANK pathway modulating osteoclast function in teeth. The role of the gingiva in modulating bone cell activity at the surface of the tooth has not been extensively described; however, research in human idiopathic cervical root resorption suggests that the gingiva plays a part in regulating the activity of osteoclast precursors at the tooth root surface (Moody and Muir, 1991). In FORL, the source of osteoclast precursors is not known, and the role of the cells of periodontal tissues and gingiva in mediating resorption is unclear. It was surprising that IL-lb and IL-6 mRNA expression was not elevated in gingival tissues, since it has been reported that the gingiva associated with teeth affected with FORL is inflamed (Okuda and Harvey, 1992a). In the cat, low expression of IL-6 has been reported in clinically healthy gingival tissue, and IL-6 mRNA is significantly upregulated in feline gingivostomatitis, a disease characterized by gingival inflammation due to oral infection (Harley et al., 1999). In man, low levels of IL-1b and IL-6 have been reported in normal, healthy gingival cells in vivo and in vitro, and increased expression is associated with oral bacterial infections (Hirose et al., 2001; Uchida et al., 2001). Interestingly, gingival tissue associated with teeth affected with FORL differed from normal tissues in expressing significantly more OPG mRNA. This suggests that gingiva adjacent to lesions inhibits osteoclastogenesis at the surface of the tooth in latestage disease, and plays a role in reparative processes in which new bone is formed by osteoblasts at the tooth root surface (Okuda and Harvey, 1992a). This is supported by evidence from studies of bone repair that show elevated OPG mRNA levels at sites of new bone formation, indicating that OPG has a role in inhibiting the resorption of reparative tissue (Kon et al., 2001). Normal feline gingival tissue differed from gingival tissue associated with teeth affected with FORL in expressing more RANKL mRNA. The role of RANKL in non-skeletal tissues has not been well defined. It has been suggested, however, that RANKL plays a role in cell activation and survival during normal tissue growth, development and metamorphosis; moreover, it plays an important role in T-cell proliferation and survival (Anderson et al., 1997;
Cytokine Expression in FORL
Kartsogiannis et al., 1999). In normal feline gingival tissue, RANKL may have a similar role in mediating the activity of cells in the oral environment which are involved in host defence or tissue turnover. Clearly the relationship between the progression of gingivitis and the development of tooth resorption requires further investigation. This study is the first to describe the expression of RANKL and OPG mRNAs in feline tissues, and shows that their pattern of expression is similar to that previously described in man and the mouse. In the cat, high RANKL and OPG mRNA levels were detected in lymph node and spleen, and low levels in muscle and liver; this accords with findings in murine and human studies (Anderson et al., 1997; Wong et al., 1997; Lacey et al., 1998; Yasuda et al., 1998b; Kartsogiannis et al., 1999). RANKL mRNA expression was found to be high in bone in the cat, as in other species (Yasuda et al., 1998b). In contrast, the expression of OPG mRNA in feline bone appeared to be lower than that described for bone of other species (Yasuda et al., 1998a); it should be borne in mind, however, that variations in OPG and RANKL expression in non-pathological bone have been reported (Kon et al., 2001). The significance of these tissue- and species-related differences in RANKL and OPG expression remains to be determined (Yasuda et al., 1998a). In conclusion, the results of this study suggest that elevated IL-1b and IL-6 mRNA expression in teeth plays a role in regulating osteoclast function or inflammation, or both, in advanced FORL. However, changes in RANKL and OPG mRNA expression do not appear to be associated with late-stage disease. Higher levels of OPG mRNA in normal teeth than in bone suggest that this factor plays an important role in inhibiting the resorption of adult feline teeth. For the first time, RANKL and OPG mRNA expression have been identified in a range of feline tissues and their distribution found to be similar to that described for other species. Acknowledgments The authors thank John Robinson and the Beaumont Animal Hospital for providing teeth and gingival tissue samples. M. A. Horton and J. S. Price acknowledge the support of The Wellcome Trust. References Anderson, D. M., Maraskovsky, E., Billingsley, W. L., Dougall, W. C., Tometsko, M. E., Roux, E. R., Teepe, M. C., DuBose, R. F., Cosman, D. and
175
Galibert, L. (1997). A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature, 390, 175±179. Burgess, T. L., Qian, Y., Kaufman, S., Ring, B. D., Van, G., Capparelli, C., Kelley, M., Hsu, H., Boyle, W. J., Dunstan, C. R., Hu, S. and Lacey, D. L. (1999). The ligand for osteoprotegerin (OPGL) directly activates mature osteoclasts. Journal of Cell Biology, 145, 527±538. Burke, F. J., Johnston, N., Wiggs, R. B. and Hall, A. F. (2000). An alternative hypothesis from veterinary science for the pathogenesis of noncarious cervical lesions. Quintessence International, 31, 475±482. Donaghue, S., Scarlett, J. M, Williams, C. A. and Saidla, J. (1994). Diet as a risk factor for feline odontoclastic resorption. Journal of Nutrition, 124, 2693S±2694S. George, D. L. Jr and Miller, R. L. (1986). Idiopathic resorption of teeth. A report of three cases. American Journal of Orthodontics, 89, 13±20. Harley, R., Helps, C. R., Harbour, D. A., Gruffydd-Jones, T. J. and Day, M. J. (1999). Cytokine mRNA expression in lesions in cats with chronic gingivostomatitis. Clinical Diagnostic Laboratory Immunology, 6, 471±478. Harvey, C. E., Hammond, B. F. and Whitaker, E. J. (1994). Is there an association between dental resorptive lesions and Actinobacillus actinomycetecomitans in cats? Proceedings of the World Veterinary Dental Congress, p. 48. Hirose, M., Ishihara, K., Saito, A., Nakagawa, T., Yamada, S. and Okuda, K. (2001). Expression of cytokines and inducible nitric oxide synthase in inflamed gingival tissue. Journal of Periodontology, 72, 590±597. Hofbauer, L. C., Dunstan, C. R., Spelsberg, T. C., Riggs, B. L. and Khosla, S. (1998). Osteoprotegerin production by human osteoblast lineage cells is stimulated by vitamin D, bone morphogenetic protein-2, and cytokines. Biochemical and Biophysical Research Communications, 250, 776±781. Hofbauer, L. C., Khosla, S., Dunstan, C. R., Lacey, D. L., Boyle, W. J. and Riggs, B. L. (2000). The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. Journal of Bone and Mineral Research, 15, 2±12. Hofbauer, L. C., Lacey, D. L., Dunstan, C. R., Spelsberg, T. C., Riggs, B. L. and Khosla, S. (1999). Interleukin-1 beta and tumor necrosis factor-alpha, but not interleukin-6, stimulate osteoprotegerin ligand gene expression in human osteoblastic cells. Bone, 25, 255±259. Holmstrom, S. E. (1992). External osteoclastic resorptive lesions. Feline Practice, 20, 7±11 Horowitz, M. C. and Lorenzo, J. A. (1996). Local regulators of bone: IL-1, TNF, lymphotoxin, interferon-g, IL-8, IL-10, IL-4, the LIF/IL-6 family and additional cytokines. In: Principles of Bone Biology, J. P. Bilezikian, L. G. Raisz and G. A. Rodan, Eds, Academic Press, London, pp. 687±700. Kartsogiannis, V., Zhou, H., Horwood, N. J., Thomas, R. J., Hards, D. K., Quinn, J. M., Niforas, P., Ng, K. W., Martin, T. J. and Gillespie, M. T. (1999). Localization of RANKL (receptor activator of NF kappa B ligand) mRNA and protein in skeletal and extraskeletal tissues. Bone, 25, 525±534.
176
A. DeLaurier et al.
Kon, T., Cho, T. J., Aizawa, T., Yamazaki, M., Nooh, N., Graves, D., Gerstenfeld, L. C. and Einhorn, T. A. (2001). Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerin ligand) and related proinflammatory cytokines during fracture healing. Journal of Bone and Mineral Research, 16, 1004±1014. Kong, Y. Y., Yoshida, H., Sarosi, I., Tan, H. L., Timms, E., Capparelli, C., Morony, S., Oliveira-dos-Santos, A. J., Van, G., Itie, A., Khoo, W., Wakeham, A., Dunstan, C. R., Lacey, D. L., Mak, T. W., Boyle, W. J. and Penninger, J. M. (1999). OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature, 397, 315±323. Lacey, D. L., Timms, E., Tan, H. L., Kelley, M. J., Dunstan, C. R., Burgess, T., Elliott, R., Colombero, A., Elliott, G., Scully, S., Hsu, H., Sullivan, J., Hawkins, N., Davy, E., Capparelli, C., Eli, A., Qian, Y. X., Kaufman, S., Sarosi, I., Shalhoub, V., Senaldi, G., Guo, J., Delaney, J. and Boyle, W. J. (1998). Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell, 93, 165±176. Liu, D., Xu, J. K., Huang, L., Pavlos, N., Price, T. and Zheng, M. H. (2000). Gene expression of ODF and OPG in periodontal disease: possible involvement of bone destruction. Bone, 27, (Suppl.), 45S. Lund, E. M., Bohacek, L. K., Dahlke, J. L., King, V. L., Kramek, B. A. and Logan, E. I. (1998). Prevalence and risk factors for odontoclastic resorptive lesions in cats. Journal of the American Veterinary Medical Association, 212, 392±395. Lyon, K. F. (1992). Subgingival odontoclastic resorptive lesions: classification, treatment, and results in 58 cats. Veterinary Clinics of North America: Small Animal Practice, 22, 1417±1432. Mason, D. J., Hillam, R. A. and Skerry, T. M. (1996). Constitutive in vivo mRNA expression by osteocytes of beta-actin, osteocalcin, connexin-43, IGF-I, c-fos and c-jun, but not TNF-alpha nor tartrate-resistant acid phosphatase. Journal of Bone and Mineral Research, 11, 350±357. Moody, G. H. and Muir, K. F. (1991). Multiple idiopathic root resorption. A case report and discussion of pathogenesis. Journal of Clinical Periodontology, 18, 577±580. Ohashi, T., Matsumoto, Y., Watari, T., Goitsuka, R., Tsujimoto, H. and Hasegawa, A. (1993). Molecular cloning of feline interleukin-6 cDNA. Journal of Veterinary Medical Science, 55, 941±944. Okuda, A. and Harvey, C. E. (1992a). Etiopathogenesis of feline dental resorptive lesions. Veterinary Clinics of North America: Small Animal Practice, 22, 1385±1404. Okuda, A. and Harvey, C. E. (1992b). Immunohistochemical distributions of interleukins as possible stimulators of odontoclastic resorption activity in feline dental resorptive lesions. In: Proceedings of the 6th Annual Veterinary Dental Forum, Las Vegas, Nevada, pp. 41±43. Ralston, S. H., Hoey, S. A., Gallacher, S. J., Adamson, B. B. and Boyle, I. T. (1994). Cytokine and growth factor expression in Paget's disease: analysis by reversetranscription/polymerase chain reaction. British Journal of Rheumatology, 33, 620±625. Rani, C. S. and MacDougall, M. (2000). Dental cells express factors that regulate bone resorption. Molecular Cell Biology Research Communications, 3, 145±152.
Rasmussen, L., Hanstrom, L. and Lerner, U. H. (2000). Characterization of bone resorbing activity in gingival crevicular fluid from patients with periodontitis. Journal of Clinical Periodontology, 27, 41±52. Reiter, A. M. (1997). Feline odontoclastic resorptive lesions (FORL): a review of literature. In: Proceedings of the 11th Annual Veterinary Dental Forum, Denver, Colorado, pp. 56±61. Reiter, A. M. (1998). Etiopathology of feline odontoclastic resorptive lesions (FORL). In: Proceedings of the 12th Annual Veterinary Dental Forum, New Orleans, Louisiana, pp. 228±234. Roberts, F. A., McCaffery, K. A. and Michalek, S. M. (1997). Profile of cytokine mRNA expression in chronic adult periodontitis. Journal of Dental Research, 76, 1833± 1839. Roodman, G. D. (1999). Cell biology of the osteoclast. Experimental Hematology, 27, 1229±1241. Sakata, M., Shiba, H., Komatsuzawa, H., Fujita, T., Ohta, K., Sugai, M., Suginaka, H. and Kurihara, H. (1999). Expression of osteoprotegerin (osteoclastogenesis inhibitory factor) in cultures of human dental mesenchymal cells and epithelial cells. Journal of Bone and Mineral Research, 14, 1486±1492. Schneck, G. W. and Osborn, J. W. (1976). Neck lesions in the teeth of cats. Veterinary Record, 99, 100. Shigeyama, Y., Grove, T. K., Strayhorn, C. and Somerman, M. J. (1996). Expression of adhesion molecules during tooth resorption in feline teeth: a model system for aggressive osteoclastic activity. Journal of Dental Research, 75, 1650±1657. Tao, M., Li, B., Nayini, J., Andrews, C. B., Huang, R. W., Devemy, E., Song, S., Venugopal, P. and Preisler, H. D. (2000). SCF, IL-1 beta, IL-lra and GM-CSF in the bone marrow and serum of normal individuals and of AML and CML patients. Cytokine, 12, 699±707. Uchida, Y., Shiba, H., Komatsuzawa, H., Takemoto, T., Sakata, M., Fujita, T., Kawaguchi, H., Sugai, M. and Kurihara, H. (2001). Expression of IL-1 beta and IL-8 by human gingival epithelial cells in response to Actinobacillus actinomycetemcomitans. Cytokine, 14, 152±161. Vargas, S. J., Naprta, A., Glaccum, M., Lee, S. K., Kalinowski, J. and Lorenzo, J. A. (1996). Interleukin-6 expression and histomorphometry of bones from mice deficient in receptors for interleukin-1 or tumor necrosis factor. Journal of Bone and Mineral Research, 11, 1736±1744. Wong, B. R., Rho, J., Arron, J., Robinson, E., Orlinick, J., Chao, M., Kalachikov, S., Cayani, E., Bartlett, F. S., III, Frankel, W. N., Lee, S. Y. and Choi, Y. (1997). TRANCE is a novel ligand of the tumor necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. Journal of Biological Chemistry, 272, 25190±25194. Yasuda, H., Shima, N., Nakagawa, N., Mochizuki, S. I., Yano, K., Fujise, N., Sato, Y., Goto, M., Yamaguchi, K., Kuriyama, M., Kanno, T., Murakami, A., Tsuda, E., Morinaga, T. and Higashio, K. (1998a). Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology, 139, 1329±1337.
Cytokine Expression in FORL
Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinosaki, M., Mochizuki, S., Tomoyasu, A., Yano, K., Goto, M., Murakami, A., Tsuda, E., Morinaga, T., Higashio, K., Udagawa, N., Takahashi, N. and Suda, T. (1998b). Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor
177
and is identical to TRANCE/RANKL. Proceedings of the National Academy of Sciences of the United States of America, 95, 3597±3602. Received; December 3rd; 2001 Accepted; April 30th; 2002
Cytokine Expression in Feline Osteoclastic Resorptive Lesions A. DeLaurier, S. Allen*, C. deFlandre, M. A. Horton and J. S. Price* Bone and Mineral Centre, Rayne Institute, University College London, 5 University Street, London WC1E 6JJ and *The Royal Veterinary College, Royal College Street, London NW1 0TU, UK Summary Feline osteoclastic resorptive lesions (FORL) of the teeth are common in cats, and lead to pain, destruction of the periodontal ligament, and tooth loss. The expression of interleukin (IL)-1b and IL-6 mRNA was higher in teeth with FORL than in normal teeth (P , 001 and P , 0001, respectively), but no such differences were found between pathological and normal gingival tissue samples. There were no differences between teeth affected with FORL and normal teeth in respect of the expression of receptor activator of NFkB ligand (RANKL) mRNA or osteoprotegerin (OPG) mRNA. However, OPG mRNA expression was higher in gingival tissue associated with teeth affected with FORL than in normal gingival tissue (P , 005), whereas the reverse was true of RANKL mRNA expression (P , 005). OPG mRNA expression was significantly higher in teeth than in femoral and alveolar bone (P , 0001). RANKL and OPG mRNAs were detected in all tissues examined. The data suggest that the elevated expression of IL-lb and IL-6 mRNA plays a role in the mediation of osteoclast activity in advanced FORL. In contrast, OPG and RANKL do not appear to regulate osteoclasts in advanced disease. The results also suggest that OPG and RANKL mRNA play a role in mediating inflammatory responses in gingival cells, and that OPG has an inhibiting effect on tooth resorption.
# 2002 Elsevier Science Ltd. All rights reserved.
Introduction Feline osteoclastic resorptive lesions (FORL) of the tooth root are common in domestic cats and lead to pain, gingival inflammation, destruction of the periodontal attachment, and tooth loss (Lyon, 1992; Reiter, 1997). Lesions are not associated with carious activity, and the relationship between FORL and periodontal disease is unclear (Schneck and Osborn, 1976; Okuda and Harvey, 1992a; Harvey et al., 1994; Reiter, 1998). There is no parallel condition in other carnivores, but a similar, rare disease of unknown aetiology has been reported in man (George and Miller, 1986; Moody and Muir, 1991). The aetiological factors predisposing to FORL are unknown; however, diet, gender, biomechanical stress, and defects in tooth morphology are believed to play a role (Donaghue et al., 1994; Lund et al., 1998; Reiter, 1998; Burke et al., 2000). Histological studies of FORL have demonstrated the presence of large, 0021±9975/02/$ ± see front matter
multi-nucleated, tartrate-resistant acid phosphatase (TRAP)-positive osteoclasts on the external surface of the tooth root at early stages of resorption (Okuda and Harvey, 1992a). The osteoclast adhesion molecules osteopontin (OPN) and bone sialoprotein (BSP) have also been identified on the resorbing surfaces of teeth affected with FORL (Shigeyama et al., 1996). At advanced stages of disease, FORL are characterized by reduced resorbing activity, and the initiation of remodelling activity by osteoblasts (Holmstrom, 1992; Lyon, 1992; Okuda and Harvey, 1992a). To date, the factors that regulate resorption in the normal adult cat tooth microenvironment and in teeth affected with FORL remain unknown (Okuda and Harvey, 1992a). The present study explores the hypothesis that the development of FORL is associated with local changes in the expression of cytokines that increase the differentiation or activation of osteoclasts including interleukin (IL)-1b, IL-6, osteoprotegerin # 2002 Elsevier Science Ltd. All rights reserved.
170
A. DeLaurier et al.
(OPG) and receptor activator of NFkB ligand (RANKL). IL-1b and IL-6 stimulate the formation of osteoclasts from precursors and the activation of mature osteoclasts (Horowitz and Lorenzo, 1996; Roodman, 1999). In man, pathological resorption of teeth and alveolar bone due to periodontal disease is associated with the production of IL-1b and IL-6 by cells in the gingiva, gingival crevicular fluid, and periodontal ligament (Roberts et al., 1997; Rasmussen et al., 2000). RANKL and its decoy receptor OPG are novel regulators of osteoclast differentiation and activity in bone, and have also been shown to play a role in mediating osteoclast activity in teeth. RANKL is synthesized by osteoblasts and stromal cells, and binds to receptors (RANK) on pre-osteoclasts or osteoclasts, stimulating the differentiation of preosteoclasts and the activity and survival of mature cells (Lacey et al., 1998; Yasuda et al., 1998b; Burgess et al., 1999). OPG is produced by osteoblasts and stromal cells in a soluble form, and competes with RANK for RANKL, inhibiting differentiation of osteoclast precursors and impairing resorptive activity of mature osteoclasts (Yasuda et al., 1998a; Hofbauer et al., 2000). Both factors are expressed in developing murine dental follicle cells, and RANKL has been demonstrated to be required for murine tooth eruption (Kong et al., 1999; Rani and MacDougall, 2000). OPG mRNA has been identified in healthy gingival cells, periodontal ligament and pulp cells, and may play a role in regulating the resorption of dental hard tissues (Sakata et al., 1999). OPG and RANKL are expressed in human periodontal ligament affected with periodontitis, and are believed to be partly responsible for mediating resorption of teeth and alveolar bone (Liu et al., 2000; Rani and MacDougall, 2000). To date, RANKL and OPG mRNAs have not been described in the cat, and their role as potential mediators of tooth resorption in the absence of periodontal disease is unknown. The objectives of the present study were to compare, by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), the expression of IL-1b, IL-6, RANKL and OPG mRNAs in normal and FORL-affected teeth and gingival tissue and to define, for the first time, the mRNA expression of RANKL and OPG mRNAs in a range of feline tissues. Materials and Methods Tissue Collection Samples of muscle, spleen, lymph node, liver (n 3), intact femoral bone (n 3; including cortical bone,
cancellous bone and marrow), teeth (n 10; including enamel, cementum, dentine and periodontal ligament), associated gingival tissue (n 10) and alveolar bone (n 10) were dissected from 10 young adult cats with no evidence of oral disease. These cats had been humanely destroyed for ethical reasons unrelated to this research. Teeth affected with FORL (n 11), and associated gingival tissue (n 10), were collected from 11 cats undergoing clinical extraction of affected teeth. Gingival tissue could not be collected from one cat affected with FORL. The presence of FORL was diagnosed on the basis of visual examination, probing of the gingival sulcus surrounding the tooth, and radiography. The stage of disease was determined according to established clinical criteria (Lyon, 1992). All teeth affected with FORL were at an advanced stage of disease. The crown and roots were significantly resorbed, and the crowns were surrounded by inflamed gingiva. Gingival tissue associated with teeth affected with FORL was collected from the region of the tooth with evidence of resorption. It was not possible to obtain samples of alveolar bone surrounding teeth affected with FORL because the procedure for tooth extraction avoided any damage to the alveolus. All tissues were immediately snap-frozen in liquid nitrogen after collection, and stored frozen at ÿ80 C until used. Total RNA Extraction Samples (1±2 g) of soft tissue and bone (which included cancellous bone, marrow and cortical bone) were ground under liquid nitrogen with a mortar and pestle. Total RNA was extracted from 100±150 mg of tissue with TrizolTM (GibcoBRL, Paisley, UK) according to the manufacturer's instructions (1 ml Trizol/50±100 mg tissue). Whole frozen teeth (which included enamel, cementum, dentine and periodontal ligament) were mounted in a cryostat at ÿ20 C and cut with a tungsten-carbide knife into shavings (approximate 15 mm) that were placed directly in TrizolTM . This technique has been described for extracting RNA from frozen, undecalcified bone by Mason et al. (1996). Extracted mRNA was quantified with a DU 530 Life Science UV/VisTM spectrophotometer (Beckman, Fullerton, CA, USA) and ``visualized'' by electrophoresis on a 1% agarose gel to check for degradation and DNA contamination. cDNA Synthesis Random Primers (GibcoBRL) (5 ml) were annealed to 3 mg of total RNA at 65 C for 5 min. The following reagents were then added to the cDNA to give a final reaction volume of 60 ml: 6 ml of CDL-dithiothreitol
171
Cytokine Expression in FORL
(Promega, Madison, WI, USA), 3 ml of deoxynucleotide trisphosphates (dNTPs) (Promega), 2 ml of Molony Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega), 12 ml of M-MLV Reverse Transcriptase 5 reaction buffer (Promega), and dH20. cDNA was synthesized by incubation at 37 C for 1 h, followed by 75 C for 10 min to inactivate the M-MLV. cDNA samples were stored at ÿ80 C until use. RT-PCR Primers Oligonucleotide Primers for OPG and RANKL were designed from conserved regions of human and mouse homologues (see Table 1). Primers for IL-6 (Ohashi et al., 1993) and IL-lb (Daniel, Brenner, Legendre, Soloman and Rouse, 1992, unpublished) were designed from cDNA sequences for the domestic cat available online from GenBankTM . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were designed from published human cDNA sequences. Primers were synthesized by Amersham Pharmacia Biotech, UK.
and photographed on an ultraviolet transluminator (UVP, Upland, CA, USA). To ensure reproducibility of results, all RT-PCR reactions were repeated at least twice. DNA Sequencing RANKL and OPG cDNA fragments generated by PCR were purified with a StrataPrepTM PCR Purification kit (Stratagene, La Jolla, CA, USA), according to the manufacturer's instructions. DNA (5 ml) was ligated into pGEM-T EasyTM vector (Promega), and transfected into competent Escherichia coli (XL-1 Blue strain). Plasmids were prepared with the WizardTM Plus Mini-Preps DNA purification system, according to the manufacturer's instructions. Approximately 1 mg of plasmid was digested with Eco R1 (Promega) to excise the insert, and run on an agarose gel to verify insert size. Plasmids were sequenced with an ABI PrismTM automated DNA sequencer (Applied Biosystems, Foster City, CA, USA) with either a T7 or SP6 primer. Analysis
Polymerase Chain Reaction (PCR) Each PCR reaction mixture included the following: 5 ml of cDNA, 4 ml of dNTPs (Promega), 25 ml of each primer (20 mM), 02 ml of Taq Polymerase (Promega), 5 ml of Taq DNA Polymerase 10 reaction buffer (Promega) and 328 ml of dH2O. The optimal number of PCR cycles for each set of primers was established to ensure that the analysis was done on the linear phase of DNA amplification. Optimal PCR conditions were as follows: 94 C for 45 min, then 24 (GAPDH) or 35 (RANKL, OPG, IL-6, IL-1b) cycles including denaturation at 94 C for 1 min, annealing (Ta annealing temperature) for 15 min (Ta GAPDH, 55 C; RANKL, 50 C; OPG, 65 C; IL-6, 70 C; ILlb, 55 C), and extension at 72 C for 1 min, followed by a final extension period of 10 min at 72 C (DNA Thermal CyclerTM Perkin Elmer, Boston, MA, USA). Products were ``visualized'' by electrophoresis on 15% or 2% agarose gels stained with ethidium bromide,
Gels were digitally captured and band densities were quantified with gel-analysis software (LabWorksTM , UVP). Results were expressed as the ratio of the value for the product (RANKL, OPG, IL-lb or IL-6) to the GAPDH control value. To assess differences in mRNA expression between femur, alveolar bone, and teeth collected from normal cats, and between pathological and normal dental tissues, band ratios were compared by analysis of variance (ANOVA, Microsoft Excel 2000TM Microsoft, Redmond, WA, USA). Results Changes in mRNA Expression in Teeth and Gingival Tissue Affected with FORL Significantly higher levels of IL-lb and IL-6 mRNA expression (P , 001 and P , 0001, respectively) were detected in teeth affected with FORL than in control
Table 1 Primer sequences used for RT-PCR Factor
Primer A 5 0 ÿ
Primer B 5 0 ÿ
Product size
RANKL OPG IL-6 IL-1b GAPDH
AGACCTAGCTACAGAGTATC GACAGCTGGCACACCAGTGACG GCCTTCAGTCCACTCGCCTT AGTACCTGAACTCACCAGTG GGAAATCCCATCACCATCTTCCA
ACTGGCTGTAAATACGCGTG AGGCCCTTCAAGGTGTCTTGGTC CCTGCAGGCCAACTTCTACGG TAGTCCTGTGACTGTATGGC CATCACGCCACAGTTTCCCGGAG
449 bp 820 bp 500 bp 350 bp 375 bp
172
A. DeLaurier et al.
teeth (Figs 1a, b and c). No significant differences in IL-lb or IL-6 mRNA expression were detected between normal gingival tissue and gingival tissue associated with teeth affected with FORL (Figs 2a, b and c). Sequence analysis of PCR products showed feline RANKL to be 89% and feline OPG to be 88% identical with human DNA sequences over the regions amplified. RANKL and OPG mRNA expression was detected in teeth and gingival tissue (Figs 1a and 2a). However, normal teeth and those affected with FORL
Fig. 1a±e. IL-1b, IL-6, OPG and RANKL mRNA expression in teeth with FORL. (a) Agarose gel electrophoresis comparing teeth affected with FORL with control teeth in respect of IL-1b (350 bp), IL-6 (500 bp), OPG (820 bp) and RANKL (449 bp) mRNA expression. Lane 1, 100 bp ladder; lanes 2±5 teeth with FORL; lanes 6±9, control teeth; lane 10, positive control; lane 11, negative control. (b±e) Quantification of changes in mRNA expression in teeth with FORL (n 11) and control teeth (n 10). (b) Significantly higher (**P , 001) expression of IL-1b mRNA in teeth affected with FORL. (c) Significantly higher (**P , 0001) expression of IL-6 mRNA in teeth with FORL. (d) No significant change in OPG mRNA expression in teeth with FORL. (e) No significant change in RANKL mRNA expression in teeth with FORL. Bars represent the mean (SD) ratio of product to GAPDH control. Results were analysed by ANOVA.
did not differ significantly in respect of RANKL and OPG mRNA expression (Figs 1a, d and e). Significantly higher (P , 005) OPG mRNA expression was detected in gingival tissue associated with teeth affected with FORL than in gingival tissue associated with normal teeth. Significantly higher RANKL mRNA expression (P , 005) was detected
Fig. 2a±e. IL-1b, IL-6, OPG and RANKL mRNA expression in gingival tissue associated with teeth affected with FORL. (a) Agarose gel electrophoresis comparing gingival tissue associated with teeth affected with FORL with control gingival tissue in respect of IL-1b (350 bp), IL-6 (500 bp), OPG (820 bp), and RANKL (449 bp) mRNA expression. Lane 1, 100 bp ladder; lanes 2±5, gingival tissue associated with FORL; lanes 6±9, control gingival tissue; lane 10, positive control; lane 11, negative control. (b±e) Quantification of changes in mRNA expression in gingival tissue associated with teeth affected with FORL (n 10) and control gingival tissue (n 10). (b) No significant change in IL-1b mRNA expression as a result of FORL. (c) No significant change in IL-6 mRNA expression as a result of FORL. (d) Significantly higher (*P , 005) OPG mRNA expression in gingival tissue associated with teeth affected with FORL. (e) Significantly higher (*P , 005) RANKL mRNA expression in control gingival tissue. Bars represent the mean ( SD) ratio of product to GAPDH control. Results were analysed by ANOVA.
Cytokine Expression in FORL
173
in normal gingival tissue than in gingival tissue associated with teeth affected with FORL (Figs 2a, d and e). The identity of the lower band in the OPG gels is not known. Normal Tissue Distribution of RANKL and OPG mRNAs RANKL and OPG mRNAs were expressed in liver, spleen, lymph node, and muscle (Fig. 3); higher expression, however, was seen in spleen and lymph node than in liver and muscle (Fig. 3). OPG mRNA was expressed in both femoral and alveolar bone samples (Fig. 4a) but the levels of expression were significantly lower than in normal teeth (P , 0001) (Fig. 4b). In contrast, similar levels of RANKL mRNA expression were detected in teeth, alveolar bone and femur (Fig. 4c). IL-lb mRNA expression was low in alveolar bone and femur, and IL-6 mRNA expression was negligible or absent in these tissues (data not shown).
Fig. 3. OPG and RANKL mRNA expression in adult feline tissues. Agarose gel electrophoresis of PCR products. Lane 1, 100 bp ladder; lane 2, liver; lane 3, spleen; lane 4, lymph node; lane 5, muscle; lane 6, negative control.
Discussion This study demonstrated increased expression of ILlb and IL-6 mRNAs in teeth affected with FORL, suggesting that these cytokines act as local factors regulating osteoclast activity at advanced stages of disease. However, it is possible that these cytokines have no primary role in osteoclast activation but are instead associated with inflammatory changes in periodontal tissues associated with the disease. Our findings support a preliminary report describing immunolocalization of these cytokines in inflammatory cells and in TRAP-positive mononuclear and multinucleated cells of teeth with FORL as well as in gingival tissue associated with affected teeth (Okuda and Harvey, 1992b). IL-1b and IL-6 are potent stimulators of osteoclast differentiation and activity in vitro and in vivo, and may be expressed by many cell types in the bone microenvironment, including osteoblasts, osteoclasts, stromal cells, lymphocytes and macrophages (Horowitz and Lorenzo, 1996; Roodman, 1999). The role of IL-lb and IL-6 in stimulating osteoclast activity in tooth and bone resorption associated with human periodontal disease is well established (Rasmussen et al., 2000). IL-lb stimulates the expression of IL-6, and both IL-lb and IL-6 appear capable of mediating their effects by stimulating the ``downstream'' expression of other factors associated with osteoclast activation (Horowitz and Lorenzo, 1996; Roodman, 1999). For example, IL-lb mediates bone resorption by stimulating the ``upregulation'' of RANKL mRNA (Hofbauer et al., 1998, 1999). The results of this study, however, do not support a role for IL-lb and IL-6 in
Fig. 4a±c. OPG and RANKL mRNA expression in femoral and alveolar bone. (a) Agarose gel electrophoresis of PCR products. Lane 1, 100 bp ladder; lanes 2±4, femoral bone; lanes 5±7, alveolar bone; lane 8, positive control; lane 9, negative control. (b±c) Quantification of differences in OPG and RANKL mRNA expression in femoral bone (n 3), alveolar bone (n 3), and normal teeth (n 10). (b) OPG mRNA expression was significantly higher in teeth (**P , 0001). (c) No significant differences in RANKL mRNA expression detected.
mediating the expression of RANKL and OPG in teeth affected with FORL. IL-lb mRNA, but not IL-6 mRNA, expression was detected in normal alveolar and femoral bone. IL-1b
174
A. DeLaurier et al.
is expressed in healthy human bone (Ralston et al., 1994; Tao et al., 2000). Our findings were consistent with those of Vargas et al. (1996), who found IL-6 levels in normal mouse bone to be low or undetectable. Ralston et al. (1994) reported that, in human bone, IL-6 expression was variable. The expression of IL-lb and IL-6 mRNAs in alveolar bone associated with teeth affected with FORL could not be assessed in this study, as the surgical procedure used for tooth extraction avoided removal of alveolar bone. The potential role of RANKL and OPG in the pathogenesis of FORL was examined in this study, since it has recently been shown that these molecules play an important role in controlling osteoclast formation. There is also accumulating evidence that they regulate osteoclast activity in the tooth microenvironment. For example, there is a failure of tooth eruption in the RANKL ``knock out'' mouse, and RANKL synthesized by mesenchymal cells cultured from teeth stimulates osteoclast formation (Kong et al., 1999). Preliminary studies suggest that OPG produced by gingival, periodontal and pulp cells functions in a paracrine manner in the microenvironment of alveolar bone to block osteoclast differentiation (Sakata et al., 1999). In human periodontitis, RANKL is upregulated and OPG downregulated in periodontal tissues, suggesting that these factors mediate resorption in this disease (Liu et al., 2000). In the present study, RANKL and OPG mRNA expression did not appear to be altered in teeth with advanced FORL. One explanation is that the osteoclastogenic factors that play a role in FORL differ from the factors involved in stimulating resorption in human periodontal disease. Alternatively, the similarity between normal teeth and those with FORL in respect of mRNA expression of RANKL and OPG may be a reflection of the stage of disease; all teeth included in our study showed evidence of considerable resorption, and Okuda and Harvey (1992a) demonstrated histologically that osteoclast activity was decreased in advanced FORL. It is also possible that changes occur in the expression of RANKL and OPG in specific cell types associated with FORL, but that these cannot be detected with RT-PCR. Immunohistochemical studies are in progress with the aim of investigating RANKL and OPG expression at different stages of the disease. A further limitation of the RT-PCR method used in this study was that it was only semi-quantitative. PCR based on the detection of a fluorescent signal produced proportionally during the amplification of a PCR product would provide a more accurate quantification of mRNA expression. Under normal conditions mature teeth, unlike the rest of the skeleton, do not undergo extensive
resorption and remodelling by bone cells. Our finding of significantly higher expression of OPG mRNA in feline teeth than in alveolar bone and femur supports the hypothesis that OPG provides a mechanism for inhibiting resorption of mature dental tissues. Teeth, alveolar bone and femoral bone did not differ significantly in RANKL mRNA expression, providing further evidence that OPG may be a key factor in the RANKL/RANK pathway modulating osteoclast function in teeth. The role of the gingiva in modulating bone cell activity at the surface of the tooth has not been extensively described; however, research in human idiopathic cervical root resorption suggests that the gingiva plays a part in regulating the activity of osteoclast precursors at the tooth root surface (Moody and Muir, 1991). In FORL, the source of osteoclast precursors is not known, and the role of the cells of periodontal tissues and gingiva in mediating resorption is unclear. It was surprising that IL-lb and IL-6 mRNA expression was not elevated in gingival tissues, since it has been reported that the gingiva associated with teeth affected with FORL is inflamed (Okuda and Harvey, 1992a). In the cat, low expression of IL-6 has been reported in clinically healthy gingival tissue, and IL-6 mRNA is significantly upregulated in feline gingivostomatitis, a disease characterized by gingival inflammation due to oral infection (Harley et al., 1999). In man, low levels of IL-1b and IL-6 have been reported in normal, healthy gingival cells in vivo and in vitro, and increased expression is associated with oral bacterial infections (Hirose et al., 2001; Uchida et al., 2001). Interestingly, gingival tissue associated with teeth affected with FORL differed from normal tissues in expressing significantly more OPG mRNA. This suggests that gingiva adjacent to lesions inhibits osteoclastogenesis at the surface of the tooth in latestage disease, and plays a role in reparative processes in which new bone is formed by osteoblasts at the tooth root surface (Okuda and Harvey, 1992a). This is supported by evidence from studies of bone repair that show elevated OPG mRNA levels at sites of new bone formation, indicating that OPG has a role in inhibiting the resorption of reparative tissue (Kon et al., 2001). Normal feline gingival tissue differed from gingival tissue associated with teeth affected with FORL in expressing more RANKL mRNA. The role of RANKL in non-skeletal tissues has not been well defined. It has been suggested, however, that RANKL plays a role in cell activation and survival during normal tissue growth, development and metamorphosis; moreover, it plays an important role in T-cell proliferation and survival (Anderson et al., 1997;
Cytokine Expression in FORL
Kartsogiannis et al., 1999). In normal feline gingival tissue, RANKL may have a similar role in mediating the activity of cells in the oral environment which are involved in host defence or tissue turnover. Clearly the relationship between the progression of gingivitis and the development of tooth resorption requires further investigation. This study is the first to describe the expression of RANKL and OPG mRNAs in feline tissues, and shows that their pattern of expression is similar to that previously described in man and the mouse. In the cat, high RANKL and OPG mRNA levels were detected in lymph node and spleen, and low levels in muscle and liver; this accords with findings in murine and human studies (Anderson et al., 1997; Wong et al., 1997; Lacey et al., 1998; Yasuda et al., 1998b; Kartsogiannis et al., 1999). RANKL mRNA expression was found to be high in bone in the cat, as in other species (Yasuda et al., 1998b). In contrast, the expression of OPG mRNA in feline bone appeared to be lower than that described for bone of other species (Yasuda et al., 1998a); it should be borne in mind, however, that variations in OPG and RANKL expression in non-pathological bone have been reported (Kon et al., 2001). The significance of these tissue- and species-related differences in RANKL and OPG expression remains to be determined (Yasuda et al., 1998a). In conclusion, the results of this study suggest that elevated IL-1b and IL-6 mRNA expression in teeth plays a role in regulating osteoclast function or inflammation, or both, in advanced FORL. However, changes in RANKL and OPG mRNA expression do not appear to be associated with late-stage disease. Higher levels of OPG mRNA in normal teeth than in bone suggest that this factor plays an important role in inhibiting the resorption of adult feline teeth. For the first time, RANKL and OPG mRNA expression have been identified in a range of feline tissues and their distribution found to be similar to that described for other species. Acknowledgments The authors thank John Robinson and the Beaumont Animal Hospital for providing teeth and gingival tissue samples. M. A. Horton and J. S. Price acknowledge the support of The Wellcome Trust. References Anderson, D. M., Maraskovsky, E., Billingsley, W. L., Dougall, W. C., Tometsko, M. E., Roux, E. R., Teepe, M. C., DuBose, R. F., Cosman, D. and
175
Galibert, L. (1997). A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature, 390, 175±179. Burgess, T. L., Qian, Y., Kaufman, S., Ring, B. D., Van, G., Capparelli, C., Kelley, M., Hsu, H., Boyle, W. J., Dunstan, C. R., Hu, S. and Lacey, D. L. (1999). The ligand for osteoprotegerin (OPGL) directly activates mature osteoclasts. Journal of Cell Biology, 145, 527±538. Burke, F. J., Johnston, N., Wiggs, R. B. and Hall, A. F. (2000). An alternative hypothesis from veterinary science for the pathogenesis of noncarious cervical lesions. Quintessence International, 31, 475±482. Donaghue, S., Scarlett, J. M, Williams, C. A. and Saidla, J. (1994). Diet as a risk factor for feline odontoclastic resorption. Journal of Nutrition, 124, 2693S±2694S. George, D. L. Jr and Miller, R. L. (1986). Idiopathic resorption of teeth. A report of three cases. American Journal of Orthodontics, 89, 13±20. Harley, R., Helps, C. R., Harbour, D. A., Gruffydd-Jones, T. J. and Day, M. J. (1999). Cytokine mRNA expression in lesions in cats with chronic gingivostomatitis. Clinical Diagnostic Laboratory Immunology, 6, 471±478. Harvey, C. E., Hammond, B. F. and Whitaker, E. J. (1994). Is there an association between dental resorptive lesions and Actinobacillus actinomycetecomitans in cats? Proceedings of the World Veterinary Dental Congress, p. 48. Hirose, M., Ishihara, K., Saito, A., Nakagawa, T., Yamada, S. and Okuda, K. (2001). Expression of cytokines and inducible nitric oxide synthase in inflamed gingival tissue. Journal of Periodontology, 72, 590±597. Hofbauer, L. C., Dunstan, C. R., Spelsberg, T. C., Riggs, B. L. and Khosla, S. (1998). Osteoprotegerin production by human osteoblast lineage cells is stimulated by vitamin D, bone morphogenetic protein-2, and cytokines. Biochemical and Biophysical Research Communications, 250, 776±781. Hofbauer, L. C., Khosla, S., Dunstan, C. R., Lacey, D. L., Boyle, W. J. and Riggs, B. L. (2000). The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. Journal of Bone and Mineral Research, 15, 2±12. Hofbauer, L. C., Lacey, D. L., Dunstan, C. R., Spelsberg, T. C., Riggs, B. L. and Khosla, S. (1999). Interleukin-1 beta and tumor necrosis factor-alpha, but not interleukin-6, stimulate osteoprotegerin ligand gene expression in human osteoblastic cells. Bone, 25, 255±259. Holmstrom, S. E. (1992). External osteoclastic resorptive lesions. Feline Practice, 20, 7±11 Horowitz, M. C. and Lorenzo, J. A. (1996). Local regulators of bone: IL-1, TNF, lymphotoxin, interferon-g, IL-8, IL-10, IL-4, the LIF/IL-6 family and additional cytokines. In: Principles of Bone Biology, J. P. Bilezikian, L. G. Raisz and G. A. Rodan, Eds, Academic Press, London, pp. 687±700. Kartsogiannis, V., Zhou, H., Horwood, N. J., Thomas, R. J., Hards, D. K., Quinn, J. M., Niforas, P., Ng, K. W., Martin, T. J. and Gillespie, M. T. (1999). Localization of RANKL (receptor activator of NF kappa B ligand) mRNA and protein in skeletal and extraskeletal tissues. Bone, 25, 525±534.
176
A. DeLaurier et al.
Kon, T., Cho, T. J., Aizawa, T., Yamazaki, M., Nooh, N., Graves, D., Gerstenfeld, L. C. and Einhorn, T. A. (2001). Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerin ligand) and related proinflammatory cytokines during fracture healing. Journal of Bone and Mineral Research, 16, 1004±1014. Kong, Y. Y., Yoshida, H., Sarosi, I., Tan, H. L., Timms, E., Capparelli, C., Morony, S., Oliveira-dos-Santos, A. J., Van, G., Itie, A., Khoo, W., Wakeham, A., Dunstan, C. R., Lacey, D. L., Mak, T. W., Boyle, W. J. and Penninger, J. M. (1999). OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature, 397, 315±323. Lacey, D. L., Timms, E., Tan, H. L., Kelley, M. J., Dunstan, C. R., Burgess, T., Elliott, R., Colombero, A., Elliott, G., Scully, S., Hsu, H., Sullivan, J., Hawkins, N., Davy, E., Capparelli, C., Eli, A., Qian, Y. X., Kaufman, S., Sarosi, I., Shalhoub, V., Senaldi, G., Guo, J., Delaney, J. and Boyle, W. J. (1998). Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell, 93, 165±176. Liu, D., Xu, J. K., Huang, L., Pavlos, N., Price, T. and Zheng, M. H. (2000). Gene expression of ODF and OPG in periodontal disease: possible involvement of bone destruction. Bone, 27, (Suppl.), 45S. Lund, E. M., Bohacek, L. K., Dahlke, J. L., King, V. L., Kramek, B. A. and Logan, E. I. (1998). Prevalence and risk factors for odontoclastic resorptive lesions in cats. Journal of the American Veterinary Medical Association, 212, 392±395. Lyon, K. F. (1992). Subgingival odontoclastic resorptive lesions: classification, treatment, and results in 58 cats. Veterinary Clinics of North America: Small Animal Practice, 22, 1417±1432. Mason, D. J., Hillam, R. A. and Skerry, T. M. (1996). Constitutive in vivo mRNA expression by osteocytes of beta-actin, osteocalcin, connexin-43, IGF-I, c-fos and c-jun, but not TNF-alpha nor tartrate-resistant acid phosphatase. Journal of Bone and Mineral Research, 11, 350±357. Moody, G. H. and Muir, K. F. (1991). Multiple idiopathic root resorption. A case report and discussion of pathogenesis. Journal of Clinical Periodontology, 18, 577±580. Ohashi, T., Matsumoto, Y., Watari, T., Goitsuka, R., Tsujimoto, H. and Hasegawa, A. (1993). Molecular cloning of feline interleukin-6 cDNA. Journal of Veterinary Medical Science, 55, 941±944. Okuda, A. and Harvey, C. E. (1992a). Etiopathogenesis of feline dental resorptive lesions. Veterinary Clinics of North America: Small Animal Practice, 22, 1385±1404. Okuda, A. and Harvey, C. E. (1992b). Immunohistochemical distributions of interleukins as possible stimulators of odontoclastic resorption activity in feline dental resorptive lesions. In: Proceedings of the 6th Annual Veterinary Dental Forum, Las Vegas, Nevada, pp. 41±43. Ralston, S. H., Hoey, S. A., Gallacher, S. J., Adamson, B. B. and Boyle, I. T. (1994). Cytokine and growth factor expression in Paget's disease: analysis by reversetranscription/polymerase chain reaction. British Journal of Rheumatology, 33, 620±625. Rani, C. S. and MacDougall, M. (2000). Dental cells express factors that regulate bone resorption. Molecular Cell Biology Research Communications, 3, 145±152.
Rasmussen, L., Hanstrom, L. and Lerner, U. H. (2000). Characterization of bone resorbing activity in gingival crevicular fluid from patients with periodontitis. Journal of Clinical Periodontology, 27, 41±52. Reiter, A. M. (1997). Feline odontoclastic resorptive lesions (FORL): a review of literature. In: Proceedings of the 11th Annual Veterinary Dental Forum, Denver, Colorado, pp. 56±61. Reiter, A. M. (1998). Etiopathology of feline odontoclastic resorptive lesions (FORL). In: Proceedings of the 12th Annual Veterinary Dental Forum, New Orleans, Louisiana, pp. 228±234. Roberts, F. A., McCaffery, K. A. and Michalek, S. M. (1997). Profile of cytokine mRNA expression in chronic adult periodontitis. Journal of Dental Research, 76, 1833± 1839. Roodman, G. D. (1999). Cell biology of the osteoclast. Experimental Hematology, 27, 1229±1241. Sakata, M., Shiba, H., Komatsuzawa, H., Fujita, T., Ohta, K., Sugai, M., Suginaka, H. and Kurihara, H. (1999). Expression of osteoprotegerin (osteoclastogenesis inhibitory factor) in cultures of human dental mesenchymal cells and epithelial cells. Journal of Bone and Mineral Research, 14, 1486±1492. Schneck, G. W. and Osborn, J. W. (1976). Neck lesions in the teeth of cats. Veterinary Record, 99, 100. Shigeyama, Y., Grove, T. K., Strayhorn, C. and Somerman, M. J. (1996). Expression of adhesion molecules during tooth resorption in feline teeth: a model system for aggressive osteoclastic activity. Journal of Dental Research, 75, 1650±1657. Tao, M., Li, B., Nayini, J., Andrews, C. B., Huang, R. W., Devemy, E., Song, S., Venugopal, P. and Preisler, H. D. (2000). SCF, IL-1 beta, IL-lra and GM-CSF in the bone marrow and serum of normal individuals and of AML and CML patients. Cytokine, 12, 699±707. Uchida, Y., Shiba, H., Komatsuzawa, H., Takemoto, T., Sakata, M., Fujita, T., Kawaguchi, H., Sugai, M. and Kurihara, H. (2001). Expression of IL-1 beta and IL-8 by human gingival epithelial cells in response to Actinobacillus actinomycetemcomitans. Cytokine, 14, 152±161. Vargas, S. J., Naprta, A., Glaccum, M., Lee, S. K., Kalinowski, J. and Lorenzo, J. A. (1996). Interleukin-6 expression and histomorphometry of bones from mice deficient in receptors for interleukin-1 or tumor necrosis factor. Journal of Bone and Mineral Research, 11, 1736±1744. Wong, B. R., Rho, J., Arron, J., Robinson, E., Orlinick, J., Chao, M., Kalachikov, S., Cayani, E., Bartlett, F. S., III, Frankel, W. N., Lee, S. Y. and Choi, Y. (1997). TRANCE is a novel ligand of the tumor necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. Journal of Biological Chemistry, 272, 25190±25194. Yasuda, H., Shima, N., Nakagawa, N., Mochizuki, S. I., Yano, K., Fujise, N., Sato, Y., Goto, M., Yamaguchi, K., Kuriyama, M., Kanno, T., Murakami, A., Tsuda, E., Morinaga, T. and Higashio, K. (1998a). Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology, 139, 1329±1337.
Cytokine Expression in FORL
Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinosaki, M., Mochizuki, S., Tomoyasu, A., Yano, K., Goto, M., Murakami, A., Tsuda, E., Morinaga, T., Higashio, K., Udagawa, N., Takahashi, N. and Suda, T. (1998b). Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor
177
and is identical to TRANCE/RANKL. Proceedings of the National Academy of Sciences of the United States of America, 95, 3597±3602. Received; December 3rd; 2001 Accepted; April 30th; 2002