- Email: [email protected]
Cytoplasmic tail domain of glycoprotein B is essential for HHV-6 infection
Virology 490 (2016) 1–5
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
Brief Communication
Cytoplasmic tail domain of glycoprotein B is essential for HHV-6 infection Nora F. Mahmoud a,b, Chyntia Jasirwan a,c, Satoshi Kanemoto a, Aika Wakata a, Bochao Wang a, Yuuki Hata a, Satoshi Nagamata a,d, Akiko Kawabata a, Huamin Tang a,e, Yasuko Mori a,n a
Division of Clinical Virology, Center for Infectious Diseases, Kobe University Graduate School of Medicine, Kobe, Japan Faculty of Pharmacy, Suez Canal University, Ismailia, Egypt c Division of Hepatobiliary, Department of Internal Medicine, Faculty of Medicine, University of Indonesia, Indonesia d Department of Obstetrics and Gynecology, Kobe University Graduate School of Medicine, Kobe, Japan e Department of Immunology, Nanjing Medical University, Nanjing, China b
art ic l e i nf o
a b s t r a c t
Article history: Received 6 November 2015 Returned to author for revisions 24 December 2015 Accepted 29 December 2015 Available online 21 January 2016
Human herpesvirus 6 (HHV-6) glycoprotein B (gB) is an abundantly expressed viral glycoprotein required for viral entry and cell fusion, and is highly conserved among herpesviruses. The present study examined the function of HHV-6 gB cytoplasmic tail domain (CTD). A gB CTD deletion mutant was constructed which, in contrast to its revertant, could not be reconstituted. Moreover, deletion of gB cytoplasmic tail impaired the intracellular transport of gB protein to the trans-Golgi network (TGN). Taken together, these results suggest that gB CTD is critical for HHV-6 propagation and important for intracellular transportation. & 2016 Elsevier Inc. All rights reserved.
Keywords: HHV-6 Glycoprotein B Cytoplasmic tail domain Intracellular transport
Introduction Human herpesvirus 6 (HHV-6) is an enveloped double stranded DNA virus belonging to the genus Roseolovirus genus within the βherpesvirus subfamily (Braun et al., 1997; Mori, 2009; Roizmann et al., 1992). Formerly, HHV-6 was classified as two variants, HHV6 A and HHV-6 B; however, these variants were recently categorized as two distinct virus species based on differing epidemiological, biological, and immunological aspects (Ablashi et al., 2014; Adams and Carstens, 2012). Up until now, HHV-6A has not been etiologically linked to any specific disease; however, HHV-6B is the causative agent of the childhood febrile illness, exanthem subitum (Yamanishi et al., 1988) Many glycoproteins are involved in vital steps during herpesviruses infection, and HHV-6 seems to rely on common homologs of multiple envelope glycoproteins [glycoprotein B (gB), glycoprotein H (gH), and glycoprotein L (gL)] for membrane fusion and virus entry (Chesnokova et al., 2009; Haan et al., 2001; Mori, 2009; Tanaka et al., 2013; Vanarsdall et al., 2008). Recently, we identified n Correspondence to: Division of Clinical Virology, Kobe University Graduate School of Medicine, 7-5-1, Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan. Tel.: þ 81 78 382 6272; fax: þ 81 78 382 6879. E-mail address: [email protected] (Y. Mori).
http://dx.doi.org/10.1016/j.virol.2015.12.018 0042-6822/& 2016 Elsevier Inc. All rights reserved.
a HHV-6A/B-specific envelope glycoprotein complex, called the gH/gL/glycoprotein Q1 (gQ1)/ glycoprotein Q2 (gQ2) complex (Akkapaiboon et al., 2004; Mori et al., 2003), which acts as a viral ligand for human CD46 (Mori et al., 2004) and CD134 (Tang et al., 2015, 2013, 2014). Moreover, gB is one of the most highly conserved glycoproteins among all herpesviruses and is a major determining factor of virus infectivity both in vitro and in vivo (de Zarate et al., 2007; Gerdts et al., 2000). HHV-6A gB is encoded by the U39 gene, which is translated to yield a protein of about 830 amino acids (aa) ( 112 KDa) that is proteolytically cleaved into two subunits of 64 and 58 KDa, which are covalently linked via a disulfide bond (Chou and Marousek, 1992; Ellinger et al., 1993; Takeda et al., 1996). Based on structure analysis of gB homologs (Bold et al., 1996; Reschke et al., 1995), HHV-6 gB comprises a long ectodomain, a transmembrane anchor region, and a cytoplasmic tail domain (CTD) of about 117 aa which is the main interest of this article. The key roles and functional regions of gB were extensively studied in other herpesviruses and CTD was indicated as an important regulator of the fusion process (Cai et al., 1988; Foster et al., 2001; Garcia et al., 2013; Haan et al., 2001; Nixdorf et al., 2000; Ruel et al., 2006). Mutation of gB CTD could modulate, enhance, reduce or even abolish; cell fusion activity (Garcia et al., 2013; Lin and Spear, 2007; Ruel et al., 2006).
2
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Moreover, in the other herpesviruses, the importance of gB CTD in intracellular transport has been shown (Calistri et al., 2007; de Zarate et al., 2007; Garcia et al., 2013; Heineman et al., 2000). Mutation of gB CTD in herpes simplex virus type 1 (HSV-1), varicella-zoster virus (VZV), pseudorabies virus (PRV) and rhesus monkey rhadinovirus (RRV) impaired the transport from endoplasmic reticulum to Golgi (Beitia Ortiz de Zarate et al., 2004; de Zarate et al., 2007; Heineman et al., 2000; Lang and Means, 2010). gB CTDs of herpesviruses contain several motifs for intracellular transportation and endocytosis. (de Zarate et al., 2007; Heineman et al., 2004; Heineman and Hall, 2001; Lang and Means, 2010; Nixdorf et al., 2000). However there has been no report regarding functional analysis for CTD of HHV-6 gB including their motifs. Here, we show that the gB CTD is essential for HHV-6 propagation and plays a role for intracellular transport of gB.
Results and discussion Little is known about HHV-6 gB and various important issues remain unclear. In this study we tried to elucidate the function of the CTD. A HHV-6 bacterial artificial chromosome (BAC) deletion mutant and its revertant were generated. Our experimental approach was to use two-step Red-mediated mutagenesis and inframe fusion of tandem FLAG-His tags at the C-terminus of the transmembrane region (Fig. 1). The resultant BACs were designated HHV-6ABACgBΔCTD and HHV-6ABACgBΔCTD rev. These BAC DNAs and HHV-6A BAC (wild type) were extracted and digested with BamH1. As expected, similar digestion patterns were detected (data not shown). Isolated BAC DNAs were transfected into JJhan cells by electroporation, followed by co-culture with umbilical cord blood mononuclear cells (CBMCs). After 4 days, green fluorescence was detected in both CBMCs and JJhan cells. Then every 4–5 days, cell to cell infection with CBMCs was carried out. After three rounds of co-culture of infected cells with uninfected CBMCs, expression of gfp gene in BAC genome was markedly increased in case of HHV-6ABACgBΔCTD rev and wild-type (Fig. 2A), while a few cells with faint GFP expression remained in case of HHV-6ABACgBΔCTD and finally the cells with GFP expression were lost upon time, indicating that virus could not be reconstituted from HHV-6ABACgBΔCTD genome (data not shown). To confirm these results, HHV-6ABACgBΔCTD rev- and wild-typeinfected cells were harvested and prepared for western blot analysis. Expression of gB, gQ1, and AU11 in HHV-6ABACgBΔCTD revinfected cells was similar to that in wild type-infected cells, indicating that the CTD deletion revertant was successfully assembled
Fig. 1. Schematic diagram of the HHV-6A gB mutant (HHV-6ABACgBΔCTD). The scale at the top indicates the amino acid number. The inserted fragment is denoted by the dotted lines. TM, transmembrane domain; CTD, cytoplasmic tail domain; AA, amino acid; TAA, stop codon.
Fig. 2. Expression of green fluorescent protein in reconstituted virus-infected cells and confirmation of viral protein expression. (A) JJhan cells were transfected with isolated BAC DNAs and then co-cultured with CBMCs on the third day post-transfection. Then co-culture of infected cells with uninfected CBMCs were subjected to three rounds of cell-to-cell infection. The GFP-fluorescence images are shown; HHV-6ABAC ‘wild type’ (left); and, HHV-6ABACgBΔCTD rev (right) (B) Cell lysates described in (A) were prepared, resolved by SDS-PAGE under reducing conditions, and blotted with antibodies specific for gB (upper), AgQ-119 (middle), and AU11 (bottom). Uninfected CBMCs served as a negative control. WB, western blot. The numbers beside the panels indicate molecular masses.
(Fig. 2B). These findings indicated that deletion of the CTD leads to failure of viral reconstitution, which may be attributable to conformational changes in the gB protein, which is essential for virus replication. Next to examine functional roles of gB CTD, C-terminal HA tagged HHV-6A gB (HHV-6A gB-HA) and its cytoplasmic tail deletion mutant (HHV-6A gBΔCTD-HA) expressing plasmids were constructed (Fig. 3A) and transfected into U373 cells. At 72 h post-transfection, cells were fixed and co-stained with anti-gB monoclonal antibody (Mab) named 87-y-13 whose epitopes exist within ectodomain of gB (Takeda et al., 1996) and antibody for TGN, then examined by confocal microscopy. HHV-6A gB-HA was mainly localized in TGN, while the truncated one, HHV-6A gBΔCTD-HA was diffusely distributed in cytoplasm and only a few cells were localized in TGN (Fig. 3B). Similar localization of gB was observed when anti-HA Mab was used (data not shown). This result indicates that CTD is required for efficient intracellular transport of gB. This is consistent with previous reports of other herpesviruses such as HSV-1, VZV, PRV, and RRV (Beitia Ortiz de
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Zarate et al., 2004; Heineman and Hall, 2001; Heineman et al., 2000; Lang and Means, 2010).These experiments were performed by three different individuals on three separate occasions, all with same results. Taken together, the results presented herein suggest that the CTD of gB is essential for virus growth and plays a crucial role in gB intracellular transport.
3
CBMCs were provided by H. Yamada (Kobe University Graduate School of Medicine, Kobe, Japan) or purchased from the Cell Bank of the RIKEN BioResource Center, Japan, and maintained in RPMI medium containing 10% FBS. Cells were stimulated with phytohemagglutinin (PHA; 5 μg/ml), and interleukin ((IL)-2; 2 ng/ml) for 3 days before use (Oyaizu et al., 2012; Takemoto et al., 2001). HHV-6A strain U1102 was propagated in pre-stimulated CBMCs, as previously described (Mori et al., 2004; Tang et al., 2010). Regarding usage of CBMCs, the study was approved by the ethics committee of Kobe University Graduate School of Medicine.
Materials and methods Plasmid construction and transfection Cells and viruses The JJhan T cell line was propagated in RPMI 1640 supplemented with 8% fetal bovine serum (FBS). Human astrocytoma cell line U373 was cultured in Dulbecco’s modified Eagle’s medium supplemented with 8% FBS (Matsuura et al., 2011)
C-terminally HA-tagged HHV-6A gB named HHV-6A gB-HA and HA-tagged gB deletion mutant named HHV-6A gBΔCTD-HAexpression plasmids were constructed as previously described (Mori et al., 2015; Niwa, Yamamura, and Miyazaki, 1991) using the pCAGGS vector (a kind gift from Jun-ichi Miyazaki, Osaka University, Japan). Codon-optimized gB was used as a template. Amplified DNA fragment was cloned into the NcoI sites within the plasmid and the recombinant plasmid was confirmed by DNA sequencing. Then transfected into U373 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Antibodies Rabbit polyclonal antibodies against HHV-6 gB and U11 have been previously described (Mahmoud et al., in press; Mori et al., 2008). Neutralizing Mab 87-y-13 and Mab specific for HHV-6A gQ1 (AgQ-119) have also been reported (Akkapaiboon et al., 2004; Mori et al., 2003; Takeda et al., 1996; Tang et al., 2010). A sheep polyclonal antibody for TGN46 (TGN marker) was purchased from AbD Serotec, and polyclonal antibody against the hemagglutinin (HA) tag was purchased from MBL. In addition, Alexa Fluor 488conjugated donkey anti-mouse IgG (H þL) and Alexa Fluor 594conjugated donkey anti-sheep IgG were purchased from Molecular Probes and used as secondary antibodies. Immunofluorescence assay The indirect immunofluorescence assay (IFAs) were carried out as previously described (Akkapaiboon et al., 2004; Ota et al., 2014) and signals were detected by a confocal laser-scanning microscope (FluoView FV1000; Olympus). Construction of the HHV-6A gB mutant and its revertant genomes
Fig. 3. Subcellular localization of HHV-6A gB and its truncation mutant in U373 cells. (A) A schematic representation of the HHV-6A and its cytoplasmic tail deletion mutant. TM, transmembrane domain; CTD, cytoplasmic tail domain. (B) U373 cells were transfected with expressing HHV-6A gB (HHV-6A gB-HA), C-terminal deletion mutant of gB (HHV-6A gBΔCTD-HA) and empty vector. Cells were harvested after 3 days post-transfection, and then stained with antibodies against gB (87-y-13) and TGN46 as well as Hoechst 33258. Co-stained area was showing by yellow in merged panels. Bars, 10 μm.
The gB deletion mutant (HHV-6ABACgBΔCTD) was constructed by in-frame fusion of tandem FLAG-His tags at the C-terminus of the gB transmembrane domain and deletion of the gB CTD. This was carried out using the two-step Red-mediated recombination system in E. coli, as previously described (Hayashi et al., 2014; Oyaizu et al., 2012; Tang et al., 2010; Tischer et al., 2006). The
Table 1 Primer sequence. Primer name
Sequence
U1102gBFlagHisTM F U1102gBFlagHis TM R AgB1210FbamHI AgBsalR AgB775F AgBFlagHisrev F AgBFlagHisrev R
50 -tgactactgtgtccagtgttacggggaccactgtcgtcaaggactacaaagacgatgacgacaagcatcaccatcaccaccactaaaggatgacgacgataag-30 50 -caacagatgtgcccccgtcaacatccttaacactaggtgtttagtggtggtgatggtgatgcttgtcgtcatcgtctttgtcaaccaattaaccaattc-30 50 -accggatccgttaagtctagacatgatattctttatg-30 50 -accgtcgactcacgcttcttctacatttac-30 50 -aatggggccactacgttagtg-30 50 -tgactactgtgtccagtgttacggggaccactgtcgtcaagacacctagtgttaaggatgaggatgacgacgataag-3 0 50 -caacagatgtgcccccgtcaacatccttaacactaggtgtcttgacgacagtggtccccgcaaccaattaaccaattc-3 0
4
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
sequences of the primers used for construction are listed in the Table 1. Briefly, the polymerase chain reaction (PCR) product was amplified from the plasmid pEP-KanS using primers U1102gBFlagHisTM F and U1102gBFlagHisTM R and transformed into GS1783competent cells (harboring HHV-6ABAC genome that contains green fluorescence protein (gfp) gene) using the Bio-Rad E. Coli Pulser (Bio-Rad laboratories; Inc.). Positive clones harboring the kanamycin-resistance gene from the first recombination step were selected on kanamycin-chloramphenicol plates. The selected clones were confirmed by PCR using primers AgB1210FbamHI and AgBsalR. Next, the kanamycin-resistance gene was excised by digesting the BAC clones with I-Sce1, the expression of which was induced by the addition of arabinose to the culture medium, followed by a second round of Red recombination. Briefly, 100 μl of an overnight culture of GS1783 cells containing the kanamycin-resistance-geneinserted HHV-6ABAC was inoculated into 2 ml of LB medium containing only chloramphenicol (17 μg/ml). Bacteria were incubated for 4 h at 30 °C, followed by addition of 10% (wt/vol) Larabinose to the culture at ratio of 1:4 (v/v). After another 1 h incubation, the culture was transferred to a 42 °C water bath and incubated for 40 min. The culture was then shaken at 30 °C for another 2 h before 100 μl (diluted 10 3 to 10 6) was plated onto LB agar plates containing only chloramphenicol. Individual colonies were re-streaked (in duplicate) on chloramphenicol- and chloramphenicol-kanamycin-containing plates. Chloramphenicolresistant, but kanamycin-sensitive, clones were first screened by PCR using primers AgB775F and AgBsalR and then checked by nucleotide sequencing. The gB revertant was constructed in a similar fashion. The kanamycin-resistance gene was amplified from pEP-KanS using primers AgBFlagHisrev F and AgBFlagHisrev R. The PCR product was then transformed into GS1783-competent cells harboring the gB mutant BAC. After the first round of recombination, positive clones were selected on kanamycin-chloramphenicol plates and confirmed by PCR using the same set of primers. Next, the kanamycinresistance gene was excised by expressing the I-Sce1 restriction enzyme, followed by induction of the Red recombination system as described above. The gB revertant (HHV-6ABACgBΔCTDrev) DNA was isolated and sequenced to confirm the reversion. Analysis of BAC plasmids and virus reconstitution Extraction and purification of BAC DNAs were carried out using the NucleoBond Bac100 purification kit (Macherey–Nagel), followed by digestion with BamH1 and separation on 0.5% agarose gels. The purified BAC DNAs were used to reconstitute infectious virus, as previously described (Hayashi et al., 2014; Kawabata et al., 2012; Tang et al., 2011; Tang et al., 2010).
Acknowledgment We thank Dr. Hideto Yamada (Department of Obstetrics and Gynecology, Kobe University Graduate School of Medicine) for providing the CBMCs. We thank Dr. Gregory A. Smith (Department of Microbiology-Immunology, Northwestern University, Chicago, IL) for providing the E. coli GS1783; Dr. Nikolaus Osterrieder (Institut für Virologie, Freie Universität Berlin, Berlin, Germany) for providing the pEP-KanS plasmid; Dr. Ulrich H. Koszinowski (Max von PettenkoferInstitute, Ludwig-Maximilians-University, Munich, Germany) for providing the pHA-2 plasmid; and Dr. Jun-Ichi Miyazaki for providing pCAGGS. This study was supported in part by a Grant-in-Aid for Challenging Exploratory Research from the Japan Society for the Promotion of Science (JSPS).
References Ablashi, D., Agut, H., Alvarez-Lafuente, R., Clark, D.A., Dewhurst, S., DiLuca, D., Flamand, L., Frenkel, N., Gallo, R., Gompels, U.A., Hollsberg, P., Jacobson, S., Luppi, M., Lusso, P., Malnati, M., Medveczky, P., Mori, Y., Pellett, P.E., Pritchett, J. C., Yamanishi, K., Yoshikawa, T., 2014. Classification of HHV-6A and HHV-6B as distinct viruses. Arch. Virol. 159 (5), 863–870. Adams, M.J., Carstens, E.B., 2012. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2012). Arch. Virol. 157 (7), 1411–1422. Akkapaiboon, P., Mori, Y., Sadaoka, T., Yonemoto, S., Yamanishi, K., 2004. Intracellular processing of human herpesvirus 6 glycoproteins Q1 and Q2 into tetrameric complexes expressed on the viral envelope. J. Virol. 78 (15), 7969–7983. Beitia Ortiz de Zarate, I., Kaelin, K., Rozenberg, F., 2004. Effects of mutations in the cytoplasmic domain of herpes simplex virus type 1 glycoprotein B on intracellular transport and infectivity. J. Virol. 78 (3), 1540–1551. Bold, S., Ohlin, M., Garten, W., Radsak, K., 1996. Structural domains involved in human cytomegalovirus glycoprotein B-mediated cell-cell fusion. J. Gen. Virol. 77 (Pt 9), 2297–2302. Braun, D.K., Dominguez, G., Pellett, P.E., 1997. Human herpesvirus 6. Clin. Microbiol. Rev. 10 (3), 521–567. Cai, W.H., Gu, B., Person, S., 1988. Role of glycoprotein B of herpes simplex virus type 1 in viral entry and cell fusion. J. Virol. 62 (8), 2596–2604. Calistri, A., Sette, P., Salata, C., Cancellotti, E., Forghieri, C., Comin, A., Gottlinger, H., Campadelli-Fiume, G., Palu, G., Parolin, C., 2007. Intracellular trafficking and maturation of herpes simplex virus type 1 gB and virus egress require functional biogenesis of multivesicular bodies. J. Virol. 81 (20), 11468–11478. Chesnokova, L.S., Nishimura, S.L., Hutt-Fletcher, L.M., 2009. Fusion of epithelial cells by Epstein–Barr virus proteins is triggered by binding of viral glycoproteins gHgL to integrins alpha v beta 6 or alpha v beta 8. Proc. Natl. Acad. Sci. U.S.A. 106 (48), 20464–20469. Chou, S., Marousek, G.I., 1992. Homology of the envelope glycoprotein B of human herpesvirus-6 and cytomegalovirus. Virology 191 (1), 523–528. de Zarate, I.B.O., Cantero-Aguilar, L., Longo, M., Berlioz-Torrent, C., Rozenberg, F., 2007. Contribution of endocytic motifs in the cytoplasmic tail of herpes simplex virus type 1 glycoprotein B to virus replication and cell–cell fusion. J. Virol. 81 (24), 13889–13903. Ellinger, K., Neipel, F., Foa-Tomasi, L., Campadelli-Fiume, G., Fleckenstein, B., 1993. The glycoprotein B homologue of human herpesvirus 6. J. Gen. Virol. 74 (Pt 3), 495–500. Foster, T.F., Melancon, J.M., Kousoulas, K.G., 2001. An alpha-helical domain within the carboxyl terminus of herpes simplex virus type 1 (HSV-1) glycoprotein B (gB) is associated with cell fusion and resistance to heparin inhibition of cell fusion. Virology 287 (1), 18–29. Garcia, N.J., Chen, J., Longnecker, R., 2013. Modulation of Epstein–Barr virus glycoprotein B (gB) fusion activity by the gB cytoplasmic tail domain. MBio 4 (1) e00571-12. Gerdts, V., Beyer, J., Lomniczi, B., Mettenleiter, T.C., 2000. Pseudorabies virus expressing bovine herpesvirus 1 glycoprotein B exhibits altered neurotropism and increased neurovirulence. J. Virol. 74 (2), 817–827. Haan, K.M., Lee, S.K., Longnecker, R., 2001. Different functional domains in the cytoplasmic tail of glycoprotein B are involved in Epstein–Barr virus-induced membrane fusion. Virology 290 (1), 106–114. Hayashi, M., Yoshida, K., Tang, H., Sadaoka, T., Kawabata, A., Jasirwan, C., Mori, Y., 2014. Characterization of the human herpesvirus 6A U23 gene. Virology 450– 451, 98–105. Heineman, T.C., Connolly, P., Hall, S.L., Assefa, D., 2004. Conserved cytoplasmic domain sequences mediate the ER export of VZV, HSV-1, and HCMV gB. Virology 328 (1), 131–141. Heineman, T.C., Hall, S.L., 2001. VZV gB endocytosis and golgi localization are mediated by YXX phi motifs in its cytoplasmic domain. Virology 285 (1), 42–49. Heineman, T.C., Krudwig, N., Hall, S.L., 2000. Cytoplasmic domain signal sequences that mediate transport of varicella-zoster virus gB from the endoplasmic reticulum to the Golgi. J. Virol. 74 (20), 9421–9430. Kawabata, A., Jasirwan, C., Yamanishi, K., Mori, Y., 2012. Human herpesvirus 6 glycoprotein M is essential for virus growth and requires glycoprotein N for its maturation. Virology 429 (1), 21–28. Lang, S.M., Means, R.E., 2010. Characterization of cytoplasmic motifs important in rhesus rhadinovirus gB processing and trafficking. Virology 398 (2), 233–242. Lin, E., Spear, P.G., 2007. Random linker-insertion mutagenesis to identify functional domains of herpes simplex virus type 1 glycoprotein B. Proc. Natl. Acad. Sci. U.S.A 104 (32), 13140–13145. Mahmoud, N.F., Kawabata, A., Tang, H., Wakata, A., Wang, B., Serada, S., Naka, T., Mori, Y., 2016. Human herpesvirus 6 U11 protein is critical for virus infection. Virology, in press. 10.1016/j.virol.2015.12.011. Matsuura, M., Takemoto, M., Yamanishi, K., Mori, Y., 2011. Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression. Virol. J. 8, 9. Mori, J., Kawabata, A., Tang, H., Tadagaki, K., Mizuguchi, H., Kuroda, K., Mori, Y., 2015. Human Herpesvirus-6 U14 induces cell-cycle arrest in G2/M phase by associating with a cellular protein, EDD. Plos. One 10 (9), e0137420. Mori, Y., 2009. Recent topics related to human herpesvirus 6 cell tropism. Cell. Microbiol. 11 (7), 1001–1006.
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Mori, Y., Akkapaiboon, P., Yang, X.W., Yamanishi, K., 2003. The human herpesvirus 6 U100 gene product is the third component of the gH-gL glycoprotein complex on the viral envelope. J. Virol. 77 (4), 2452–2458. Mori, Y., Akkapaiboon, P., Yonemoto, S., Koike, M., Takemoto, M., Sadaoka, T., Sasamoto, Y., Konishi, S., Uchiyama, Y., Yamanishi, K., 2004. Discovery of a second form of tripartite complex containing gH-gL of human herpesvirus 6 and observations on CD46. J. Virol. 78 (9), 4609–4616. Mori, Y., Koike, M., Moriishi, E., Kawabata, A., Tang, H., Oyaizu, H., Uchiyama, Y., Yamanishi, K., 2008. Human herpesvirus-6 induces MVB formation, and virus egress occurs by an exosomal release pathway. Traffic 9 (10), 1728–1742. Niwa, H., Yamamura, K., Miyazaki, J., 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108 (2), 193–199. Nixdorf, R., Klupp, B.G., Karger, A., Mettenleiter, T.C., 2000. Effects of truncation of the carboxy terminus of pseudorabies virus glycoprotein B on infectivity. J. Virol. 74 (15), 7137–7145. Ota, M., Serada, S., Naka, T., Mori, Y., 2014. MHC class I molecules are incorporated into human herpesvirus-6 viral particles and released into the extracellular environment. Microbiol. Immunol. 58 (2), 119–125. Oyaizu, H., Tang, H., Ota, M., Takenaka, N., Ozono, K., Yamanishi, K., Mori, Y., 2012. Complementation of the function of glycoprotein H of human herpesvirus 6 variant A by glycoprotein H of variant B in the virus life cycle. J. Virol. 86 (16), 8492–8498. Reschke, M., Reis, B., Noding, K., Rohsiepe, D., Richter, A., Mockenhaupt, T., Garten, W., Radsak, K., 1995. Constitutive expression of human cytomegalovirus glycoprotein-B (Gpul55) with mutagenized carboxy-terminal hydrophobic domains. J. Gen. Virol. 76, 113–122. Roizmann, B., Desrosiers, R.C., Fleckenstein, B., Lopez, C., Minson, A.C., Studdert, M. J., 1992. The family Herpesviridae: an update. The herpesvirus study group of the international committee on taxonomy of viruses. Arch. Virol. 123 (3–4), 425–449. Ruel, N., Zago, A., Spear, P.G., 2006. Alanine substitution of conserved residues in the cytoplasmic tail of herpes simplex virus gB can enhance or abolish cell fusion activity and viral entry. Virology 346 (1), 229–237. Takeda, K., Okuno, T., Isegawa, Y., Yamanishi, K., 1996. Identification of a variant Aspecific neutralizing epitope on glycoprotein B (gB) of human herpesvirus-6 (HHV-6). Virology 222 (1), 176–183.
5
Takemoto, M., Shimamoto, T., Isegawa, Y., Yamanishi, K., 2001. The R3 region, one of three major repetitive regions of human herpesvirus 6, is a strong enhancer of immediate-early gene U95. J. Virol. 75 (21), 10149–10160. Tanaka, Y., Suenaga, T., Matsumoto, M., Seya, T., Arase, H., 2013. Herpesvirus 6 glycoproteins B (gB), gH, gL, and gQ are necessary and sufficient for cell-to-cell fusion. J. Virol. 87 (19), 10900–10903. Tang, H.M., Hayashi, M., Maeki, T., Yamanishi, K., Mori, Y., 2011. Human herpesvirus 6 glycoprotein complex formation is required for folding and trafficking of the gH/gL/gQ1/gQ2 complex and Its cellular receptor binding. J. Virol. 85 (21), 11121–11130. Tang, H.M., Kawabata, A., Yoshida, M., Oyaizu, H., Maeki, T., Yamanishi, K., Mori, Y., 2010. Human herpesvirus 6 encoded glycoprotein Q1 gene is essential for virus growth. Virology 407 (2), 360–367. Tang, H.M., Mahmoud, N.F., Mori, Y., 2015. Maturation of human herpesvirus 6A glycoprotein O requires coexpression of glycoprotein H and glycoprotein L. J. Virol. 89 (9), 5159–5163. Tang, H.M., Serada, S., Kawabata, A., Ota, M., Hayashi, E., Naka, T., Yamanishi, K., Mori, Y., 2013. CD134 is a cellular receptor specific for human herpesvirus-6B entry. Proc. Natl. Acad. Sci. U.S.A. 110 (22), 9096–9099. Tang, H.M., Wang, J.J., Mahmoud, N.F., Mori, Y., 2014. Detailed study of the interaction between human herpesvirus 6B glycoprotein complex and its cellular receptor, human CD134. J. Virol. 88 (18), 10875–10882. Tischer, B.K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40 (2), 191–197. Vanarsdall, A.L., Ryckman, B.J., Chase, M.C., Johnson, D.C., 2008. Human cytomegalovirus glycoproteins gB and gH/gL mediate epithelial cell-cell fusion when expressed either in cis or in trans. J. Virol. 82 (23), 11837–11850. Yamanishi, K., Shiraki, K., Kondo, T., Okuno, T., Takahashi, M., Asano, Y., Kurata, T., 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1 (8594), 1065–1067.
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
Brief Communication
Cytoplasmic tail domain of glycoprotein B is essential for HHV-6 infection Nora F. Mahmoud a,b, Chyntia Jasirwan a,c, Satoshi Kanemoto a, Aika Wakata a, Bochao Wang a, Yuuki Hata a, Satoshi Nagamata a,d, Akiko Kawabata a, Huamin Tang a,e, Yasuko Mori a,n a
Division of Clinical Virology, Center for Infectious Diseases, Kobe University Graduate School of Medicine, Kobe, Japan Faculty of Pharmacy, Suez Canal University, Ismailia, Egypt c Division of Hepatobiliary, Department of Internal Medicine, Faculty of Medicine, University of Indonesia, Indonesia d Department of Obstetrics and Gynecology, Kobe University Graduate School of Medicine, Kobe, Japan e Department of Immunology, Nanjing Medical University, Nanjing, China b
art ic l e i nf o
a b s t r a c t
Article history: Received 6 November 2015 Returned to author for revisions 24 December 2015 Accepted 29 December 2015 Available online 21 January 2016
Human herpesvirus 6 (HHV-6) glycoprotein B (gB) is an abundantly expressed viral glycoprotein required for viral entry and cell fusion, and is highly conserved among herpesviruses. The present study examined the function of HHV-6 gB cytoplasmic tail domain (CTD). A gB CTD deletion mutant was constructed which, in contrast to its revertant, could not be reconstituted. Moreover, deletion of gB cytoplasmic tail impaired the intracellular transport of gB protein to the trans-Golgi network (TGN). Taken together, these results suggest that gB CTD is critical for HHV-6 propagation and important for intracellular transportation. & 2016 Elsevier Inc. All rights reserved.
Keywords: HHV-6 Glycoprotein B Cytoplasmic tail domain Intracellular transport
Introduction Human herpesvirus 6 (HHV-6) is an enveloped double stranded DNA virus belonging to the genus Roseolovirus genus within the βherpesvirus subfamily (Braun et al., 1997; Mori, 2009; Roizmann et al., 1992). Formerly, HHV-6 was classified as two variants, HHV6 A and HHV-6 B; however, these variants were recently categorized as two distinct virus species based on differing epidemiological, biological, and immunological aspects (Ablashi et al., 2014; Adams and Carstens, 2012). Up until now, HHV-6A has not been etiologically linked to any specific disease; however, HHV-6B is the causative agent of the childhood febrile illness, exanthem subitum (Yamanishi et al., 1988) Many glycoproteins are involved in vital steps during herpesviruses infection, and HHV-6 seems to rely on common homologs of multiple envelope glycoproteins [glycoprotein B (gB), glycoprotein H (gH), and glycoprotein L (gL)] for membrane fusion and virus entry (Chesnokova et al., 2009; Haan et al., 2001; Mori, 2009; Tanaka et al., 2013; Vanarsdall et al., 2008). Recently, we identified n Correspondence to: Division of Clinical Virology, Kobe University Graduate School of Medicine, 7-5-1, Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan. Tel.: þ 81 78 382 6272; fax: þ 81 78 382 6879. E-mail address: [email protected] (Y. Mori).
http://dx.doi.org/10.1016/j.virol.2015.12.018 0042-6822/& 2016 Elsevier Inc. All rights reserved.
a HHV-6A/B-specific envelope glycoprotein complex, called the gH/gL/glycoprotein Q1 (gQ1)/ glycoprotein Q2 (gQ2) complex (Akkapaiboon et al., 2004; Mori et al., 2003), which acts as a viral ligand for human CD46 (Mori et al., 2004) and CD134 (Tang et al., 2015, 2013, 2014). Moreover, gB is one of the most highly conserved glycoproteins among all herpesviruses and is a major determining factor of virus infectivity both in vitro and in vivo (de Zarate et al., 2007; Gerdts et al., 2000). HHV-6A gB is encoded by the U39 gene, which is translated to yield a protein of about 830 amino acids (aa) ( 112 KDa) that is proteolytically cleaved into two subunits of 64 and 58 KDa, which are covalently linked via a disulfide bond (Chou and Marousek, 1992; Ellinger et al., 1993; Takeda et al., 1996). Based on structure analysis of gB homologs (Bold et al., 1996; Reschke et al., 1995), HHV-6 gB comprises a long ectodomain, a transmembrane anchor region, and a cytoplasmic tail domain (CTD) of about 117 aa which is the main interest of this article. The key roles and functional regions of gB were extensively studied in other herpesviruses and CTD was indicated as an important regulator of the fusion process (Cai et al., 1988; Foster et al., 2001; Garcia et al., 2013; Haan et al., 2001; Nixdorf et al., 2000; Ruel et al., 2006). Mutation of gB CTD could modulate, enhance, reduce or even abolish; cell fusion activity (Garcia et al., 2013; Lin and Spear, 2007; Ruel et al., 2006).
2
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Moreover, in the other herpesviruses, the importance of gB CTD in intracellular transport has been shown (Calistri et al., 2007; de Zarate et al., 2007; Garcia et al., 2013; Heineman et al., 2000). Mutation of gB CTD in herpes simplex virus type 1 (HSV-1), varicella-zoster virus (VZV), pseudorabies virus (PRV) and rhesus monkey rhadinovirus (RRV) impaired the transport from endoplasmic reticulum to Golgi (Beitia Ortiz de Zarate et al., 2004; de Zarate et al., 2007; Heineman et al., 2000; Lang and Means, 2010). gB CTDs of herpesviruses contain several motifs for intracellular transportation and endocytosis. (de Zarate et al., 2007; Heineman et al., 2004; Heineman and Hall, 2001; Lang and Means, 2010; Nixdorf et al., 2000). However there has been no report regarding functional analysis for CTD of HHV-6 gB including their motifs. Here, we show that the gB CTD is essential for HHV-6 propagation and plays a role for intracellular transport of gB.
Results and discussion Little is known about HHV-6 gB and various important issues remain unclear. In this study we tried to elucidate the function of the CTD. A HHV-6 bacterial artificial chromosome (BAC) deletion mutant and its revertant were generated. Our experimental approach was to use two-step Red-mediated mutagenesis and inframe fusion of tandem FLAG-His tags at the C-terminus of the transmembrane region (Fig. 1). The resultant BACs were designated HHV-6ABACgBΔCTD and HHV-6ABACgBΔCTD rev. These BAC DNAs and HHV-6A BAC (wild type) were extracted and digested with BamH1. As expected, similar digestion patterns were detected (data not shown). Isolated BAC DNAs were transfected into JJhan cells by electroporation, followed by co-culture with umbilical cord blood mononuclear cells (CBMCs). After 4 days, green fluorescence was detected in both CBMCs and JJhan cells. Then every 4–5 days, cell to cell infection with CBMCs was carried out. After three rounds of co-culture of infected cells with uninfected CBMCs, expression of gfp gene in BAC genome was markedly increased in case of HHV-6ABACgBΔCTD rev and wild-type (Fig. 2A), while a few cells with faint GFP expression remained in case of HHV-6ABACgBΔCTD and finally the cells with GFP expression were lost upon time, indicating that virus could not be reconstituted from HHV-6ABACgBΔCTD genome (data not shown). To confirm these results, HHV-6ABACgBΔCTD rev- and wild-typeinfected cells were harvested and prepared for western blot analysis. Expression of gB, gQ1, and AU11 in HHV-6ABACgBΔCTD revinfected cells was similar to that in wild type-infected cells, indicating that the CTD deletion revertant was successfully assembled
Fig. 1. Schematic diagram of the HHV-6A gB mutant (HHV-6ABACgBΔCTD). The scale at the top indicates the amino acid number. The inserted fragment is denoted by the dotted lines. TM, transmembrane domain; CTD, cytoplasmic tail domain; AA, amino acid; TAA, stop codon.
Fig. 2. Expression of green fluorescent protein in reconstituted virus-infected cells and confirmation of viral protein expression. (A) JJhan cells were transfected with isolated BAC DNAs and then co-cultured with CBMCs on the third day post-transfection. Then co-culture of infected cells with uninfected CBMCs were subjected to three rounds of cell-to-cell infection. The GFP-fluorescence images are shown; HHV-6ABAC ‘wild type’ (left); and, HHV-6ABACgBΔCTD rev (right) (B) Cell lysates described in (A) were prepared, resolved by SDS-PAGE under reducing conditions, and blotted with antibodies specific for gB (upper), AgQ-119 (middle), and AU11 (bottom). Uninfected CBMCs served as a negative control. WB, western blot. The numbers beside the panels indicate molecular masses.
(Fig. 2B). These findings indicated that deletion of the CTD leads to failure of viral reconstitution, which may be attributable to conformational changes in the gB protein, which is essential for virus replication. Next to examine functional roles of gB CTD, C-terminal HA tagged HHV-6A gB (HHV-6A gB-HA) and its cytoplasmic tail deletion mutant (HHV-6A gBΔCTD-HA) expressing plasmids were constructed (Fig. 3A) and transfected into U373 cells. At 72 h post-transfection, cells were fixed and co-stained with anti-gB monoclonal antibody (Mab) named 87-y-13 whose epitopes exist within ectodomain of gB (Takeda et al., 1996) and antibody for TGN, then examined by confocal microscopy. HHV-6A gB-HA was mainly localized in TGN, while the truncated one, HHV-6A gBΔCTD-HA was diffusely distributed in cytoplasm and only a few cells were localized in TGN (Fig. 3B). Similar localization of gB was observed when anti-HA Mab was used (data not shown). This result indicates that CTD is required for efficient intracellular transport of gB. This is consistent with previous reports of other herpesviruses such as HSV-1, VZV, PRV, and RRV (Beitia Ortiz de
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Zarate et al., 2004; Heineman and Hall, 2001; Heineman et al., 2000; Lang and Means, 2010).These experiments were performed by three different individuals on three separate occasions, all with same results. Taken together, the results presented herein suggest that the CTD of gB is essential for virus growth and plays a crucial role in gB intracellular transport.
3
CBMCs were provided by H. Yamada (Kobe University Graduate School of Medicine, Kobe, Japan) or purchased from the Cell Bank of the RIKEN BioResource Center, Japan, and maintained in RPMI medium containing 10% FBS. Cells were stimulated with phytohemagglutinin (PHA; 5 μg/ml), and interleukin ((IL)-2; 2 ng/ml) for 3 days before use (Oyaizu et al., 2012; Takemoto et al., 2001). HHV-6A strain U1102 was propagated in pre-stimulated CBMCs, as previously described (Mori et al., 2004; Tang et al., 2010). Regarding usage of CBMCs, the study was approved by the ethics committee of Kobe University Graduate School of Medicine.
Materials and methods Plasmid construction and transfection Cells and viruses The JJhan T cell line was propagated in RPMI 1640 supplemented with 8% fetal bovine serum (FBS). Human astrocytoma cell line U373 was cultured in Dulbecco’s modified Eagle’s medium supplemented with 8% FBS (Matsuura et al., 2011)
C-terminally HA-tagged HHV-6A gB named HHV-6A gB-HA and HA-tagged gB deletion mutant named HHV-6A gBΔCTD-HAexpression plasmids were constructed as previously described (Mori et al., 2015; Niwa, Yamamura, and Miyazaki, 1991) using the pCAGGS vector (a kind gift from Jun-ichi Miyazaki, Osaka University, Japan). Codon-optimized gB was used as a template. Amplified DNA fragment was cloned into the NcoI sites within the plasmid and the recombinant plasmid was confirmed by DNA sequencing. Then transfected into U373 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Antibodies Rabbit polyclonal antibodies against HHV-6 gB and U11 have been previously described (Mahmoud et al., in press; Mori et al., 2008). Neutralizing Mab 87-y-13 and Mab specific for HHV-6A gQ1 (AgQ-119) have also been reported (Akkapaiboon et al., 2004; Mori et al., 2003; Takeda et al., 1996; Tang et al., 2010). A sheep polyclonal antibody for TGN46 (TGN marker) was purchased from AbD Serotec, and polyclonal antibody against the hemagglutinin (HA) tag was purchased from MBL. In addition, Alexa Fluor 488conjugated donkey anti-mouse IgG (H þL) and Alexa Fluor 594conjugated donkey anti-sheep IgG were purchased from Molecular Probes and used as secondary antibodies. Immunofluorescence assay The indirect immunofluorescence assay (IFAs) were carried out as previously described (Akkapaiboon et al., 2004; Ota et al., 2014) and signals were detected by a confocal laser-scanning microscope (FluoView FV1000; Olympus). Construction of the HHV-6A gB mutant and its revertant genomes
Fig. 3. Subcellular localization of HHV-6A gB and its truncation mutant in U373 cells. (A) A schematic representation of the HHV-6A and its cytoplasmic tail deletion mutant. TM, transmembrane domain; CTD, cytoplasmic tail domain. (B) U373 cells were transfected with expressing HHV-6A gB (HHV-6A gB-HA), C-terminal deletion mutant of gB (HHV-6A gBΔCTD-HA) and empty vector. Cells were harvested after 3 days post-transfection, and then stained with antibodies against gB (87-y-13) and TGN46 as well as Hoechst 33258. Co-stained area was showing by yellow in merged panels. Bars, 10 μm.
The gB deletion mutant (HHV-6ABACgBΔCTD) was constructed by in-frame fusion of tandem FLAG-His tags at the C-terminus of the gB transmembrane domain and deletion of the gB CTD. This was carried out using the two-step Red-mediated recombination system in E. coli, as previously described (Hayashi et al., 2014; Oyaizu et al., 2012; Tang et al., 2010; Tischer et al., 2006). The
Table 1 Primer sequence. Primer name
Sequence
U1102gBFlagHisTM F U1102gBFlagHis TM R AgB1210FbamHI AgBsalR AgB775F AgBFlagHisrev F AgBFlagHisrev R
50 -tgactactgtgtccagtgttacggggaccactgtcgtcaaggactacaaagacgatgacgacaagcatcaccatcaccaccactaaaggatgacgacgataag-30 50 -caacagatgtgcccccgtcaacatccttaacactaggtgtttagtggtggtgatggtgatgcttgtcgtcatcgtctttgtcaaccaattaaccaattc-30 50 -accggatccgttaagtctagacatgatattctttatg-30 50 -accgtcgactcacgcttcttctacatttac-30 50 -aatggggccactacgttagtg-30 50 -tgactactgtgtccagtgttacggggaccactgtcgtcaagacacctagtgttaaggatgaggatgacgacgataag-3 0 50 -caacagatgtgcccccgtcaacatccttaacactaggtgtcttgacgacagtggtccccgcaaccaattaaccaattc-3 0
4
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
sequences of the primers used for construction are listed in the Table 1. Briefly, the polymerase chain reaction (PCR) product was amplified from the plasmid pEP-KanS using primers U1102gBFlagHisTM F and U1102gBFlagHisTM R and transformed into GS1783competent cells (harboring HHV-6ABAC genome that contains green fluorescence protein (gfp) gene) using the Bio-Rad E. Coli Pulser (Bio-Rad laboratories; Inc.). Positive clones harboring the kanamycin-resistance gene from the first recombination step were selected on kanamycin-chloramphenicol plates. The selected clones were confirmed by PCR using primers AgB1210FbamHI and AgBsalR. Next, the kanamycin-resistance gene was excised by digesting the BAC clones with I-Sce1, the expression of which was induced by the addition of arabinose to the culture medium, followed by a second round of Red recombination. Briefly, 100 μl of an overnight culture of GS1783 cells containing the kanamycin-resistance-geneinserted HHV-6ABAC was inoculated into 2 ml of LB medium containing only chloramphenicol (17 μg/ml). Bacteria were incubated for 4 h at 30 °C, followed by addition of 10% (wt/vol) Larabinose to the culture at ratio of 1:4 (v/v). After another 1 h incubation, the culture was transferred to a 42 °C water bath and incubated for 40 min. The culture was then shaken at 30 °C for another 2 h before 100 μl (diluted 10 3 to 10 6) was plated onto LB agar plates containing only chloramphenicol. Individual colonies were re-streaked (in duplicate) on chloramphenicol- and chloramphenicol-kanamycin-containing plates. Chloramphenicolresistant, but kanamycin-sensitive, clones were first screened by PCR using primers AgB775F and AgBsalR and then checked by nucleotide sequencing. The gB revertant was constructed in a similar fashion. The kanamycin-resistance gene was amplified from pEP-KanS using primers AgBFlagHisrev F and AgBFlagHisrev R. The PCR product was then transformed into GS1783-competent cells harboring the gB mutant BAC. After the first round of recombination, positive clones were selected on kanamycin-chloramphenicol plates and confirmed by PCR using the same set of primers. Next, the kanamycinresistance gene was excised by expressing the I-Sce1 restriction enzyme, followed by induction of the Red recombination system as described above. The gB revertant (HHV-6ABACgBΔCTDrev) DNA was isolated and sequenced to confirm the reversion. Analysis of BAC plasmids and virus reconstitution Extraction and purification of BAC DNAs were carried out using the NucleoBond Bac100 purification kit (Macherey–Nagel), followed by digestion with BamH1 and separation on 0.5% agarose gels. The purified BAC DNAs were used to reconstitute infectious virus, as previously described (Hayashi et al., 2014; Kawabata et al., 2012; Tang et al., 2011; Tang et al., 2010).
Acknowledgment We thank Dr. Hideto Yamada (Department of Obstetrics and Gynecology, Kobe University Graduate School of Medicine) for providing the CBMCs. We thank Dr. Gregory A. Smith (Department of Microbiology-Immunology, Northwestern University, Chicago, IL) for providing the E. coli GS1783; Dr. Nikolaus Osterrieder (Institut für Virologie, Freie Universität Berlin, Berlin, Germany) for providing the pEP-KanS plasmid; Dr. Ulrich H. Koszinowski (Max von PettenkoferInstitute, Ludwig-Maximilians-University, Munich, Germany) for providing the pHA-2 plasmid; and Dr. Jun-Ichi Miyazaki for providing pCAGGS. This study was supported in part by a Grant-in-Aid for Challenging Exploratory Research from the Japan Society for the Promotion of Science (JSPS).
References Ablashi, D., Agut, H., Alvarez-Lafuente, R., Clark, D.A., Dewhurst, S., DiLuca, D., Flamand, L., Frenkel, N., Gallo, R., Gompels, U.A., Hollsberg, P., Jacobson, S., Luppi, M., Lusso, P., Malnati, M., Medveczky, P., Mori, Y., Pellett, P.E., Pritchett, J. C., Yamanishi, K., Yoshikawa, T., 2014. Classification of HHV-6A and HHV-6B as distinct viruses. Arch. Virol. 159 (5), 863–870. Adams, M.J., Carstens, E.B., 2012. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2012). Arch. Virol. 157 (7), 1411–1422. Akkapaiboon, P., Mori, Y., Sadaoka, T., Yonemoto, S., Yamanishi, K., 2004. Intracellular processing of human herpesvirus 6 glycoproteins Q1 and Q2 into tetrameric complexes expressed on the viral envelope. J. Virol. 78 (15), 7969–7983. Beitia Ortiz de Zarate, I., Kaelin, K., Rozenberg, F., 2004. Effects of mutations in the cytoplasmic domain of herpes simplex virus type 1 glycoprotein B on intracellular transport and infectivity. J. Virol. 78 (3), 1540–1551. Bold, S., Ohlin, M., Garten, W., Radsak, K., 1996. Structural domains involved in human cytomegalovirus glycoprotein B-mediated cell-cell fusion. J. Gen. Virol. 77 (Pt 9), 2297–2302. Braun, D.K., Dominguez, G., Pellett, P.E., 1997. Human herpesvirus 6. Clin. Microbiol. Rev. 10 (3), 521–567. Cai, W.H., Gu, B., Person, S., 1988. Role of glycoprotein B of herpes simplex virus type 1 in viral entry and cell fusion. J. Virol. 62 (8), 2596–2604. Calistri, A., Sette, P., Salata, C., Cancellotti, E., Forghieri, C., Comin, A., Gottlinger, H., Campadelli-Fiume, G., Palu, G., Parolin, C., 2007. Intracellular trafficking and maturation of herpes simplex virus type 1 gB and virus egress require functional biogenesis of multivesicular bodies. J. Virol. 81 (20), 11468–11478. Chesnokova, L.S., Nishimura, S.L., Hutt-Fletcher, L.M., 2009. Fusion of epithelial cells by Epstein–Barr virus proteins is triggered by binding of viral glycoproteins gHgL to integrins alpha v beta 6 or alpha v beta 8. Proc. Natl. Acad. Sci. U.S.A. 106 (48), 20464–20469. Chou, S., Marousek, G.I., 1992. Homology of the envelope glycoprotein B of human herpesvirus-6 and cytomegalovirus. Virology 191 (1), 523–528. de Zarate, I.B.O., Cantero-Aguilar, L., Longo, M., Berlioz-Torrent, C., Rozenberg, F., 2007. Contribution of endocytic motifs in the cytoplasmic tail of herpes simplex virus type 1 glycoprotein B to virus replication and cell–cell fusion. J. Virol. 81 (24), 13889–13903. Ellinger, K., Neipel, F., Foa-Tomasi, L., Campadelli-Fiume, G., Fleckenstein, B., 1993. The glycoprotein B homologue of human herpesvirus 6. J. Gen. Virol. 74 (Pt 3), 495–500. Foster, T.F., Melancon, J.M., Kousoulas, K.G., 2001. An alpha-helical domain within the carboxyl terminus of herpes simplex virus type 1 (HSV-1) glycoprotein B (gB) is associated with cell fusion and resistance to heparin inhibition of cell fusion. Virology 287 (1), 18–29. Garcia, N.J., Chen, J., Longnecker, R., 2013. Modulation of Epstein–Barr virus glycoprotein B (gB) fusion activity by the gB cytoplasmic tail domain. MBio 4 (1) e00571-12. Gerdts, V., Beyer, J., Lomniczi, B., Mettenleiter, T.C., 2000. Pseudorabies virus expressing bovine herpesvirus 1 glycoprotein B exhibits altered neurotropism and increased neurovirulence. J. Virol. 74 (2), 817–827. Haan, K.M., Lee, S.K., Longnecker, R., 2001. Different functional domains in the cytoplasmic tail of glycoprotein B are involved in Epstein–Barr virus-induced membrane fusion. Virology 290 (1), 106–114. Hayashi, M., Yoshida, K., Tang, H., Sadaoka, T., Kawabata, A., Jasirwan, C., Mori, Y., 2014. Characterization of the human herpesvirus 6A U23 gene. Virology 450– 451, 98–105. Heineman, T.C., Connolly, P., Hall, S.L., Assefa, D., 2004. Conserved cytoplasmic domain sequences mediate the ER export of VZV, HSV-1, and HCMV gB. Virology 328 (1), 131–141. Heineman, T.C., Hall, S.L., 2001. VZV gB endocytosis and golgi localization are mediated by YXX phi motifs in its cytoplasmic domain. Virology 285 (1), 42–49. Heineman, T.C., Krudwig, N., Hall, S.L., 2000. Cytoplasmic domain signal sequences that mediate transport of varicella-zoster virus gB from the endoplasmic reticulum to the Golgi. J. Virol. 74 (20), 9421–9430. Kawabata, A., Jasirwan, C., Yamanishi, K., Mori, Y., 2012. Human herpesvirus 6 glycoprotein M is essential for virus growth and requires glycoprotein N for its maturation. Virology 429 (1), 21–28. Lang, S.M., Means, R.E., 2010. Characterization of cytoplasmic motifs important in rhesus rhadinovirus gB processing and trafficking. Virology 398 (2), 233–242. Lin, E., Spear, P.G., 2007. Random linker-insertion mutagenesis to identify functional domains of herpes simplex virus type 1 glycoprotein B. Proc. Natl. Acad. Sci. U.S.A 104 (32), 13140–13145. Mahmoud, N.F., Kawabata, A., Tang, H., Wakata, A., Wang, B., Serada, S., Naka, T., Mori, Y., 2016. Human herpesvirus 6 U11 protein is critical for virus infection. Virology, in press. 10.1016/j.virol.2015.12.011. Matsuura, M., Takemoto, M., Yamanishi, K., Mori, Y., 2011. Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression. Virol. J. 8, 9. Mori, J., Kawabata, A., Tang, H., Tadagaki, K., Mizuguchi, H., Kuroda, K., Mori, Y., 2015. Human Herpesvirus-6 U14 induces cell-cycle arrest in G2/M phase by associating with a cellular protein, EDD. Plos. One 10 (9), e0137420. Mori, Y., 2009. Recent topics related to human herpesvirus 6 cell tropism. Cell. Microbiol. 11 (7), 1001–1006.
N.F. Mahmoud et al. / Virology 490 (2016) 1–5
Mori, Y., Akkapaiboon, P., Yang, X.W., Yamanishi, K., 2003. The human herpesvirus 6 U100 gene product is the third component of the gH-gL glycoprotein complex on the viral envelope. J. Virol. 77 (4), 2452–2458. Mori, Y., Akkapaiboon, P., Yonemoto, S., Koike, M., Takemoto, M., Sadaoka, T., Sasamoto, Y., Konishi, S., Uchiyama, Y., Yamanishi, K., 2004. Discovery of a second form of tripartite complex containing gH-gL of human herpesvirus 6 and observations on CD46. J. Virol. 78 (9), 4609–4616. Mori, Y., Koike, M., Moriishi, E., Kawabata, A., Tang, H., Oyaizu, H., Uchiyama, Y., Yamanishi, K., 2008. Human herpesvirus-6 induces MVB formation, and virus egress occurs by an exosomal release pathway. Traffic 9 (10), 1728–1742. Niwa, H., Yamamura, K., Miyazaki, J., 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108 (2), 193–199. Nixdorf, R., Klupp, B.G., Karger, A., Mettenleiter, T.C., 2000. Effects of truncation of the carboxy terminus of pseudorabies virus glycoprotein B on infectivity. J. Virol. 74 (15), 7137–7145. Ota, M., Serada, S., Naka, T., Mori, Y., 2014. MHC class I molecules are incorporated into human herpesvirus-6 viral particles and released into the extracellular environment. Microbiol. Immunol. 58 (2), 119–125. Oyaizu, H., Tang, H., Ota, M., Takenaka, N., Ozono, K., Yamanishi, K., Mori, Y., 2012. Complementation of the function of glycoprotein H of human herpesvirus 6 variant A by glycoprotein H of variant B in the virus life cycle. J. Virol. 86 (16), 8492–8498. Reschke, M., Reis, B., Noding, K., Rohsiepe, D., Richter, A., Mockenhaupt, T., Garten, W., Radsak, K., 1995. Constitutive expression of human cytomegalovirus glycoprotein-B (Gpul55) with mutagenized carboxy-terminal hydrophobic domains. J. Gen. Virol. 76, 113–122. Roizmann, B., Desrosiers, R.C., Fleckenstein, B., Lopez, C., Minson, A.C., Studdert, M. J., 1992. The family Herpesviridae: an update. The herpesvirus study group of the international committee on taxonomy of viruses. Arch. Virol. 123 (3–4), 425–449. Ruel, N., Zago, A., Spear, P.G., 2006. Alanine substitution of conserved residues in the cytoplasmic tail of herpes simplex virus gB can enhance or abolish cell fusion activity and viral entry. Virology 346 (1), 229–237. Takeda, K., Okuno, T., Isegawa, Y., Yamanishi, K., 1996. Identification of a variant Aspecific neutralizing epitope on glycoprotein B (gB) of human herpesvirus-6 (HHV-6). Virology 222 (1), 176–183.
5
Takemoto, M., Shimamoto, T., Isegawa, Y., Yamanishi, K., 2001. The R3 region, one of three major repetitive regions of human herpesvirus 6, is a strong enhancer of immediate-early gene U95. J. Virol. 75 (21), 10149–10160. Tanaka, Y., Suenaga, T., Matsumoto, M., Seya, T., Arase, H., 2013. Herpesvirus 6 glycoproteins B (gB), gH, gL, and gQ are necessary and sufficient for cell-to-cell fusion. J. Virol. 87 (19), 10900–10903. Tang, H.M., Hayashi, M., Maeki, T., Yamanishi, K., Mori, Y., 2011. Human herpesvirus 6 glycoprotein complex formation is required for folding and trafficking of the gH/gL/gQ1/gQ2 complex and Its cellular receptor binding. J. Virol. 85 (21), 11121–11130. Tang, H.M., Kawabata, A., Yoshida, M., Oyaizu, H., Maeki, T., Yamanishi, K., Mori, Y., 2010. Human herpesvirus 6 encoded glycoprotein Q1 gene is essential for virus growth. Virology 407 (2), 360–367. Tang, H.M., Mahmoud, N.F., Mori, Y., 2015. Maturation of human herpesvirus 6A glycoprotein O requires coexpression of glycoprotein H and glycoprotein L. J. Virol. 89 (9), 5159–5163. Tang, H.M., Serada, S., Kawabata, A., Ota, M., Hayashi, E., Naka, T., Yamanishi, K., Mori, Y., 2013. CD134 is a cellular receptor specific for human herpesvirus-6B entry. Proc. Natl. Acad. Sci. U.S.A. 110 (22), 9096–9099. Tang, H.M., Wang, J.J., Mahmoud, N.F., Mori, Y., 2014. Detailed study of the interaction between human herpesvirus 6B glycoprotein complex and its cellular receptor, human CD134. J. Virol. 88 (18), 10875–10882. Tischer, B.K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40 (2), 191–197. Vanarsdall, A.L., Ryckman, B.J., Chase, M.C., Johnson, D.C., 2008. Human cytomegalovirus glycoproteins gB and gH/gL mediate epithelial cell-cell fusion when expressed either in cis or in trans. J. Virol. 82 (23), 11837–11850. Yamanishi, K., Shiraki, K., Kondo, T., Okuno, T., Takahashi, M., Asano, Y., Kurata, T., 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1 (8594), 1065–1067.