- Email: [email protected]
Data in support of effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells
Data in Brief 4 (2015) 437–439
Contents lists available at ScienceDirect
Data in Brief journal homepage: www.elsevier.com/locate/dib
Data article
Data in support of effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells Bin Cao, Zhenhua Li, Rong Peng, Jiandong Ding n State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Advanced Materials Laboratory, Fudan University, Shanghai 200433, China
a r t i c l e in f o
a b s t r a c t
Article history: Received 15 June 2015 Received in revised form 23 June 2015 Accepted 29 June 2015 Available online 8 July 2015
This paper presents data related to the research article entitled “Effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells” [1]. Three sets of micropatterns were fabricated to study the influence of the cell–cell contact on the chondrogenic induction of mesenchymal stem cells (MSCs). The basic repeat units of these micropatterns were of the same area and microisland number to guarantee the same cell density in each culture well. Cells on these micropatterns experienced the same microenvironment except cell–cell contact extent. Immunofluorescent staining and quantitative real-time polymerase chain reaction (qRT-PCR) were performed, and the data are included here. & 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Keywords: PEG hydrogel Micropatterning Chondrogenic differentiation Cell–cell contact Oxygen tension
Specifications table Subject area Material sciences, chemistry, biology, regenerative medicine More specific subject Biomaterials, micropattern, stem cell differentiation, chondrogenesis area Type of data Table, figure
n
DOI of original article: http://dx.doi.org/10.1016/j.biomaterials.2015.06.018 Corresponding author. E-mail address: [email protected] (J. Ding).
http://dx.doi.org/10.1016/j.dib.2015.06.020 2352-3409/& 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
438
B. Cao et al. / Data in Brief 4 (2015) 437–439
How data was acquired Data format Experimental factors Experimental features Data source location Data accessibility
Microscopy, PerlPrimer, Primer-BLAST Raw for the figure and analyzed for the table Cell–cell contact, oxygen tension The prepared micropatterns were captured by microscopy, and the sequence of primers were obtained by PerlPrimer and Primer-BLAST Fudan University, Shanghai, China Data is provided in the article
Value of the data
Data can be helpful to the readers when designing a pattern with appropriate spatial distribution
of microdomains of different microisland numbers to enhance efficiency to examine the effects of microisland numbers in microdomains on cell behaviors. Data emphasizes the importance of keeping the same microisland density in a basic repeated unit in cell studies in order to rule out the interference of other factors such as difference of paracrined soluble factors. The sequences of primers can be employed by other researchers in sequence design of targeted genes detected by quantitative real-time polymerase chain reaction (qRT-PCR) to study the chondrogenic induction of mesenchymal stem cells (MSCs) derived from bone marrow of Sprague Dawley (SD) rats.
1. Data, experimental design, materials and methods The data provided here are bright-field micrographs of three sets of micropatterns with a similar microisland density (Fig. 1) and primer sequences of targeted genes for qRT-PCR (Table 1). 1.1. Micropatterns for cell studies The method to prepare micropatterns had been reported previously by our group [2–11]. First, gold micropatterns were fabricated on glass with a pre-designed mask through photolithography. Then a bi-functional linker was grafted onto the gold with Au–S bond. After that, poly(ethylene glycol) diacrylate (PEGDA-700) mixed with a photo-initiator was coated on the glass surface. By UV irradiation, the macromonomer was cross-linked, and the gold micropatterns were transformed from the glass surface onto the PEG hydrogel by peeling-off. The micrograph presented in Fig. 1 was captured by a CCD in an inverted optical microscope (AXIOVERT 200, Zeiss).
Fig. 1. Bright-field optical micrographs of as-prepared micropatterns for the present cell studies. (A) Five types of microdomains with the numbers of microislands 1, 2, 3, 6 and 15 for collagen II immunofluorescent staining; (B) microdomains with single microislands for qRT-PCR detection of gene expression by single cells; (C) microdomains with the number of microislands 15 for qRT-PCR detection of gene expression by contacted cells.
B. Cao et al. / Data in Brief 4 (2015) 437–439
439
Table 1 Sequences of forward (Fw) and reversed (Rv) primers designed in qRT-PCR for detection of mRNA expression of the genes of interest. Genes
Primer (50 -30 )
Collagen II
Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv
Collagen I Aggrecan SOX9 HIF-1α GAPDH
TGGAAGAGCGGAGACTACTG GTAGACGGAGGAAAGTCATCTGG TCCTGCCGATGTCGCTATC CAAGTTCCGGTGTGACTCGTG TATGAGGATGGCTTCCACCAG AAGACCTCACCCTCCATCTC CTGAACGAGAGCGAGAAG TTCTTCACCGACTTCCTCC CTGAACGAGAGCGAGAAG TTCTTCACCGACTTCCTCC GCTCTCTGCTCCTCCCTGTTCTAG TGGTAACCAGGCGTCCGAT
1.2. Sequence of primers The characteristic genes for the chondrogenic differentiation [12,13] were examined using qRT-PCR [14]. Original mRNA and genomic sequence was obtained from NCBI, then pasted into PerlPrimer [15]. After setting appropriate parameters (Primer temperature 58–62 1C, primer length 20–24 bases, amplicon size 100–300 bases), the most matched primers pairs were obtained. Then Primer-BLAST from NCBI [16] was used to check the specificity of the primers got from PerlPrimer. The sequences are listed in Table 1. References [1] B. Cao, Z.H. Li, R. Peng, J.D. Ding, Effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells, Biomaterials 64 (2015) 21–32. [2] J. Tang, R. Peng, J.D. Ding, The regulation of stem cell differentiation by cell–cell contact on micropatterned material surfaces, Biomaterials 31 (2010) 2470–2476. [3] C. Yan, J.G. Sun, J.D. Ding, Critical areas of cell adhesion on micropatterned surfaces, Biomaterials 32 (2011) 3931–3938. [4] R. Peng, X. Yao, J.D. Ding, Effect of cell anisotropy on differentiation of stem cells on micropatterned surfaces through the controlled single cell adhesion, Biomaterials 32 (2011) 8048–8057. [5] R. Peng, X. Yao, B. Cao, J. Tang, J.D. Ding, The effect of culture conditions on the adipogenic and osteogenic inductions of mesenchymal stem cells on micropatterned surfaces, Biomaterials 33 (2012) 6008–6019. [6] X. Yao, R. Peng, J.D. Ding, Cell–material interactions revealed via material techniques of surface patterning, Adv. Mater. 25 (2013) 5257–5286. [7] X. Yao, R. Peng, J.D. Ding, Effects of aspect ratios of stem cells on lineage commitments with and without induction media, Biomaterials 34 (2013) 930–939. [8] X. Yao, Y.W. Hu, B. Cao, R. Peng, JD. Ding, Effects of surface molecular chirality on adhesion and differentiation of stem cells, Biomaterials 34 (2013) 9001–9009. [9] J.G. Sun, S.V. Graeter, J. Tang, J.H. Huang, P. Liu, Y.X. Lai, et al., Preparation of stable micropatterns of gold on cell-adhesionresistant hydrogels assisted by a hetero-bifunctional macromonomer linker, Sci. China Chem. 57 (2014) 645–653. [10] B. Cao, R. Peng, Z.H. Li, J.D. Ding, Effects of spreading areas and aspect ratios of single cells on dedifferentiation of chondrocytes, Biomaterials 35 (2014) 6871–6881. [11] X. Wang, S.Y. Li, C. Yan, P. Liu, J.D. Ding, Fabrication of RGD micro/nanopattern and corresponding study of stem cell differentiation, Nano Lett. 15 (2015) 1457–1467. [12] P.G. Duan, Z. Pan, L. Cao, Y. He, H.R. Wang, Z.H. Qu, et al., The effects of pore size in bilayered poly(lactide-co-glycolide) scaffolds on restoring osteochondral defects in rabbits, J. Biomed. Mater. Res. A 102 (2014) 180–192. [13] Z. Pan, P. Duan, X. Liu, H. Wang, L. Cao, Y. He, et al., Effect of porosities of bilayered porous scaffolds on spontaneous osteochondral repair in cartilage tissue engineering, Regen. Biomater. 2 (2015) 9–19. [14] L.P. Cao, B. Cao, C.J. Lu, G.W. Wang, L. Yu, J.D. Ding, An injectable hydrogel formed by in situ cross-linking of glycol chitosan and multi-benzaldehyde functionalized PEG analogues for cartilage tissue engineering, J. Mater. Chem. B 3 (2015) 1268–1280. [15] O.J. Marshall, PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR, Bioinformatics 20 (2004) 2471–2472. [16] J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen, T.L. Madden, Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction, BMC Bioinform. 13 (2012) 134.
Contents lists available at ScienceDirect
Data in Brief journal homepage: www.elsevier.com/locate/dib
Data article
Data in support of effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells Bin Cao, Zhenhua Li, Rong Peng, Jiandong Ding n State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Advanced Materials Laboratory, Fudan University, Shanghai 200433, China
a r t i c l e in f o
a b s t r a c t
Article history: Received 15 June 2015 Received in revised form 23 June 2015 Accepted 29 June 2015 Available online 8 July 2015
This paper presents data related to the research article entitled “Effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells” [1]. Three sets of micropatterns were fabricated to study the influence of the cell–cell contact on the chondrogenic induction of mesenchymal stem cells (MSCs). The basic repeat units of these micropatterns were of the same area and microisland number to guarantee the same cell density in each culture well. Cells on these micropatterns experienced the same microenvironment except cell–cell contact extent. Immunofluorescent staining and quantitative real-time polymerase chain reaction (qRT-PCR) were performed, and the data are included here. & 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Keywords: PEG hydrogel Micropatterning Chondrogenic differentiation Cell–cell contact Oxygen tension
Specifications table Subject area Material sciences, chemistry, biology, regenerative medicine More specific subject Biomaterials, micropattern, stem cell differentiation, chondrogenesis area Type of data Table, figure
n
DOI of original article: http://dx.doi.org/10.1016/j.biomaterials.2015.06.018 Corresponding author. E-mail address: [email protected] (J. Ding).
http://dx.doi.org/10.1016/j.dib.2015.06.020 2352-3409/& 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
438
B. Cao et al. / Data in Brief 4 (2015) 437–439
How data was acquired Data format Experimental factors Experimental features Data source location Data accessibility
Microscopy, PerlPrimer, Primer-BLAST Raw for the figure and analyzed for the table Cell–cell contact, oxygen tension The prepared micropatterns were captured by microscopy, and the sequence of primers were obtained by PerlPrimer and Primer-BLAST Fudan University, Shanghai, China Data is provided in the article
Value of the data
Data can be helpful to the readers when designing a pattern with appropriate spatial distribution
of microdomains of different microisland numbers to enhance efficiency to examine the effects of microisland numbers in microdomains on cell behaviors. Data emphasizes the importance of keeping the same microisland density in a basic repeated unit in cell studies in order to rule out the interference of other factors such as difference of paracrined soluble factors. The sequences of primers can be employed by other researchers in sequence design of targeted genes detected by quantitative real-time polymerase chain reaction (qRT-PCR) to study the chondrogenic induction of mesenchymal stem cells (MSCs) derived from bone marrow of Sprague Dawley (SD) rats.
1. Data, experimental design, materials and methods The data provided here are bright-field micrographs of three sets of micropatterns with a similar microisland density (Fig. 1) and primer sequences of targeted genes for qRT-PCR (Table 1). 1.1. Micropatterns for cell studies The method to prepare micropatterns had been reported previously by our group [2–11]. First, gold micropatterns were fabricated on glass with a pre-designed mask through photolithography. Then a bi-functional linker was grafted onto the gold with Au–S bond. After that, poly(ethylene glycol) diacrylate (PEGDA-700) mixed with a photo-initiator was coated on the glass surface. By UV irradiation, the macromonomer was cross-linked, and the gold micropatterns were transformed from the glass surface onto the PEG hydrogel by peeling-off. The micrograph presented in Fig. 1 was captured by a CCD in an inverted optical microscope (AXIOVERT 200, Zeiss).
Fig. 1. Bright-field optical micrographs of as-prepared micropatterns for the present cell studies. (A) Five types of microdomains with the numbers of microislands 1, 2, 3, 6 and 15 for collagen II immunofluorescent staining; (B) microdomains with single microislands for qRT-PCR detection of gene expression by single cells; (C) microdomains with the number of microislands 15 for qRT-PCR detection of gene expression by contacted cells.
B. Cao et al. / Data in Brief 4 (2015) 437–439
439
Table 1 Sequences of forward (Fw) and reversed (Rv) primers designed in qRT-PCR for detection of mRNA expression of the genes of interest. Genes
Primer (50 -30 )
Collagen II
Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv
Collagen I Aggrecan SOX9 HIF-1α GAPDH
TGGAAGAGCGGAGACTACTG GTAGACGGAGGAAAGTCATCTGG TCCTGCCGATGTCGCTATC CAAGTTCCGGTGTGACTCGTG TATGAGGATGGCTTCCACCAG AAGACCTCACCCTCCATCTC CTGAACGAGAGCGAGAAG TTCTTCACCGACTTCCTCC CTGAACGAGAGCGAGAAG TTCTTCACCGACTTCCTCC GCTCTCTGCTCCTCCCTGTTCTAG TGGTAACCAGGCGTCCGAT
1.2. Sequence of primers The characteristic genes for the chondrogenic differentiation [12,13] were examined using qRT-PCR [14]. Original mRNA and genomic sequence was obtained from NCBI, then pasted into PerlPrimer [15]. After setting appropriate parameters (Primer temperature 58–62 1C, primer length 20–24 bases, amplicon size 100–300 bases), the most matched primers pairs were obtained. Then Primer-BLAST from NCBI [16] was used to check the specificity of the primers got from PerlPrimer. The sequences are listed in Table 1. References [1] B. Cao, Z.H. Li, R. Peng, J.D. Ding, Effects of cell–cell contact and oxygen tension on chondrogenic differentiation of stem cells, Biomaterials 64 (2015) 21–32. [2] J. Tang, R. Peng, J.D. Ding, The regulation of stem cell differentiation by cell–cell contact on micropatterned material surfaces, Biomaterials 31 (2010) 2470–2476. [3] C. Yan, J.G. Sun, J.D. Ding, Critical areas of cell adhesion on micropatterned surfaces, Biomaterials 32 (2011) 3931–3938. [4] R. Peng, X. Yao, J.D. Ding, Effect of cell anisotropy on differentiation of stem cells on micropatterned surfaces through the controlled single cell adhesion, Biomaterials 32 (2011) 8048–8057. [5] R. Peng, X. Yao, B. Cao, J. Tang, J.D. Ding, The effect of culture conditions on the adipogenic and osteogenic inductions of mesenchymal stem cells on micropatterned surfaces, Biomaterials 33 (2012) 6008–6019. [6] X. Yao, R. Peng, J.D. Ding, Cell–material interactions revealed via material techniques of surface patterning, Adv. Mater. 25 (2013) 5257–5286. [7] X. Yao, R. Peng, J.D. Ding, Effects of aspect ratios of stem cells on lineage commitments with and without induction media, Biomaterials 34 (2013) 930–939. [8] X. Yao, Y.W. Hu, B. Cao, R. Peng, JD. Ding, Effects of surface molecular chirality on adhesion and differentiation of stem cells, Biomaterials 34 (2013) 9001–9009. [9] J.G. Sun, S.V. Graeter, J. Tang, J.H. Huang, P. Liu, Y.X. Lai, et al., Preparation of stable micropatterns of gold on cell-adhesionresistant hydrogels assisted by a hetero-bifunctional macromonomer linker, Sci. China Chem. 57 (2014) 645–653. [10] B. Cao, R. Peng, Z.H. Li, J.D. Ding, Effects of spreading areas and aspect ratios of single cells on dedifferentiation of chondrocytes, Biomaterials 35 (2014) 6871–6881. [11] X. Wang, S.Y. Li, C. Yan, P. Liu, J.D. Ding, Fabrication of RGD micro/nanopattern and corresponding study of stem cell differentiation, Nano Lett. 15 (2015) 1457–1467. [12] P.G. Duan, Z. Pan, L. Cao, Y. He, H.R. Wang, Z.H. Qu, et al., The effects of pore size in bilayered poly(lactide-co-glycolide) scaffolds on restoring osteochondral defects in rabbits, J. Biomed. Mater. Res. A 102 (2014) 180–192. [13] Z. Pan, P. Duan, X. Liu, H. Wang, L. Cao, Y. He, et al., Effect of porosities of bilayered porous scaffolds on spontaneous osteochondral repair in cartilage tissue engineering, Regen. Biomater. 2 (2015) 9–19. [14] L.P. Cao, B. Cao, C.J. Lu, G.W. Wang, L. Yu, J.D. Ding, An injectable hydrogel formed by in situ cross-linking of glycol chitosan and multi-benzaldehyde functionalized PEG analogues for cartilage tissue engineering, J. Mater. Chem. B 3 (2015) 1268–1280. [15] O.J. Marshall, PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR, Bioinformatics 20 (2004) 2471–2472. [16] J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen, T.L. Madden, Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction, BMC Bioinform. 13 (2012) 134.