Erk signaling pathways in colorectal cancer cells

Journal Pre-proofs Delicaflavone induces ROS-mediated apoptosis and inhibits PI3K/AKT/mTOR and Ras/MEK/Erk signaling pathways in colorectal cancer cells Wensong Yao, Zhen Lin, Peiying Shi, Bing Chen, Gang Wang, Jianyong Huang, Yuxia Sui, Qicai Liu, Shaoguang Li, Xinhua Lin, Qicai Liu, Hong Yao PII: DOI: Reference:

S0006-2952(19)30379-X https://doi.org/10.1016/j.bcp.2019.113680 BCP 113680

To appear in:

Biochemical Pharmacology

Received Date: Accepted Date:

22 August 2019 13 October 2019

Please cite this article as: W. Yao, Z. Lin, P. Shi, B. Chen, G. Wang, J. Huang, Y. Sui, Q. Liu, S. Li, X. Lin, Q. Liu, H. Yao, Delicaflavone induces ROS-mediated apoptosis and inhibits PI3K/AKT/mTOR and Ras/MEK/Erk signaling pathways in colorectal cancer cells, Biochemical Pharmacology (2019), doi: https://doi.org/10.1016/j.bcp. 2019.113680

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Elsevier Inc. All rights reserved.

Delicaflavone induces ROS-mediated apoptosis and inhibits PI3K/AKT/mTOR and Ras/MEK/Erk signaling pathways in colorectal cancer cells Wensong Yao1,3,#, Zhen Lin1,#, Peiying Shi4, Bing Chen2, Gang Wang1, Jianyong Huang5, Yuxia Sui6, Qicai Liu7, Shaoguang Li1,*, Xinhua Lin1,2,*, Qicai Liu2, Hong Yao1,8,*. 1

Department of Pharmaceutical Analysis, Faculty of Pharmacy, Fujian Medical University, Fuzhou 350122, China.

2

Nano Medical Technology Research Institute, Fujian Medical University, Fuzhou 350122, China.

3

College of Medical Sciences, Ningde Normal University, Ningde 352100, China.

4

Department of Traditional Chinese Medicine Resource and Bee Products, Bee Science College, Fujian Agriculture

and Forestry University, Fuzhou, 350002, China. 5

Department of Pharmaceutics, Fujian Medical University Union Hospital, Fuzhou 350001, China.

6

Department of Pharmacy, Provincial Clinical College of Fujian Medical University, Fujian Provincial Hospital, Fuzhou

350001, China. 7

Department of Reproductive Medicine Centre, The First Affiliated Hospital of Fujian Medical University, Fuzhou

350005, China. 8

Fujian Key Laboratory of Drug Target Discovery and Structural and Functional Research, Fujian Medical University,

Fuzhou, 350122, People’s Republic of China.

*Corresponding

authors: Department of Pharmaceutical Analysis, Faculty of Pharmacy, Fujian Medical University,

Fuzhou, 350122, PR China. E-mail addresses: [email protected], [email protected], [email protected] or [email protected]. #Both authors contributed equally to this work.

Abstract Colorectal cancer (CRC) is one of the most common malignant tumors worldwide and tends to have drug resistance. Delicaflavone (DLF), a novel anticancer agent of biflavonoid from Selaginella doederleinii Hieron, showed strong anti-CRC activities, which has not yet been reported. In this study, we investigated the effects and possible anti-CRC mechanism of DLF in vitro and in vivo. It was shown that DLF significantly inhibited the cells viability and induced G2/M phase arrest, apoptosis, the loss of mitochondrial membrane potential (Δψm), generation of ROS and increase of intracellular Ca2+ in HT29 and HCT116 cells by MTT assay, TEM, flow cytometry and inverted fluorescence microscope. Western blot and qPCR assays results further confirmed DLF induced caspase-dependent apoptosis and inhibited PI3K/AKT/mTOR and Ras/MEK/Erk signaling pathways in CRC cells. Meanwhile, DLF significantly suppressed the tumor growth via activation of Caspase-9 and Caspase-3 protein and decrease of ki67 and CD34 protein without apparent side effects in vivo. In summary, these results indicated DLF induced ROS-mediated cell cycle arrest and apoptosis through ER stress and mitochondrial pathway accompanying with the inhibition of PI3K/AKT/mTOR and Ras/MEK/Erk signaling cascade. Thus DLF could be a potential therapeutic agent for CRC.

Keywords: Biflavonoids, ROS, apoptosis, PI3K/AKT/mTOR and Ras/Mek/Erk, G2/M. 1 / 24

Abbreviations: CRC: Colorectal cancer; DLF: Delicaflavone; DMSO: Dimethyl sulfoxide; ER: Endoplasmic reticulum; H-dose: High dose; L-dose: Low dose; M-dose: Medium dose; PBS: Phosphate buffered saline; PI: Propidium iodide; PVDF: Polyvinylidene difluoride; qPCR: Quantitative real-time Polymerase chain reaction; ROS: Reactive oxygen species; SDS-PAGE: Sodium dodecyl sulfate

polyacrylamide

gel

electrophoresis;

TEM:

Transmission

electron

microscope;

MTT:

Methylthiazolyldiphenyl tetrazolium bromide; NAC: N-acetyl cysteine; 5-FU: 5-Fluorouracil; Δψm: mitochondrial membrane potential.

1. Introduction Colorectal cancer (CRC) is the third most common diagnosed cancer and ranks third in terms of incidence and second in terms of mortality worldwide[1]. Chemotherapy is still an indispensable and important treatment for CRC. However, there are limited numbers of anticancer agents which are toxic to cancer cells with minimum toxicity in normal cells[2]. Furthermore, one of the most important factors limiting the effectiveness of chemotherapy is the primary and secondary resistance of CRC cells[3]. Thus, development of effective anti-CRC drugs is important for sustainable treatment of CRC. Many clinical anticancer drugs exert their therapeutic effects by inducing apoptosis[4]. The reactivation of apoptosis not only directly triggers the death of cancer cells, but also lowers the threshold of apoptotic cells induced by other stimuli, thus making cancer cells sensitive to apoptosis[5]. Reactive oxygen species (ROS) plays an important role in apoptosis. Cancer cells seem to function with higher levels of endogenous oxidative stress. Interestingly, an elevation of ROS production may suppress cancer growth[6]. Under pathological conditions, excessive ROS could damage DNA, protein, mitochondria and endoplasmic reticulum (ER), and induce cell apoptosis and cell cycle arrest[7]. Due to lower antioxidant enzymes, tumor cells were easier to accumulate more ROS and became more sensitive to ROS than normal cells, which led to cancer cell death[8]. Many anticancer agents (such as arsenic trioxide, anthracyclines and cisplatin) killed cancer cells with increased ROS stress[9]. Flavonoids had antioxidant activities, but emerging evidences suggested that some flavonoids (such as apigenin, quercetin, and ginkgetin) exhibited oxidative and induced ROS dependent apoptosis in cancer cells [10-12]. The redox property was closely related to the structure of flavonoids[13]. Under the catalysis of peroxidase, phenolic flavonoids in cells might form oxidizing phenoxyl radicals and then synergistically oxidize GSH to form thiyl radicals which activate oxygen and produce ROS[14]. The total biflavonoids extract from Selaginella doederleinii Hieron inhibited the growth of lung cancer cell A549 via caspase-dependent apoptosis pathway[15]. Recent studies demonstrated that delicaflavone (DLF, Fig. 1A), a biflavone isolated from this folk medicine, induced cell apoptosis of cervical cancer via mitochondrial pathway[16] and caused autophagic cell death in lung cancer via the Akt/mTOR/p70S6K signaling pathway[17]. Further research showed that DLF also exhibited strong anti-CRC activities which had not yet been reported. In this study, the anti-CRC effects of DLF and the underlying molecular mechanisms were investigated and disclosed for the first time. Our results showed that DLF induced ROS-mediated apoptosis and cell cycle arrest with the inhibition of PI3K/AKT/mTOR and Ras/MEK/Erk signaling pathways.

2 / 24

2. Materials and methods 2.1 Reagents and antibodies Dimethyl sulfoxide (DMSO), ethanol, N-acetyl cysteine (NAC), 5-Fluorouracil (5-FU) and methylthiazolyldiphenyl

tetrazolium

bromide

(MTT)

were

purchased

from

Aladdin

Biotechnology (Shanghai, China). TRIzol reagent was purchased from Thermo Fisher Scientific (Waltham, MA, USA). McCoy’s 5A was obtained from Hyclone Laboratories (South Logan, UT, USA). Fetal bovine serum, Penicillin-Streptomycin and Trypsin/EDTA were from Gibco BRL (Grand Island, NY, USA). Primary antibodies included Caspase-12 (#2202), Caspase-9 (#9502), Caspase-3 (#9662), Cytochrome c (#11940), p21 (#2947), Cyclin B1 (#12231), cdc2 (#77055), phospho-cdc25 (#9528), Raf (#9422), phospho-Raf (#9421), MEK (#9126), phospho-MEK (#3958), Erk1/2 (#4695), phospho-Erk1/2 (#9101), PARP (#9532), PI3K (#4255), phospho-PI3K (#4228), AKT (#9272), phospho-AKT (#13038), mTOR (#2983), phospho-mTOR (#5536), Bax (#5023), Bcl-2 (#4223),β-Actin (#4970) and Anti-rabbit IgG (#7074) were obtained from Cell Signaling Technology (Danvers, MA, USA). Cell cycle analysis kit, Annexin V-FITC apoptosis detection kit, Ca2+ assay kit, ROS assay kit, mitochondrial membrane potential assay kit with JC-1, BCA protein assay kit and ultra-sensitive ECL chemiluminescence kit were obtained from Beyotime Biotechnology (Shanghai, China). DLF was synthesized with purity of 98.5% (Fig. 1A) in our own laboratory. DLF was dissolved in ethanol/dimethyl sulfoxide (DMSO) mixed solvents (v:v=1:1) and diluted to the desired concentration with cell culture medium immediately (the final concentration of ethanol or DMSO in culture medium was less than 0.2%).

2.2 Cell lines and cell culture Human CRC cell lines (HT29 and HCT116) and normal colorectal cells FHC were obtained from the American Type Culture Collection (Manassas, VA, USA). These cells were cultured in McCoy’s 5A medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 mg/ml streptomycin.

2.3 Cell viability assay The cell viability was measured using MTT assay. In brief, cells were seeded at a density of 5×103 per well in 96-well plate. After treatment with 0-120 μM DLF for 12-72 h, the cells were incubated with 100 μl of basal medium (containing 10 μl of 5 mg/ml MTT) for 4 h at 37 ℃ and subsequently solubilized in 150 μl DMSO. The absorbance at 490 nm was measured using a Microplate Reader (Thermo Multiskan Sky, USA). Half maximal inhibitory concentration (IC50) values were calculated by GraphPad Prism 6 software. Each assay was performed in 3 replicates.

2.4 Cell morphological assessment Cells were seeded in a 6-well plate and treated with DLF for 24 or 48 h. After drug

3 / 24

intervention, the images were observed by using inverted microscope (Leica, Germany). Meanwhile, cells were also grown in 9 cm culture dish and treated with various concentrations of DLF for 24 h. After treatment, cells were harvested by trypsinization and combined with supernatant, followed by centrifugation at 1500 rpm at 4 °C for 5 min and fixing in 2.5% glutaraldehyde for 12 h. The cells precipitate was washed with phosphate buffer (PBS), post-fixed in 1% osmium tetroxide buffer, dehydrated in a graded series of ethanol and embedded in spur resin. The thin sections (60 nm) were cut with an ultramicrotome and stained with saturated solutions of uranyl acetate and lead citrate. The cell ultrastructure was examined by TEM (Royal Philips, Holland).

2.5 Cell Cycle and apoptosis analysis Cells were seeded at 5×105 cells/well in 6-well plates and treated with different concentration of DLF. For cell cycle assay, cells were washed with PBS, harvested by trypsinization and fixed with ice-cold 70% ethanol for 12 h. The fixed cells were stained with RNase A and PI at room temperature for 30 min in the dark. DNA content of stained cells was measured using flow cytometry (Becton-Dickinson, USA) and data was analyzed with Modfit LT 5.0 software. For apoptosis assay, cells were harvested by trypsinization timely, terminated with cell culture medium. After centrifugation, the cells were resuspended with 195 μl binding buffer containing 5 μl Annexin V-FITC and 10 μl PI, incubated for 20 min in the dark at room temperature and then placed in ice bath before they were measured with flow cytometry.

2.6 Mitochondrial membrane potential (Δψm) assay Changes of Δψm were examined by fluorescence using JC-1. Cells treated with DLF were washed twice with PBS and incubated with 5 μM JC-1 for 30 min. The fluorescence images were obtained by using inverted fluorescence microscope (Leica, Germany) with the excitation wavelength of 514 nm. The intensity of red and green fluorescence was measured by Image J software.

2.7 Measurement of intracellular ROS accumulation Intracellular ROS production was determined by an ROS assay kit with fluorescent probe DCFH-DA. After treatment with DLF, the cells were incubated with 10 μM DCFH-DA for 30min at 37°C and then washed with McCoy’s 5A three times. Intracellular ROS oxidized non-fluorescent DCFH to produce fluorescent DCF. The fluorescence of DCF was measured by inverted fluorescence microscope. Then cells were harvested by trypsinization and collected in 5 ml centrifuge tube. Fluorescent intensity of DCF (ROS contents) was measured by using fluorescence spectrophotometer (Agilent, Santa Clara, CA, USA) with an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

2.8 Measurement of cytosolic Ca2+ level The level of cytosolic Ca2+ was determined by Ca2+ assay kit with fluorescent probe Fluo-4 AM. After treatment with DLF, the cells were incubated with 2 μM Fluo-4 AM for 30 min at 37°C, and then washed with PBS twice. Cytosolic Ca2+ combined with Fluo-4 and produced green fluorescence under inverted fluorescence microscope with an excitation wavelength of 494 nm. The intensity of green fluorescence was measured by Image J software.

4 / 24

2.9 Western blot analysis Cells were lysed with RIPA buffer containing 2% protease and phosphatase inhibitor and then centrifuged at 15000 rpm for 10 min at 4 ℃. The total proteins in supernatants were separated using SDS-PAGE and subsequently transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA). After incubation with appropriate primary antibodies and secondary antibodies, blot bands were visualized using the hypersensitive ECL chemiluminescence kit and quantified by Image J software.

2.10 Quantitative real-time Polymerase chain reaction (qPCR ) assay The total RNAs from harvested cells were extracted using a TRIzol reagent according to the manufacturer’s instructions. The mRNA of p21, Cyclin B1 and Caspase-3 were determined using the qPCR And the 18S rRNA, a housekeeping gene, was used as the internal standard. The primers of target gene and internal reference gene are as follows: 18S rRNA forward: ACCCGTTGAACCCCATTCGTGA, reverse: GCCTCACTAAACCATCCAATCGG; p21 mRNA forward: AGGTGGACCTGGAGACTCTCAG, reverse: TCCTCTTGGAGAAGATCAGCCG; Cyclin

B1

mRNA

forward:

GACCTGTGTCAGGCTTTCTCTG,

GGTATTTTGGTCTGACTGCTTGC; GGAAGCGAATCAATGGACTCTGG,

Caspase-3 reverse:

mRNA

reverse: forward:

GCATCGACATCTGTACCAGACC.

Approximately 5 μg of total RNA was subjected to qPCR using TransScript™. qPCR was run with an initial denaturation step

at 95 °C for 30 s, followed by extension step at 60 °C and 30

s for 40 cycles. The experiments were performed in triplicate.

2.11 Xenograft model HT29 cells (2×106/mouse) were injected subcutaneously into two male BALB/c nude mice (National Rodent Laboratory Animal Resource, Shanghai, China). Tumors were dissected when it reached approximately 500 mm 3, and cut into about 1 mm3 small pieces. To establish xenograft tumor model, 30 male nude mice were inoculated with one small piece of HT29 tumor, then randomly divided into 5 groups (n=6 per group). After tumor volume reached more than 100 mm3, the nude mice were injected via the tail vein for 14 days. The mice in the control group were injected with 0.2 ml menstruum once a day. The mice in treatment groups were injected with low dose (L-dose,10 mg/kg), medium dose (M-dose, 20 mg/kg) and high dose (H-dose, 30 mg/kg) of DLF once a day, respectively and those in the 5-Fluorouracil (5-FU) group were injected with 10 mg/kg 5-FU every third day. Tumor volume was measured by calipers and calculated as 0.5×length×width.

2.12 Immunohistochemistry and histology Immunohistostaining

was

performed

on

3

μm

sections

of

formalin-fixed

and

paraffin-embedded tumor tissues. Sections were incubated with primary antibodies, and then followed by the treatment of second antibody. The brown granules in the cytoplasm or/and on the cell membrane represented positive staining and assessed by measuring the optical density using image-pro plus software. Heart, liver, spleen, lung and kidney sections were also stained with hematoxylin-eosin for histological analysis.

2.13 Statistical analysis 5 / 24

The results were expressed as mean ± SD. Mean values were calculated from data obtain from experiments performed in triplicate. The differences between the experimental and control groups were compared using one way ANOVA followed by Dunnett's multiple comparisons test. All statistical analyses were performed using GraphPad Prism 6.0 software. The p value < 0.05 was considered statistically significance.

3. Results 3.1 Effects of DLF on the cell viability, morphological change and Δψm in CRC cells To investigate the cytotoxic effect of DLF on human CRC cell lines (HT29 cells, HCT116 cells) and normal colorectal FHC cells were treated with DLF and 5-FU (a basic drug for CRC therapy as a positive drug). The cell viability was measured by MTT assay. As shown in Fig 1B, DLF significantly inhibited viability of HT29 and HCT116 cells in a dose- and time-dependent manner. The IC50 value for DLF treated on HT29, HCT116 and FHC cells for 48 h was 18.8, 32.0 and 85.6 μM, respectively. After treatment with DLF (40 μM) for 48 h, the viability of HT29, HCT116 and FHC cells was about 27.9%, 34.5% and 68.2%, respectively. 40 μM of 5-FU also markedly reduced the viability of HT29, HCT116 and FHC cells in a time-dependent manner and the cell viability was 43.4%, 53.1% and 44.1% (48 h), respectively. Compared with 5-FU, DLF showed better anti-proliferation ability towards CRC cells and lower toxicity to normal colorectal cells FHC. DLF induced significantly morphology change of HT29 and HCT116 cells (Fig. 1C). The cells bodies of HT29 and HCT116 in treatment groups generally became smaller and more round than those of the control group. After treatment with DLF for 48h, the number of cells decreased and a lot of floated cells and cellular debris appeared in the culture medium. These results indicated that DLF not only inhibited cell proliferation, but also induced cell death. Furthermore, the ultrastructure of HT29 and HCT116 cells treated with DLF was observed under TEM (Fig. 1D). HT29 and HCT116 cells in the control group had a large nucleus, rich organelles, and especially showed the clear vision of rough endoplasmic reticulum and mitochondria. However, apoptotic features such as nuclear pyknosis, chromatin edge collection, and apoptotic bodies were observed in HT29 and HCT116 cells treated with DLF. Furthermore, the endoplasmic reticulum (ER) and mitochondria were swollen and vacuoles appeared in cytoplasm of DLF-treated cells. These results indicated that DLF induced cell apoptosis with damage of mitochondria and ER. Mitochondrial damage may cause the decrease of mitochondrial membrane potential (Δψm). Fig. 1E showed that mitochondria in the control cells emitted strong red fluorescence. When HT29 and HCT116 cells were treated with DLF for 12h, red fluorescence decreased, while green fluorescence increased significantly, which indicated that Δψm decreased in a dose-dependent manner.

3.2 DLF induced ROS generation in CRC cells NAC is a well-known ROS inhibitor[18]. 2 mM NAC could significantly attenuate the inhibition of proliferation of HT29 and HCT116 cells treated with 40 μM DLF in a time-dependent manner (Fig. 2A and B). After treatment with 40 μM DLF for 72h, the viability of HT29 and HCT116 cells were increased by 21.5% and 16.3%, respectively. NAC also partially reversed the inhibition of viability of HT29 and HCT116 cells treated with 80 μM DLF for 72 h and the the viability of HT29 and HCT116 cells were increased by 7.0% and 6.1%,

6 / 24

respectively. While NAC (1, 2 and 4 mM) itself did not affect cell viability compared with the control group ( Fig. 2C). The fluorescent probe DCFH-DA was used to estimate the effect of DLF on ROS production in HT29 and HCT116 cells. As shown in Fig. 2D and E, the intensity of green fluorescence in cells treated with DLF was much higher than that in control group, which indicated that DLF induced ROS production in HT29 and HCT116 cells. Fluorescence spectrophotometer was further used to monitor the fluorescence intensity generated from DCFH-DA to evaluate the level of DLF-induced ROS. ROS production was expressed as the fluorescence intensity. The fluorescence intensity in HT29 and HCT116 cells treated with DLF for 12 h was 2.6~4.1 folds and 3.2~4.3 folds higher than that in the control group, respectively. These results indicated the amount of ROS produced by DLF was much higher than that in the control cells. Fig. 2F showed NAC led to fluorescence quenching when cells were incubated with DLF in the presence of NAC, which indicated that co-treatment with NAC significantly inhibited DLF-induced ROS production in HT29 and HCT116 cells. These results indicated that the ROS production induced by DLF might damage CRC cells and induce cell death.

3.3 DLF increased the level of cytosolic Ca2+ in CRC cells Fluo-4 AM fluorescent probe of Ca2+ was used to estimate the concentration of Ca2+ in cytoplasm of CRC cells treated with DLF. As shown in Fig. 3A and B, the intensity of green fluorescence of Fluo-4-Ca2+ in HT29 and HCT116 cells treated with DLF was increased in a dose dependent manner. The fluorescence intensity in HT29 and HCT116 cells treated with DLF for 12 h was increased by 11.5~22.3 times and 12.4~21.5 times than that in the control group, respectively.

3.4 DLF induced cell apoptosis in CRC cells The apoptotic effects of DLF on HT29 and HCT116 cells stained with Annexin V-FITC and PI were analyzed by flow cytometry. Fig. 3C and D showed that there was nearly no apoptosis and necrosis cells in control group. However, DLF induced significant apoptosis of HT29 and HCT116 cells in a dose- and time-dependent manner. The apoptotic rates of HT29 and HCT116 were 47.5% and 43.8%, respectively when cells were treated with 80 μM of DLF for 24h, and 41.4% and 48.3%, respectively when cells were treated with 40 μM of DLF for 48h.

3.5 DLF induced G2/M phase cell cycle arrest in CRC cells Fig.4A and B showed that the cell number in G2/M phase increased from 12.6% to 25.2% and from 18.7% to 28.7% in HT29 and HCT116 cells treated with DLF, respectively. Compared with the control group, the number of HT29 and HCT116 cells were significantly accumulated at G2/M phase in a dose-dependent manner. The expression of cycle-associated proteins was detected by western blot. As shown in Fig.4C and D, compared with the control group, the levels of p53 and p21 proteins increased significantly, while the levels of cdc2, Cyclin B1 and phospho-cdc25 proteins decreased significantly in HT29 and HCT116 cells treated with DLF (40 and 80 μM). We further examined the mRNA levels of p21 and Cyclin B1 using qPCR. Compared with the control group, Fig. 4E showed that the expression of p21 mRNA was significantly up-regulated in 40 and 80 μM of DLF treated groups, while the expression of Cyclin B1 mRNA was down-regulated significantly in a dose-dependent manner in HT29 cells.

7 / 24

Similarly, compared with the control, the levels of p21 mRNA were significantly increased, while the levels of Cyclin B1 mRNA were decreased significantly in HCT116 cells treated with 40 and 80 μM of DLF (Fig. 4F). The effects of DLF on transcriptional level of p21 and Cyclin B1 mRNA were consistent with the expression of their proteins in HT29 and HCT116 cells.

3.6 DLF regulated Bcl-2 family proteins and released the Cytochrome c in CRC cells Mitochondrial apoptotic pathway was controlled by the Bcl-2 family proteins. As shown in Fig.

5A and B, compared with the control group, the expression of Bax protein was significantly up-regulated in HT29 and HCT116 cells treated with DLF (20 and 40 μM), while the expression of Bcl-2 protein was significantly down-regulated in HT29 and HCT116 cells treated with DLF (40 and 80 μM). The Bax/Bcl-2 ratio in HT29 and HCT116 cells treated with DLF (20, 40 and 80 μM) was significantly higher than that in the control group, accompanying with the increase level of Cytochrome c protein in HT29 and HCT116 cells treated with DLF (20, 40 and 80 μM) (Fig. 5C and D).

3.7 DLF activated the caspases cascade and PARP in CRC cells The effects of DLF on the expression of caspases and PARP proteins were investigated. Fig.

5E and F showed that the expression of Caspase-12 and Caspase-9 proteins were not significantly changed in HT29 and HCT116 cells treated with DLF compared with the control group. However, the levels of cleaved Caspase-12 and cleaved Caspase-9 proteins in HT29 cells treated with DLF (40 and 80 μM) and in HCT116 cells treated with DLF (20, 40 and 80 μM) were significantly increased compared with that in the control group. The cleaved Caspase-9, an initiator of apoptosis, activates its downstream apoptotic executor Caspase-3. Compared with the control group, the expression of Capspase-3 was up-regulated in HT29 treated with 80 μM of DLF and in HCT116 cells treated with DLF (20, 40 and 80 μM). Additionally, the levels of cleaved Caspase-3 protein in HT29 and HCT116 treated with DLF (20, 40 and 80 μM) were markedly increased compared with that in the control group, which was consistent with the alternations of Caspase-3 mRNA (Fig. 5G and H). PARP is an important substrate of Caspase-3 and an indicator of Caspase-3 activation[19]. Compared with the control group, the expression of PARP protein showed no significant change in HT29 and HCT116 cells treated with DLF. However, the levels of cleaved PARP proteins in HT29 cells treated with DLF (40 and 80 μM) and in HCT116 cells treated with DLF (20, 40 and 80 μM) were markedly increased compared with that in the control group (Fig. 5C and D).

3.8 DLF inhibited PI3K/AKT/mTOR and Raf/MEK/Erk signaling pathways in CRC cells PI3K/AKT/mTOR pathway plays an important role in cellular processes of transcription, proliferation and apoptosis. Compared with the control group ( Fig. 6A), it showed that the levels of PI3K and phospho-PI3K proteins in HT29 cells treated with DLF were significantly decreased in a dose dependent-manner. Additionally, the levels of AKT and phospho-AKT proteins were decreased in HT29 cells treated with DLF (40 and 80 μM) compared with the control. Furthermore, the levels of mTOR and phospho-mTOR proteins in HT29 cells treated with DLF were markedly down-regulated in a dose dependent-manner. Compared with the control group (Fig. 6B), it showed that the level of PI3K presented no significant change in HCT116 cells treated with DLF, but the expression of phospho-PI3K in HCT116 cells treated

8 / 24

with DLF (40 and 80 μM) was significantly decreased. Similarly, the level of AKT also showed no significant change between DLF treated-groups and the control group. However, the expression of phospho-AKT was down-regulated in a dose-dependent manner in the treated groups. Compared with the control, the level of mTOR and phospho-mTOR proteins was decreased in HCT116 cells treated with DLF (40 and 80 μM). The Raf/MEK/Erk signaling cascades transmit signals from growth factor receptors to regulate gene expression and prevent apoptosis[20]. Compared with the control, DLF (40 and 80 μM) not only significantly reduced the expression of Raf, MEK and Erk1/2 proteins, but also markedly inhibited the expression of their phosphorylation in HT29 cells (Fig. 6C). The level of Raf, MEK and Erk1/2 proteins in HCT116 cells treated with DLF (20 and 40 μM) did not changed significantly. However, DLF (40 and 80 μM) markedly reduced the expression of phospho-Raf, phospho-MEK and phospho-Erk1/2 proteins in HCT116 cells (Fig. 6D).

3.9 DLF inhibited HT29 tumor growth in vivo We further assessed the anticancer effects of DLF in vivo by using the xenograft tumor model of HT29 cells in male BALB/c nude mice. No nude mice died during the treatment. Compared with the control, the groups treated with 5-FU and DLF both significantly inhibited tumor growth (Fig. 7A-C). H-dose DLF and 5-FU significantly inhibited tumor growth with inhibition ratio of 55.2% and 46.9%, respectively. Body weight had not been significantly changed in DLF-treated mice compared to the control. However there was obvious loss of body weight in 5-FU group during chemotherapy (Fig. 7D). No drug-induced lesions were observed in the important organs of mice treated with H-dose DLF (Fig. 7E). In addition, the expressions of Caspase-3, Caspase-9, CD34 and ki67 in tumors were measured by immunohistochemistry (Fig. 7F and G). Compared with the control group, the levels of Caspase-3 and Caspase-9 significantly increased, whereas the levels of CD34 and ki67 were gradually down-regulated in DLF-treatment groups.

4. Discussion Evasion from apoptosis was a prominent feature of human cancer, which contributed to the formation of tumors and their resistance to treatment[21]. Programmed cell death via apoptosis was characteristically disturbed in human cancer. Many anticancer chemotherapy killed cancer cells by activating the intrinsic and/or extrinsic apoptosis pathway[22]. The change of mitochondrial function was closely related with apoptosis[23]. The loss of Δψm caused by mitochondrial damage was a key event in early cell apoptosis[24]. In this study, DLF not only caused the swelling of mitochondrial membrane, but also caused significant decrease of Δψm in CRC cells. Mitochondria are the source and target of ROS. The oxidation of mitochondrial pores by ROS may result in the release of Cytochrome c and the disruption of the Δψm[7, 25]. After short-term treatment, DLF led to rapid production and accumulation of ROS in CRC cells. NAC, a small molecule inhibitor of ROS, inhibited the production of ROS in CRC cells and reversed DLF-induced cell death. Mitochondrial apoptotic pathway is regulated by the Bcl-2 family proteins, which has pro-apoptotic members (such as Bax and Bak) or anti-apoptotic members (such as Bcl-2 and Bcl-xl)[26]. Mitochondrial extracorporeal membrane permeability increase while Bax translocation and Bak conformational changes occurs, which causes the release of

9 / 24

mitochondrial apoptotic proteins such as Cytochrome c and SMAC from the mitochondrial membrane space to the cytoplasm[27, 28]. DLF not only up-regulated the expression of Bax protein, but also down-regulated the expression of Bcl-2 protein in CRC cells which might induce the increase of apoptotic Bax-Bax homologous dimer and the decrease of anti-apoptotic heterodimer Bax-Bcl-2 by altering the expression balance of Bcl-2 family proteins in CRC cells. These affairs increased the mitochondrial membrane permeability accompanying with the decrease of Δψm and the release of Cytochrome c. The increase of Cytochrome c in cytoplasm was a critical step in the apoptosis process[29]. Compared with the control group, Cytochrome c in CRC cells treated with DLF increased significantly. The Cytochrome c binded to its cytosolic partner Apaf-1 to form apoptosome, which recruited and activated procaspase-9 to initiate an apoptotic protease cascade[30]. The increased expression of cleaved Caspase-9 in CRC cells induced by DLF further confirmed that the mitochondrial apoptotic pathway was activated by DLF. ER is the primary site for synthesis and folding of secreted and membrane-bound proteins. It is also the site for cholesterol and steroid synthesis, lipid synthesis, glycogen synthesis and the storage of Ca2+[31]. Regulated Ca2+ transfers from ER to the mitochondria is important in maintaining control of pro-survival/pro-death pathways[32]. The accumulation of ROS in cells might induce oxidative stress of ER and promote the release of Ca2+ from internal stores into cytoplasm. The level of Ca2+ in cytoplasm of HT29 and HCT116 cells treated with DLF was much higher than that in the control group, which was consistent with the level of ROS production. The increase in cytosolic Ca2+ not only activates calpain but also causes Δψm depolarization and ATP loss[33]. Caspase-12 is localized at ER and activated by ER stress, including disruption of ER calcium homeostasis and accumulation of excess proteins in ER[34]. Caspase-12 was specifically cleaved and activated by calpain in ER-stressed cells, and then directly cleaved and activated Caspase-9[35]. Compared with the control group, the level of Ca2+ and cleaved Caspase-12 protein increased significantly in CRC cells treated with DLF, which indicated DLF activated the ER stress apoptotic pathway. Mitochondrial and ER apoptotic pathways eventually converged to Caspase-3. Caspase-3, as the executor of apoptosis, plays an irreplaceable role in apoptosis and can be activated by Caspase-9 or Caspase-8[36]. PARP，a DNA repair enzyme, played an important role in DNA damage repair and apoptosis. PARP was also an important marker of apoptosis and inactivated by cleaved Caspase-3[37]. PARP is very important for the cell stability and survival. Once PARP was cleaved, it lost its enzyme activity, which will lead to cell instability and accelerate cell apoptosis. Compared with the control, cleaved Caspase-3 was increased significantly in all DLF-treated CRC cells, which cleaved and activated its substrate PARP, causing a significant increase of cleaved PARP in DLF-treated cells. An accumulation of ROS severely damages the protein and DNA, which will block cell entry into mitosis by the G2/M checkpoint mechanism[38]. The progression of G2/M is regulated by cdc2 kinase and Cyclin B1. When DNA was damaged, p53 protein prevented DNA replication and induced cells cycle arrest via activation its downstream protein p21. p21 suppresses Cyclin B1 and cdc2 expression by inhibiting either cdc2 kinase activity or blocking the interaction of Cyclin B1-cdc2 complexes with their substrates, and then leads to G2/M phase cell cycle arrest[39]. DLF significantly increased level of p21 and inhibited the expression of Cyclin B1, cdc2 and cdc25, which resulted in cell cycle arrest at G2/M phase.

10 / 24

The protein kinases regulate cellular functions of transcription, translation, proliferation, growth and survival by the process of phosphorylation. Stimulation of the PI3K/Akt/mTOR and Raf/MEK/Erk pathways enhances growth, survival, and metabolism of cancer cells[40]. Abnormal activation of PI3K/AKT/mTOR and Raf/MEK/Erk signaling pathway is common in human cancer cells[41, 42]. Several drugs targeting nodes of the two pathways have been developed[43]. Activated Akt or Erk plays an anti-apoptotic role by phosphorylation of Bad[44, 45]. In our study, DLF significantly decreased the phosphorylation levels of PI3K, AKT and mTOR protein. DLF also significantly inhibited the expression of phospho-Raf in CRC cells, and thereby reduced the phosphorylation levels of downstream molecules MEK and Erk1/2. These results indicated that DLF affected the survival of CRC cells partly by inhibiting both PI3K/Akt/mTOR and Raf/MEK/Erk signaling pathway. DLF inhibited tumor growth without significant loss of body weight and damage of important organs in xenograft mice. The blood vessels were always activated to meet the needs of continuous growth of tumors. CD34 was mainly expressed in endothelial cells which was closely related with angiogenesis[46]. DLF increased the expression of cleaved Caspase-9, cleaved Caspase-3 and inhibited the expression of CD34 and ki67 in vivo. These results indicated that DLF might inhibit tumor growth by inducing apoptosis and anti-angiogenesis without obvious side effects. In conclusion, the results presented here demonstrated that DLF exhibited antitumor effects against CRC cells in vitro and in vivo. As illustrated in schematic diagram (Fig. 8), DLF not only induced ROS generation, ER stress, mitochondrial dysfunction, G2/M arrest and apoptosis, but also inhibited both PI3K/AKT/mTOR and Raf/MEK/Erk signaling pathways. These findings supported the role of DLF as a potential agent against CRC.

Acknowledgements The authors gratefully acknowledge the financial support of the National Nature Science Foundation of China (21775023 and 81973558), Fujian Provincial Natural Science Foundation (2018J01596 and 2016J01371), Social Development Guiding Programs of Fujian Province of China (2017Y0042 and 2018Y0011), Joint Funds for the innovation of science and Technology, Fujian province (2017Y9123, 2016Y9047 and 2017Y9118), Training project of young talents in health system of Fujian Province (2016-ZQN-63 and 2018-ZQN-3) and Talents Cultivation Program of Health System in Fujian Province (2018-CX-39) and program for Young Top-Notch Innovative Talents of Fujian Province of China.

Conflict of interest The authors declare that they have no conflict of interest

References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J Clin 68(6) (2018) 394-424. [2] D. Trachootham, Y. Zhou, H. Zhang, Y. Demizu, Z. Chen, H. Pelicano, P.J. Chiao, G. Achanta, R.B. Arlinghaus, J. Liu, Selective killing of oncogenically transformed cells through a ROS-mediated mechanism by β-phenylethyl isothiocyanate, Cancer Cell 10(3) (2006) 241-252.

11 / 24

[3] M. Panczyk, Pharmacogenetics research on chemotherapy resistance in colorectal cancer over the last 20 years, World Journal of Gastroenterology: WJG 20(29) (2014) 9775. [4] K.-M. Debatin, Activation of apoptosis pathways by anticancer treatment, Toxicol. Lett. 112 (2000) 41-48. [5] S. Fulda, Targeting apoptosis for anticancer therapy, Seminars in cancer biology, 31 (2015) 84-88. [6] X. Chen, X. Dai, P. Zou, W. Chen, V. Rajamanickam, C. Feng, W. Zhuge, C. Qiu, Q. Ye, X. Zhang, Curcuminoid EF24 enhances the anti-tumor activity of Akt inhibitor MK-2206 through ROS-mediated ER stress and mitochondrial dysfunction in gastric cancer, Brit. J. Pharmacol. 174(10) (2017) 1131. [7] H.-U. Simon, A. Haj-Yehia, F. Levi-Schaffer, Role of reactive oxygen species (ROS) in apoptosis induction, Apoptosis 5(5) (2000) 415-418. [8] E. Agostinelli, N. Seiler, Non-irradiation-derived reactive oxygen species (ROS) and cancer: therapeutic implications, Amino Acids 31(3) (2006) 341-355. [9] H. Pelicano, D. Carney, P. Huang, ROS stress in cancer cells and therapeutic implications, Drug Resist. Update. 7(2) (2004) 97-110. [10] S. Park, W. Lim, F.W. Bazer, G. Song, Apigenin Induces ROS Dependent Apoptosis and ER Stress in Human Endometriosis Cells, J. Cell Physiol. 233(4) (2018) 3055. [11] K. Bishayee, S. Ghosh, A. Mukherjee, R. Sadhukhan, J. Mondal, A. Khuda‐Bukhsh, Quercetin induces cytochrome‐c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M, in cervical carcinoma: signal cascade and drug‐DNA interaction, Cell Proliferat. 46(2) (2013) 153-163. [12] Y. Su, C.-M. Sun, H.-H. Chuang, P.-T. Chang, Studies on the cytotoxic mechanisms of ginkgetin in a human ovarian adenocarcinoma cell line, Naunyn Schmiedebergs Arch. Pharmacol. 362(1) (2000) 82-90. [13] G. Cao, E. Sofic, R.L. Prior, Antioxidant and prooxidant behavior of flavonoids: structure-activity relationships, Free. Radical. Bio. Med 22(5) (1997) 749-760. [14] G. Galati, M.Y. Moridani, T.S. Chan, P.J. O’Brien, Peroxidative metabolism of apigenin and naringenin versus luteolin and quercetin: glutathione oxidation and conjugation, Free. Radical. Bio. Med 30(4) (2001) 370-382. [15] Y. Sui, S. Li, P. Shi, Y. Wu, Y. Li, W. Chen, L. Huang, H. Yao, X. Lin, Ethyl acetate extract from Selaginella doederleinii Hieron inhibits the growth of human lung cancer cells A549 via caspase-dependent apoptosis pathway, Journal of ethnopharmacology 190 (2016) 261-271. [16] W. Yao, Z. Lin, G. Wang, S. Li, B. Chen, Y. Sui, J. Huang, Q. Liu, P. Shi, X. Lin, Delicaflavone induces apoptosis via mitochondrial pathway accompanying G2/M cycle arrest and inhibition of MAPK signaling cascades in cervical cancer HeLa cells, Phytomedicine (2019) 152973. [17] Y. Sui, H. Yao, S. Li, L. Jin, P. Shi, Z. Li, G. Wang, S. Lin, Y. Wu, Y. Li, Delicaflavone induces autophagic cell death in lung cancer via Akt/mTOR/p70S6K signaling pathway, J. Mol. Med-jmm. 95(3) (2017) 311-322. [18] Y. Uchihara, K. Tago, H. Taguchi, Y. Narukawa, F. Kiuchi, H. Tamura, M. Funakoshi-Tago, Taxodione induces apoptosis in BCR-ABL-positive cells through ROS generation, Biochemical pharmacology 154 (2018) 357-372. [19] S. Zhang, W.-C. Huang, L. Zhang, C. Zhang, F.J. Lowery, Z. Ding, H. Guo, H. Wang, S. Huang, A.A. Sahin, SRC family kinases as novel therapeutic targets to treat breast cancer brain metastases, Cancer Res. 73(18) (2013) 5764-5774.

12 / 24

[20] J.A. McCubrey, L.S. Steelman, W.H. Chappell, S.L. Abrams, E.W. Wong, F. Chang, B. Lehmann, D.M. Terrian, M. Milella, A. Tafuri, Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance, Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1773(8) (2007) 1263-1284. [21] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144(5) (2011) 646-674. [22] S. Fulda, K.-M. Debatin, Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy, Oncogene 25(34) (2006) 4798. [23] G. Kroemer, J.C. Reed, Mitochondrial control of cell death, Nat. Med. 6(5) (2000) 513. [24] J.D. Ly, D. Grubb, A. Lawen, The mitochondrial membrane potential (Δψ m) in apoptosis; an update, Apoptosis 8(2) (2003) 115-128. [25] C.E. Halim, S.L. Xinjing, L. Fan, J.B. Vitarbo, F. Arfuso, C.H. Tan, A.S. Narula, A.P. Kumar, G. Sethi, K.S. Ahn, Anti-cancer effects of oxymatrine are mediated through multiple molecular mechanism (s) in tumor models, Pharmacological research

(2019) 104327.

[26] J.C. Reed, Bcl-2 family proteins, Oncogene 17(25) (1998) 3225. [27] R.J. Youle, A. Strasser, The BCL-2 protein family: opposing activities that mediate cell death, Nat. Rev. Mol. Cell Bio 9(1) (2008) 47. [28] L. Gong, Y. Tang, R. An, M. Lin, L. Chen, J. Du, RTN1-C mediates cerebral ischemia/reperfusion injury via ER stress and mitochondria-associated apoptosis pathways, Cell death & disease 8(10) (2017) e3080. [29] R.M. Kluck, E. Bossy-Wetzel, D.R. Green, D.D. Newmeyer, The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis, Science 275(5303) (1997) 1132-1136. [30] X. Jiang, L. Li, Z. Ying, C. Pan, S. Huang, L. Li, M. Dai, B. Yan, M. Li, H. Jiang, A Small Molecule That Protects the Integrity of the Electron Transfer Chain Blocks the Mitochondrial Apoptotic Pathway, Mol. Cell 63(2) (2016) 229-239. [31] T.L. Watterson, B. Hamilton, R. Martin, R.A. Coulombe Jr, Urban particulate matter causes ER stress and the unfolded protein response in human lung cells, Toxicol. Sci. 112(1) (2009) 111-122. [32] J.D. Malhotra, R.J. Kaufman, ER stress and its functional link to mitochondria: role in cell survival and death, Cold Spring Harb Perspect Biol 3(9) (2011) a004424. [33] S. Oyadomari, E. Araki, M. Mori, Endoplasmic reticulum stress-mediated apoptosis in pancreatic β-cells, Apoptosis 7(4) (2002) 335-345. [34] T. Nakagawa, H. Zhu, N. Morishima, E. Li, J. Xu, B.A. Yankner, J. Yuan, Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-β, Nature 403(6765) (2000) 98. [35] N. Morishima, K. Nakanishi, H. Takenouchi, T. Shibata, Y. Yasuhiko, An endoplasmic reticulum stress-specific caspase cascade in apoptosis cytochrome c-independent activation of caspase-9 by caspase-12, J. Biol. Chem. 277(37) (2002) 34287-34294. [36] B.B. Wolf, D.R. Green, Suicidal tendencies: apoptotic cell death by caspase family proteinases, J. Biol. Chem. 274(29) (1999) 20049-20052. [37] Y. Shi, Mechanical aspects of apoptosome assembly, Curr. Opin. Cell Biol. 18(6) (2006) 677-684. [38] W.R. Taylor, G.R. Stark, Regulation of the G2/M transition by p53, Oncogene 20(15) (2001) 1803. [39] M. Park, H. Chae, J. Yun, M, Y. Kim, S. Kim, M. Han, D. Shin, Constitutive activation of cyclin B1-associated cdc2 kinase overrides p53-mediated G2-M arrest, Cancer Res. 60(3) (2000) 542-545. [40] V. Asati, D.K. Mahapatra, S.K. Bharti, PI3K/Akt/mTOR and Ras/Raf/MEK/ERK signaling pathways

13 / 24

inhibitors as anticancer agents: Structural and pharmacological perspectives, Eur. J. Med. Chem. 109 (2016) 314-341. [41] S.M. Wilhelm, C. Carter, L. Tang, D. Wilkie, A. McNabola, H. Rong, C. Chen, X. Zhang, P. Vincent, M. McHugh, BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis, Cancer Res. 64(19) (2004) 7099-7109. [42] M. Will, A.C.R. Qin, W. Toy, Z. Yao, V. Rodrik-Outmezguine, C. Schneider, X. Huang, P. Monian, X. Jiang, E. De Stanchina, Rapid induction of apoptosis by PI3K inhibitors is dependent upon their transient inhibition of RAS–ERK signaling, Cancer Discov 4(3) (2014) 334-347. [43] D. Chen, X. Lin, C. Zhang, Z. Liu, Z. Chen, Z. Li, J. Wang, B. Li, Y. Hu, B. Dong, Dual PI3K/mTOR inhibitor BEZ235 as a promising therapeutic strategy against paclitaxel-resistant gastric cancer via targeting PI3K/Akt/mTOR pathway, Cell death & disease 9(2) (2018) 123. [44] S.R. Datta, H. Dudek, X. Tao, S. Masters, H. Fu, Y. Gotoh, M.E. Greenberg, Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery, Cell 91(2) (1997) 231-241. [45] M.P. Scheid, K.M. Schubert, V. Duronio, Regulation of Bad phosphorylation and association with Bcl-xL by the MAPK/Erk kinase, J. Biol. Chem. 274(43) (1999) 31108-31113. [46] H. Kimura, T. Nakajima, K. Kagawa, T. Deguchi, M. Kakusui, T. Katagishi, T. Okanoue, K. Kashima, T. Ashihara, Angiogenesis in hepatocellular carcinoma as evaluated by CD34 immunohistochemistry, Liver 18(1) (1998) 14-19.

14 / 24

Figure Legends

Figure 1. The molecular structure of DLF and effects of DLF on the viability, morphological changes and mitochondrial membrane potential in HT29 and HCT116 cells. (A) The puritury and molecular structure of DLF. (B) The cell viability. Cells were treated with DLF (0-120 μM) or 5-FU (40 μM) for 12, 24, 48 and 72 h and the cell viability was determined by MTT assay. Data was expressed as mean ± SD, n=3. (C) The cell morphological changes. Cells were treated with DLF (0-80 μM) for 24 h and then imaged by inverted microscope at 200 × magnification. (D) The cell ultrastructure. Cells were treated with DLF (0-80 μM) for 24 h. Representative images were obtained by TEM. (E) The Cell mitochondrial membrane potential. Cells treated with DLF (0-80 μM) for 12 h and then imaged by inverted fluorescence microscope at 200 × magnification. The intensity of red or green fluorescence was measure by Image J software.

Figure 2. The attenuated effects of NAC on the viability and ROS production in DLF-treated HT29 and HCT116 cells. (A and B) The attenuated effects of NAC on the viability of DLF-treated cells. Cells were incubated with DLF (40 and 80 μM) in the absence or presence of NAC (2 mM) for 24, 48 and 72 h. (C) The effects of NAC on cell viability. Cells were treated with NAC (1, 2 and 4 mM) for 48 h. (D and E) The representative images of DCF fluorescence and the level of ROS in the cells. Cells were treated with DLF (0-80 μM) for 6 and 12 h, respectively and imaged by inverted fluorescence microscope at 200 × magnification. Then the cells were harvested by trypsinization and collected in 5 ml centrifuge tube. The intensity of fluorescent DCF (ROS level) was measured using fluorescence spectrophotometer with excitation wavelength of 488 nm and emission wavelength of 525 nm. (F). The attenuated effects of NAC on the ROS production in DLF-treated cells. Cells were incubated with 80 μM DLF in the absence or presence of 2 mM NAC for 12 h, and representative DCF fluorescence images were obtained by inverted fluorescence microscope at 200× magnification. Data was expressed as mean ± SD, n=3. “ns” indicates no significant difference; * indicates that p ＜ 0.05 value, ** indicates that p ＜ 0.01 value and *** indicates that p ＜ 0.001 value compared with control cells.

Figure 3. The effects of DLF on the Ca2+ level and apoptosis in HT29 and HCT116 cells. (A and B) The effects of DLF on the Ca2+ level. Cells were treated with DLF (0-80 μM) for 6 and 12 h, respectively, and representative Fluo-4-Ca2+ fluorescence images were obtained by fluorescence microscope at 200 × magnification. (C and D) The cell apoptosis. HT29 Cells were treated with DLF (0-80 μM) for 24 h and HCT116 cells were treated with 40 μM DLF for 12, 24 and 48 h, respectively and cell apoptosis was measured by flow cytometry.

Figure 4. Effects of DLF on cell cycle, expression of G2/M phase relative proteins and mRNA of p21, Cyclin B1 in HT29 and HCT116 cells. (A and B) The cell cycle distribution. Cells were treated with DLF (0-80 μM) for 24 h and with 40 μM DLF for 12, 24 and 48 h. DNA content was stained with PI and analyzed by flow cytometry. The populations in cell cycle phase were calculated with Modfit LT 5.0 software. (C and D) The expression of relative proteins of G2/M phase. Cells were treated with DLF (0-80 μM) for 24 h and proteins were confirmed by western blot. (E and F) The relative expression of mRNA of p21 and Cyclin B1. Cells were treated with DLF (0-80 μM) for 12 h. Total RNA was extracted and qPCR

15 / 24

analysis was used to measure the mRNA expression of p21 and Cyclin B1. 18S rRNA was used as an internal standard. Data was expressed as mean ± SD, n=3. * indicates that p ＜ 0.05 value, ** indicates that p ＜ 0.01 value and *** indicates that p ＜ 0.001 value, compared with control.

Figure 5. Effects of DLF on the expression of Bax, Bcl-2, Cytochrome c, PARP, Caspases proteins and Caspase-3 mRNA in HT29 and HCT116 cells. (A and B) The expression of Bax, Bcl-2 protein. (C and D) The expression of Cytochrome c, PARP protein. (E and F) The expression of Caspase-12, Caspase-9 and Caspase-3 protein. Cells were treated with DLF (0-80 μM) for 24 h and proteins were confirmed by western blot. (G and H) The relative expression of Caspase-3 mRNA. Cells were treated with DLF (0-80 μM) for 12 h. Total RNA was extracted and qPCR analysis was used to measure the mRNA expression of Caspase-3. 18S rRNA was used as an internal standard. Data was expressed as mean ± SD, n=3. * indicates that p ＜ 0.05 value, ** indicates that p ＜ 0.01 value and *** indicates that p ＜ 0.001 value, compared with control.

Figure 6. Effects of DLF on expression of proteins from PI3K/AKTmTOR and Raf/MEK/Erk signaling pathway in HT29 and HCT116 cells. (A and B) The expression of PI3K, AKT and mTOR protein. (C and D) The expression of Raf, MEK and Erk1/2 protein. Cells treated with DLF (0-80 μM) for 24 h and protein was confirmed by western blot. Data was expressed as mean ± SD, n=3. * indicates that p ＜ 0.05 value, ** indicates that p ＜ 0.01 value and *** indicates that p ＜ 0.001 value, compared with control.

Figure 7. The effect of DLF on tumors growth, body weights and important organs in HT29 cells xenograft tumors in nude mice. (A) Harvested tumour specimens. (B) Tumor weight. (C) The tumor volumes. (D) The body weights. (E) The important organs. (F) The expression of Caspase-9, Caspase-3, CD34 and ki67 in xenografts tumor measured by immunohistochemistry (400×magnification). (G) The optical density of associated proteins. Data was expressed as mean ± SD, n=3. * indicates that p ＜ 0.05 value, ** indicates that p ＜ 0.01 value and *** indicates that p ＜ 0.001 value compared with control cells.

Figure 8. The proposed mechanisms of DLF-induced apoptosis in CRC cells. DLF caused ROS-mediated G2/M arrest and apoptosis through ER stress and mitochondrial pathway in CRC cells. In addition, DLF inhibited phosphorylation of PI3K/AKT/mTOR and Raf/MEK/Erk1/2 signaling pathway.

16 / 24

Figures

17 / 24

18 / 24

19 / 24

20 / 24

21 / 24

22 / 24

23 / 24

24 / 24