- Email: [email protected]
Detection and characterisation of Shiga toxin-producing Escherichia coli other than Escherichia coli O157:H7 in wild ruminants
Available online at www.sciencedirect.com
The Veterinary Journal The Veterinary Journal 180 (2009) 384–388 www.elsevier.com/locate/tvjl
Detection and characterisation of Shiga toxin-producing Escherichia coli other than Escherichia coli O157:H7 in wild ruminants S. Sa´nchez a,*, A. Garcı´a-Sa´nchez a, R. Martı´nez a, J. Blanco b, J.E. Blanco b, M. Blanco b, G. Dahbi b, A. Mora b, J. Hermoso de Mendoza a, J.M. Alonso a, J. Rey a a
Patologı´a Infecciosa y Epidemiologı´a, Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad de Extremadura, Avda. de la Universidad s/n, 10071 Ca´ceres, Spain b Laboratorio de Referencia de E. coli (LREC), Departamento de Microbiologı´a y Parasitologı´a, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo, Spain Accepted 24 January 2008
Abstract Shiga toxin-producing Escherichia coli (STEC) are an important group of emerging pathogens, with ruminants recognised as their main natural reservoir. The aim of this work was to establish the prevalence of non-O157 STEC in free-ranging wild ruminants in the Extremadura region of Spain and to characterise them phenogenotypically. Faecal samples were collected from 243 wild ruminants, including Cervus elaphus, Capreolus capreolus, Dama dama and Ovis musimon and were examined for STEC using both phenotypic (Vero cells) and genotypic (PCR and PFGE) methods. Shiga toxin-producing Escherichia coli were isolated from 58 (23.9%) of the samples and a total of 65 isolates were characterised. A PCR method indicated that 11 (16.9%) strains carried the stx1 gene, 44 (67.7%) carried the stx2 gene and 10 (15.4%) carried both these genes. The ehxA gene was detected in 37 (57%) of the isolates but none contained either the eae or saa genes. The isolates were from a total of 12 ‘O’ serogroups, although 80% were restricted to the O2, O8, O128, O146, O166 and O174 serogroups. The most commonly isolated STEC bacteria, which were from the O146 serogroup, exhibited a high degree of polymorphism as indicated by PFGE. Shiga toxin-producing Escherichia coli isolates of serogroups O20, O25, O166, O171, O174 and O176 had not previously been found in wild ruminants. This is the first study to confirm that wild ruminants in Spain are a reservoir of STEC and are thus a potential source of human infection. Ó 2008 Elsevier Ltd. All rights reserved. Keywords: Shiga toxin-producing E. coli (STEC); Serogroups; Virulence genes; Pulsed-field gel electrophoresis; Wild ruminants
Introduction Shiga toxin-producing Escherichia coli (STEC) have recently emerged as important food-borne pathogens, especially serotype O157:H7 (Paton and Paton, 1998). Human diseases ranging from mild diarrhoea to haemorrhagic colitis, haemolytic uraemic syndrome (HUS) and thrombotic thrombocytopenic purpura, can be caused by STEC, typically affecting children, the elderly and immuno-compromised patients (Centers for Disease Control and Prevention, 2001). The pathogenic capacity of STEC *
Corresponding author. Tel.: +34 927257114; fax: +34 927257110. E-mail address: [email protected] (S. Sa´nchez).
1090-0233/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.tvjl.2008.01.011
resides in a number of virulence factors, including Shiga toxins (Stx1 and Stx2) (Paton and Paton, 1998), intimin (Kaper et al., 1998), enterohaemolysin (Ehly) (Schmidt et al., 1995) and the STEC autoaggultinating adhesin (Saa) (Paton and Paton, 2002). Healthy domestic ruminants such as cattle, sheep and goats, can harbour STEC and E. coli O157:H7 in their faeces and are thus natural reservoirs of these pathogens (Beutin et al., 1993; Blanco et al., 2001, 2004; Rey et al., 2003). However, STEC strains have also been isolated from wild deer (Renter et al., 2001), and deer have been implicated in the food-borne transmission of E. coli O157:H7 to humans in Japan (Nagano et al., 2004) and in the USA (Keene et al., 1997; Cody et al., 1999; Rabatsky-Ehr et al., 2002).
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
385
Table 1 Shiga toxin-producing Escherichia coli gene detection Gene
Primer
Oligonucleotide sequence (50 –30 )
Fragment size (bp)
Annealing temperature (°C)
Reference
stx1
VT1-A VT1-B VT2-A VT2-B HlyA1 HlyA4 EAE-1 EAE-2 SAA-DF SAA-DR
CGCTGAATGTCATTCGCTCTGC CGTGGTATAGCTACTGTCACC CTTCGGTATCCTATTCCCGG CTGCTGTGACAGTGACAAAACGC GGTGCAGCAGAAAAAGTTGTAG TCTCGCCTGATAGTGTTTGGTA GAGAATGAAATAGAAGTCGT GCGGTATCTTTCGCGTAATCGCC CGTGATGAACAGGCTATTGC ATGGACATGCCTGTGGCAAC
302
55
Blanco et al. (2003)
516
55
Blanco et al. (2003)
1.551
60
Schmidt et al. (1995)
775
55
Blanco et al. (2003)
119
66
Paton and Paton (2002)
stx2 ehxA eaea saa
Primer sequences and predicted lengths of PCR amplification products. a eae gene detection. Universal oligonucleotide primer pair EAE-1 and EAE-2 with homology to the 50 conserved region of eae gene (detects all eae variants currently reported).
Although we have previously reported the first isolation of three E. coli O157:H7 strains from red deer in Spain (Garcı´a-Sa´nchez et al., 2007), in general there are few reports of the isolation of STEC other than E. coli O157:H7 from wild ruminants and, to our knowledge, the prevalence of these bacteria in wildlife in Spain is not known. The current study thus expands our previous work, aiming to establish the prevalence of non-O157 STEC in free-ranging wild ruminants in the Extremadura region of Spain and to phenogenotypically characterise them, with the objective of determining if wild cervids represent a potential risk to public health. Materials and methods Sampling method and isolation of E. coli Faecal samples were collected from animals killed by hunters during the 2004 and 2005 hunting seasons (October–February) in the Sierra de Las Villuercas in Extremadura, a region in the South-West of Spain. A total of 243 samples, each of approximately 20 g, were collected from each animal per rectum using a clean glove. Red deer (Cervus elaphus) provided 206 samples, 20 came from roe deer (Capreolus capreolus), 6 from fallow deer (Dama dama) and 11 from mouflon (Ovis musimon). The samples were kept at ambient temperature, transported to the laboratory, and placed in culture media within 24 h. Specimens were plated onto Lactose–MacConkey agar (Oxoid) and, following overnight incubation, four colonies with the typical appearance of E. coli were randomly chosen, and confirmed as E. coli by biochemical methods (API 20E, BioMe´rieux). A total of 972 isolates were established and stored at room temperature in nutrient broth with 0.75% agar.
Production and detection of Shiga toxins in Vero cells All E. coli colonies were tested for Shiga toxin production by cytotoxicity assays on Vero cells as previously described (Blanco et al., 1993).
Detection of virulence genes by polymerase chain reaction (PCR) All STEC colonies were tested as previously described (Blanco et al., 2003), with primers specific for the genes encoding: Stx1 and Stx2 toxin (stx1 and stx2 genes); enterohaemolysin (ehxA gene); intimin (eae gene); and Saa (saa gene) (Table 1). When STEC isolates from a given animal exhibited similar genetic characteristics in terms of the presence or absence of these genes, it was assumed that they were the same strain. Reference E. coli strains used as controls were STEC-EDL933 (human, O157:H7,
stx1, stx2, eae, ehxA) (Zhang et al., 2002), STEC-FV900a (bovine, O91:H21, stx2, ehxA, saa) (Orden et al., 2005) and K12-185 (negative for the stx1, stx2, eae, ehxA and saa genes) (Blanco et al., 2004).
Determination of O antigen The identification of O antigen in isolates was carried out as described by Guine´e et al. (1981) using the full range of O antisera from O1 to O185. Antisera were produced in the Laboratorio de Referencia de E. coli (Lugo, Spain), and were absorbed with corresponding cross-reacting antigens to remove non-specific agglutinins.
Pulsed-field gel electrophoresis Pulsed-field gel electrophoresis (PFGE) was performed in a CHEF MAPPER system (Bio-Rad) at 14 °C in 0.5 Tris–Borate EDTA (TBE) buffer by the Internet proposed standard-protocol for PFGE1.1 Cleavage of agarose-embedded DNA was achieved with 0.2–0.8 U/lL XbaI (Roche) following the manufacturer’s instructions. Run and pulse times were 2.2 to 54.0 s for 22 h with linear ramping. Pulsed-field gel electrophoresis was used to establish relatedness and diversity among some STEC isolates. Analysis of TIFF files was by InfoQuestFP software (Bio-Rad). Cluster analysis of Dice similarity indices based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) generated a dendrogram, with a 1% tolerance value, describing the relationships between the pulsotypes. A difference of at least one restriction fragment in the profiles was considered sufficient discrimination between clones.
Results STEC strains were detected in 58 (23.9%) of the animals sampled: 51 (24.7%) from red deer, 1 (5%) from a roe-deer, 2 (33.3%) from fallow-deer and 4 (36.4%) from mouflon. Two different strains were identified in seven animals. A total of 65 STEC strains were characterised. All were cytotoxic to Vero cells. The PCR procedure indicated that 11 (16.9%) strains carried the stx1 gene, 44 (67.7%) the stx2 gene and 10 (15.4%) contained both of these genes. The ehxA gene was detected in 37 (57%) of the strains and none of the 65 isolates contained the eae or saa genes. The STEC strains identified belonged to 12 O serogroups although 80% were of the O2, O8, O128, O146, 1 See: http://www.foodborne-net.de/content/content/e25/e70/e580/ index_ger.html.
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
386
O166 or O174 serogroups (Table 2). Although there were 22 different associations between serogroup and virulence genes among the 65 strains, 54% were restricted to five. The most commonly found association was between serogroup O146 and the stx2 and ehxA genes (16 strains), followed by serogroup O174 and the stx2 (6 strains) and O8 and the stx2 (5 strains) genes (Table 2). The 25 STEC isolates of the most common O146 serogroup, selected for analysis by PFGE, produced a dendrogram indicating 25 distinct restriction profiles with 13–22 discernible fragments, ranging from approximately 35 to 1000 kb in molecular weight (Fig. 1). Based on a similarity of >70%, these 25 isolates could be divided into nine groups containing between 1 and 9 isolates. However, genetic patterns in each group differed considerably and at an 85% similarity level, 21 PFGE subgroups were identified, with only three small clusters clearly differentiated: strains 23 and 62 (similarity >86%); strains 36, 37 and 38 (similarity >93%); and strains 50 and 51 (similarity >92%). Discussion A total of 65 STEC strains were isolated from free-ranging wild ruminants in the Extremadura region of Spain. Although non-O157 STEC strains have previously been isolated from red deer, fallow-deer and mouflon (Leotta et al., 2006), this is the first report of the isolation of this pathogen from roe-deer. Most surveys of wild ruminants, and particularly of deer, have focused on the detection of E. coli O157:H7 (Fischer et al., 2001; Renter et al., 2001; Dunn et al., 2004), so that there is limited knowledge of the prevalence of non-O157 Table 2 Serogroups and virulence genes of Shiga toxin-producing Escherichia coli strains isolated from wild ruminants Serogroup
Total number of strains tested
stx1
stx2
eae
ehxA
saa
O2 O2 O8 O15 O20 O25 O128 O128 O146 O146 O146 O146 O146 O166 O166 O171 O174 O176 ONTa ONTa ONTa ONTa
3 4 5 1 1 1 4 1 3 2 1 16 3 3 1 1 6 1 2 1 2 3
– – – – – – + + + + + – – + – + – + + + + –
+ + + + + + + – + – – + + – + – + – + + – +
– – – – – – – – – – – – – – – – – – – – – –
+ – – – – – + – + + – + – + + – – + + – + –
– – – – – – – – – – – – – – – – – – – – – –
a
ONT: O antigen non-typeable.
STEC isolates in such animals. Many previous studies used faecal samples collected from the ground and no STEC were found in such samples from red or roe deer or from chamois in Italy (Caprioli et al., 1991), although STEC were isolated from such samples from wild deer in Japan (Asakura et al., 1998; Fukuyama et al., 1999). In other studies, where faecal samples were taken directly from animals, no STEC were found in hunter-killed moose and roe deer in Sweden (Wahlstrom et al., 2003) or in red deer, roe deer, moose or reindeer in Norway (Lillehaug et al., 2005). In non-O157 STEC isolates found in wild deer in Japan (Asakura et al., 1998; Fukuyama et al., 1999), there was a lower prevalence of stx-positive isolates (10.5% and 16.3%) than in the current study. In a recent study of 65 captive non-domestic mammals, including red deer, mouflon and fallow deer from a zoological collection in Argentina, Leotta et al. (2006) isolated non-O157 STEC from 38.5% of faecal samples. Pie´rard et al. (1997) found non-O157 STEC in 16% of red deer, 21% of roe deer and in 22% of fallow deer raw venison samples. Shiga toxin-producing E. coli strains from 12 O serogroups have previously been isolated from wild and captive non-domestic ruminants and from venison (Rice et al., 1995; Asakura et al., 1998; Fukuyama et al., 1999; Leotta et al., 2006).2 The STEC strains in the present study from serogroups O20, O25, O166, O171, O174 and O176 have not been isolated from wild ruminants previously. With the exception of serogroup O176, all of the serogroups identified have been associated with human infection and in particular with causing HUS.3 Of the 65 STEC strains characterised in this study, stx2 was the predominant stx gene identified, a finding in agreement with Asakura et al. (1998) and of potential clinical significance given that most human patients developing HUS are infected with stx2 – carrying STEC strains (Caprioli et al., 1995). In contrast Fukuyama et al. (1999) and Leotta et al. (2006) identified 48% of STEC isolates with the stx1 gene only and 40% of STEC isolates with both the stx1 and stx2 genes respectively. The eae and saa genes were not detected in the STEC strains in the current study, findings similar to those of Pie´rard et al. (1997) in a study of venison and to those of Leotta et al. (2006) in captive non-domestic ruminants. The ehxA gene was detected in a higher percentage of isolates than in those reported by Leotta et al. (2006). Few studies have assessed the genetic relatedness of nonO157 STEC isolates from wild ruminants. Asakura et al. (1998) used random amplified polymorphic DNA to analyse the genetic diversity of seven STEC isolates from serogroups O111, O96 and ‘O’ antigen non-typeable (ONT) isolates obtained from wild deer, and found similarities in only three isolates. Using PFGE, Leotta et al. (2006) found 19 distinct restriction profiles within 25 STEC strains isolated from captive non-domestic mammals of serogroups
2 3
See: http://www.microbionet.com.au/vtectable.html. See: http://www.microbionet.com.au/vtectable.html.
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
387
Fig. 1. Pulsed-field gel electrophoresis (PFGE) was used to establish relatedness and diversity among Shiga toxin-producing Escherichia coli (STEC) isolates. A dendrogram was created based on the Dice coefficient of similarity indicating the relatedness of the 25 O146 STEC strains isolated from wild ruminants as determined by macrorestriction analysis of genomic DNA with XbaI.
O2, O12, O13, O146 and ONT. Based on these findings these authors suggested that inter-species transmission of STEC strains occurred within the same or within different habitats (Leotta et al., 2006). The results of the present study indicate a high degree of polymorphism among the 25 O146 STEC isolates. Leotta et al. (2006) also found extensive polymorphism among six O146:H28 and five O13:H6 STEC isolates from captive non-domestic mammals. This finding indicates the existence of different clusters of STEC isolates among the most prevalent O146 serogroup found in wild ruminants. However, further studies will be required to determine the temporal evolution of these clusters and to determine their pathogenicity.
ducing E. coli isolates of serogroups O20, O25, O166, O171, O174 and O176 have not previously been found in wild ruminants and this is the first study to implicate wild ruminants in Spain as a reservoir of STEC and thus a potential source of human infection. Further studies will be required to further elucidate the degree of zoonotic risk posed.
Conclusion
Acknowledgements
The results of this study demonstrate a high prevalence of STEC infection in wild-living ruminants. Shiga toxin-pro-
This study was partially supported by the Fondo de Investigacio´n Sanitaria (FIS G03/025-COLIRED-O157).
Conflict of interest statement None of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper.
388
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
S. Sa´nchez acknowledges the Ministerio de Educacio´n y Ciencia for his research fellowship (AP2002–3286). Thanks are also due to R. Rubio for her skilful technical assistance. References Asakura, H., Makino, S., Shirahata, T., Tsukamoto, T., Kurazono, H., Ikeda, T., Takeshi, K., 1998. Detection and genetical characterization of Shiga toxin-producing Escherichia coli from wild deer. Microbiology and Immunology 42, 815–822. Beutin, L., Geier, D., Steinruck, H., Zimmermann, S., Scheutz, F., 1993. Prevalence and some properties of verotoxin (Shiga-like toxin)producing Escherichia coli in seven different species of healthy domestic animals. Journal of Clinical Microbiology 31, 2483–2488. Blanco, J., Blanco, M., Blanco, J.E., Mora, A., Alonso, M.P., Gonza´lez, E.A., Berna´rdez, M.I., 2001. Epidemiology of verocytotoxigenic Escherichia coli (VTEC) in ruminants. In: Duffy, G., Garvey, P., McDowell, D. (Eds.), Verocytotoxigenic Escherichia coli. Food and Nutrition Press Inc., Trumbull, USA, pp. 113–148. Blanco, M., Blanco, J., Blanco, J.E., Ramos, J., 1993. Enterotoxigenic, verotoxigenic, and necrotoxigenic Escherichia coli isolated from cattle in Spain. American Journal of Veterinary Research 54, 1446–1451. Blanco, M., Blanco, J.E., Mora, A., Rey, J., Alonso, J.M., Hermoso, M., Hermoso, J., Alonso, M.P., Dahbi, G., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2003. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. Journal of Clinical Microbiology 41, 1351– 1356. Blanco, M., Blanco, J.E., Mora, A., Dahbi, G., Alonso, M.P., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2004. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae –n). Journal of Clinical Microbiology 42, 645–651. Caprioli, A., Donelli, G., Falbo, V., Passi, C., Pagano, A., Mantovani, A., 1991. Antimicrobial resistance and production of toxins in Escherichia coli strains from wild ruminants and the alpine marmot. Journal of Wildlife Diseases 27, 324–327. Caprioli, A., Luzzi, I., Gianviti, A., Russmann, H., Karch, H., 1995. Pheno-genotyping of verotoxin 2 (VT2)-producing Escherichia coli causing haemorrhagic colitis and haemolytic uraemic syndrome by direct analysis of patients’ stools. Journal of Medical Microbiology 43, 348–353. Centers for Disease Control and Prevention, 2001. Outbreaks of Escherichia coli O157:H7 infections among children associated with farm visits –Pennsylvania and Washington, 2000. Journal of the American Medical Association 285, 2320–2322. Cody, S.H., Glynn, M.K., Farrar, J.A., Cairns, K.L., Griffin, P.M., Kobayashi, J., Fyfe, M., Hoffman, R., King, A.S., Lewis, J.H., Swaminathan, B., Bryant, R.G., Vugia, D.J., 1999. An outbreak of Escherichia coli O157:H7 infection from unpasteurized commercial apple juice. Annals of Internal Medicine 130, 202–209. Dunn, J.R., Keen, J.E., Moreland, D., Alex, T., 2004. Prevalence of Escherichia coli O157:H7 in white-tailed deer from Louisiana. Journal of Wildlife Diseases 40, 361–365. Fischer, J.R., Zhao, T., Doyle, M.P., Goldberg, M.R., Brown, C.A., Sewell, C.T., Kavanagh, D.M., Bauman, C.D., 2001. Experimental and field studies of Escherichia coli O157:H7 in white-tailed deer. Applied and Environmental Microbiology 67, 1218–1224. Fukuyama, M., Yokoyama, R., Sakata, S., Furuhata, K., Oonaka, K., Hara, M., Satoh, Y., Tabuchi, K., Itoh, T., Kai, A., Matsuda, M., 1999. Study on the verotoxin-producing Escherichia coli – isolation of the bacteria from deer dung Kansenshogaku Zasshi. Journal of the Japanese Association for Infectious Diseases 73, 1140–1144 (in Japanese). Garcı´a-Sa´nchez, A., Sa´nchez, S., Rubio, R., Pereira, G., Alonso, J.M., Hermoso de Mendoza, J., Rey, J., 2007. Presence of Shiga toxin-
producing E. coli O157:H7 in a survey of wild artiodactyls. Veterinary Microbiology 121, 373–377. Guine´e, P.A.M., Jansen, W.H., Wadstro¨m, T., Sellwood, R., 1981. Escherichia coli associated with neonatal diarrhoea in piglets and calves. In: Leeww, P.W., Guine´e, P.A.M. (Eds.), Laboratory Diagnosis in Neonatal Calf and Pig Diarrhoea: Current Topics in Veterinary and Animal Science. Martinus-Nijhoff, The Hague, pp. 126–162. Kaper, J.B., Elliott, S., Sperandio, V., Perna, N.T., Mayhew, G.F., Blattner, F.R., 1998. Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In: Kaper, J.B., O’Brien, A.D. (Eds.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, DC, pp. 163–182. Keene, W.E., Sazie, E., Kok, J., Rice, D.H., Hancock, D.D., Balan, V.K., Zhao, T., Doyle, M.P., 1997. An outbreak of Escherichia coli O157:H7 infections traced to jerky made from deer meat. Journal of the American Medical Association 277, 1229–1231. Leotta, G.A., Deza, N., Origlia, J., Toma, C., Chinen, I., Miliwebsky, E., Iyoda, S., Sosa-Estani, S., Rivas, M., 2006. Detection and characterization of Shiga toxin-producing Escherichia coli in captive nondomestic mammals. Veterinary Microbiology 118, 151–157. Lillehaug, A., Bergsjo, B., Schau, J., Bruheim, T., Vikoren, T., Handeland, K., 2005. Campylobacter spp., Salmonella spp., verocytotoxic Escherichia coli, and antibiotic resistance in indicator organisms in wild cervids. Acta Veterinaria Scandinavica 46, 23–32. Nagano, H., Hirochi, T., Fujita, K., Wakamori, Y., Takeshi, K., Yano, S., 2004. Phenotypic and genotypic characterization of beta-D-glucuronidase-positive Shiga toxin-producing Escherichia coli O157:H7 isolates from deer. Journal of Medical Microbiology 53, 1037–1043. Orden, J.A., Corte´s, C., Ruiz-Santa-Quiteria, J.A., Martı´nez, S., de la Fuente, R., 2005. Detection of the saa gene in verotoxin-producing Escherichia coli from ruminants. Journal of Veterinary Diagnostic Investigation 17, 65–67. Paton, A.W., Paton, J.C., 2002. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. Journal of Clinical Microbiology 40, 271–274. Paton, J.C., Paton, A.W., 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clinical Microbiology Reviews 11, 450–479. Pie´rard, D., Van Damme, L., Moriau, L., Stevens, D., Lauwers, S., 1997. Virulence factors of verocytotoxin-producing Escherichia coli isolated from raw meats. Applied and Environmental Microbiology 63, 4585– 4587. Rabatsky–Ehr, T., Dingman, D., Marcus, R., Howard, R., Kinney, A., Mshar, P., 2002. Deer meat as the source for a sporadic case of Escherichia coli O157:H7 infection, Connecticut. Emerging Infectious Diseases 8, 525–527. Renter, D.G., Sargeant, J.M., Hygnstorm, S.E., Hoffman, J.D., Gillespie, J.R., 2001. Escherichia coli O157:H7 in free-ranging deer in Nebraska. Journal of Wildlife Diseases 37, 755–760. Rey, J., Blanco, J.E., Blanco, M., Mora, A., Dahbi, G., Alonso, J.M., Hermoso, M., Hermoso, J., Alonso, M.P., Usera, M.A., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2003. Serotypes, phage types and virulence genes of Shiga-producing Escherichia coli isolated from sheep in Spain. Veterinary Microbiology 94, 47–56. Rice, D.H., Hancock, D.D., Besser, T.E., 1995. Verotoxigenic E. coli O157 colonisation of wild deer and range cattle. Veterinary Record 137, 524. Schmidt, H., Beutin, L., Karch, H., 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infection and Immunity 63, 1055–1061. Wahlstrom, H., Tysen, E., Olsson Engvall, E., Brandstrom, B., Eriksson, E., Morner, T., Vagsholm, I., 2003. Survey of Campylobacter species, VTEC O157 and Salmonella species in Swedish wildlife. Veterinary Record 153, 74–80. Zhang, W.L., Kohler, B., Oswald, E., Beutin, L., Karch, H., Morabito, S., Caprioli, A., Suerbaum, S., Schmidt, H., 2002. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. Journal of Clinical Microbiology 40, 4486–4492.
The Veterinary Journal The Veterinary Journal 180 (2009) 384–388 www.elsevier.com/locate/tvjl
Detection and characterisation of Shiga toxin-producing Escherichia coli other than Escherichia coli O157:H7 in wild ruminants S. Sa´nchez a,*, A. Garcı´a-Sa´nchez a, R. Martı´nez a, J. Blanco b, J.E. Blanco b, M. Blanco b, G. Dahbi b, A. Mora b, J. Hermoso de Mendoza a, J.M. Alonso a, J. Rey a a
Patologı´a Infecciosa y Epidemiologı´a, Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad de Extremadura, Avda. de la Universidad s/n, 10071 Ca´ceres, Spain b Laboratorio de Referencia de E. coli (LREC), Departamento de Microbiologı´a y Parasitologı´a, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo, Spain Accepted 24 January 2008
Abstract Shiga toxin-producing Escherichia coli (STEC) are an important group of emerging pathogens, with ruminants recognised as their main natural reservoir. The aim of this work was to establish the prevalence of non-O157 STEC in free-ranging wild ruminants in the Extremadura region of Spain and to characterise them phenogenotypically. Faecal samples were collected from 243 wild ruminants, including Cervus elaphus, Capreolus capreolus, Dama dama and Ovis musimon and were examined for STEC using both phenotypic (Vero cells) and genotypic (PCR and PFGE) methods. Shiga toxin-producing Escherichia coli were isolated from 58 (23.9%) of the samples and a total of 65 isolates were characterised. A PCR method indicated that 11 (16.9%) strains carried the stx1 gene, 44 (67.7%) carried the stx2 gene and 10 (15.4%) carried both these genes. The ehxA gene was detected in 37 (57%) of the isolates but none contained either the eae or saa genes. The isolates were from a total of 12 ‘O’ serogroups, although 80% were restricted to the O2, O8, O128, O146, O166 and O174 serogroups. The most commonly isolated STEC bacteria, which were from the O146 serogroup, exhibited a high degree of polymorphism as indicated by PFGE. Shiga toxin-producing Escherichia coli isolates of serogroups O20, O25, O166, O171, O174 and O176 had not previously been found in wild ruminants. This is the first study to confirm that wild ruminants in Spain are a reservoir of STEC and are thus a potential source of human infection. Ó 2008 Elsevier Ltd. All rights reserved. Keywords: Shiga toxin-producing E. coli (STEC); Serogroups; Virulence genes; Pulsed-field gel electrophoresis; Wild ruminants
Introduction Shiga toxin-producing Escherichia coli (STEC) have recently emerged as important food-borne pathogens, especially serotype O157:H7 (Paton and Paton, 1998). Human diseases ranging from mild diarrhoea to haemorrhagic colitis, haemolytic uraemic syndrome (HUS) and thrombotic thrombocytopenic purpura, can be caused by STEC, typically affecting children, the elderly and immuno-compromised patients (Centers for Disease Control and Prevention, 2001). The pathogenic capacity of STEC *
Corresponding author. Tel.: +34 927257114; fax: +34 927257110. E-mail address: [email protected] (S. Sa´nchez).
1090-0233/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.tvjl.2008.01.011
resides in a number of virulence factors, including Shiga toxins (Stx1 and Stx2) (Paton and Paton, 1998), intimin (Kaper et al., 1998), enterohaemolysin (Ehly) (Schmidt et al., 1995) and the STEC autoaggultinating adhesin (Saa) (Paton and Paton, 2002). Healthy domestic ruminants such as cattle, sheep and goats, can harbour STEC and E. coli O157:H7 in their faeces and are thus natural reservoirs of these pathogens (Beutin et al., 1993; Blanco et al., 2001, 2004; Rey et al., 2003). However, STEC strains have also been isolated from wild deer (Renter et al., 2001), and deer have been implicated in the food-borne transmission of E. coli O157:H7 to humans in Japan (Nagano et al., 2004) and in the USA (Keene et al., 1997; Cody et al., 1999; Rabatsky-Ehr et al., 2002).
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
385
Table 1 Shiga toxin-producing Escherichia coli gene detection Gene
Primer
Oligonucleotide sequence (50 –30 )
Fragment size (bp)
Annealing temperature (°C)
Reference
stx1
VT1-A VT1-B VT2-A VT2-B HlyA1 HlyA4 EAE-1 EAE-2 SAA-DF SAA-DR
CGCTGAATGTCATTCGCTCTGC CGTGGTATAGCTACTGTCACC CTTCGGTATCCTATTCCCGG CTGCTGTGACAGTGACAAAACGC GGTGCAGCAGAAAAAGTTGTAG TCTCGCCTGATAGTGTTTGGTA GAGAATGAAATAGAAGTCGT GCGGTATCTTTCGCGTAATCGCC CGTGATGAACAGGCTATTGC ATGGACATGCCTGTGGCAAC
302
55
Blanco et al. (2003)
516
55
Blanco et al. (2003)
1.551
60
Schmidt et al. (1995)
775
55
Blanco et al. (2003)
119
66
Paton and Paton (2002)
stx2 ehxA eaea saa
Primer sequences and predicted lengths of PCR amplification products. a eae gene detection. Universal oligonucleotide primer pair EAE-1 and EAE-2 with homology to the 50 conserved region of eae gene (detects all eae variants currently reported).
Although we have previously reported the first isolation of three E. coli O157:H7 strains from red deer in Spain (Garcı´a-Sa´nchez et al., 2007), in general there are few reports of the isolation of STEC other than E. coli O157:H7 from wild ruminants and, to our knowledge, the prevalence of these bacteria in wildlife in Spain is not known. The current study thus expands our previous work, aiming to establish the prevalence of non-O157 STEC in free-ranging wild ruminants in the Extremadura region of Spain and to phenogenotypically characterise them, with the objective of determining if wild cervids represent a potential risk to public health. Materials and methods Sampling method and isolation of E. coli Faecal samples were collected from animals killed by hunters during the 2004 and 2005 hunting seasons (October–February) in the Sierra de Las Villuercas in Extremadura, a region in the South-West of Spain. A total of 243 samples, each of approximately 20 g, were collected from each animal per rectum using a clean glove. Red deer (Cervus elaphus) provided 206 samples, 20 came from roe deer (Capreolus capreolus), 6 from fallow deer (Dama dama) and 11 from mouflon (Ovis musimon). The samples were kept at ambient temperature, transported to the laboratory, and placed in culture media within 24 h. Specimens were plated onto Lactose–MacConkey agar (Oxoid) and, following overnight incubation, four colonies with the typical appearance of E. coli were randomly chosen, and confirmed as E. coli by biochemical methods (API 20E, BioMe´rieux). A total of 972 isolates were established and stored at room temperature in nutrient broth with 0.75% agar.
Production and detection of Shiga toxins in Vero cells All E. coli colonies were tested for Shiga toxin production by cytotoxicity assays on Vero cells as previously described (Blanco et al., 1993).
Detection of virulence genes by polymerase chain reaction (PCR) All STEC colonies were tested as previously described (Blanco et al., 2003), with primers specific for the genes encoding: Stx1 and Stx2 toxin (stx1 and stx2 genes); enterohaemolysin (ehxA gene); intimin (eae gene); and Saa (saa gene) (Table 1). When STEC isolates from a given animal exhibited similar genetic characteristics in terms of the presence or absence of these genes, it was assumed that they were the same strain. Reference E. coli strains used as controls were STEC-EDL933 (human, O157:H7,
stx1, stx2, eae, ehxA) (Zhang et al., 2002), STEC-FV900a (bovine, O91:H21, stx2, ehxA, saa) (Orden et al., 2005) and K12-185 (negative for the stx1, stx2, eae, ehxA and saa genes) (Blanco et al., 2004).
Determination of O antigen The identification of O antigen in isolates was carried out as described by Guine´e et al. (1981) using the full range of O antisera from O1 to O185. Antisera were produced in the Laboratorio de Referencia de E. coli (Lugo, Spain), and were absorbed with corresponding cross-reacting antigens to remove non-specific agglutinins.
Pulsed-field gel electrophoresis Pulsed-field gel electrophoresis (PFGE) was performed in a CHEF MAPPER system (Bio-Rad) at 14 °C in 0.5 Tris–Borate EDTA (TBE) buffer by the Internet proposed standard-protocol for PFGE1.1 Cleavage of agarose-embedded DNA was achieved with 0.2–0.8 U/lL XbaI (Roche) following the manufacturer’s instructions. Run and pulse times were 2.2 to 54.0 s for 22 h with linear ramping. Pulsed-field gel electrophoresis was used to establish relatedness and diversity among some STEC isolates. Analysis of TIFF files was by InfoQuestFP software (Bio-Rad). Cluster analysis of Dice similarity indices based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) generated a dendrogram, with a 1% tolerance value, describing the relationships between the pulsotypes. A difference of at least one restriction fragment in the profiles was considered sufficient discrimination between clones.
Results STEC strains were detected in 58 (23.9%) of the animals sampled: 51 (24.7%) from red deer, 1 (5%) from a roe-deer, 2 (33.3%) from fallow-deer and 4 (36.4%) from mouflon. Two different strains were identified in seven animals. A total of 65 STEC strains were characterised. All were cytotoxic to Vero cells. The PCR procedure indicated that 11 (16.9%) strains carried the stx1 gene, 44 (67.7%) the stx2 gene and 10 (15.4%) contained both of these genes. The ehxA gene was detected in 37 (57%) of the strains and none of the 65 isolates contained the eae or saa genes. The STEC strains identified belonged to 12 O serogroups although 80% were of the O2, O8, O128, O146, 1 See: http://www.foodborne-net.de/content/content/e25/e70/e580/ index_ger.html.
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
386
O166 or O174 serogroups (Table 2). Although there were 22 different associations between serogroup and virulence genes among the 65 strains, 54% were restricted to five. The most commonly found association was between serogroup O146 and the stx2 and ehxA genes (16 strains), followed by serogroup O174 and the stx2 (6 strains) and O8 and the stx2 (5 strains) genes (Table 2). The 25 STEC isolates of the most common O146 serogroup, selected for analysis by PFGE, produced a dendrogram indicating 25 distinct restriction profiles with 13–22 discernible fragments, ranging from approximately 35 to 1000 kb in molecular weight (Fig. 1). Based on a similarity of >70%, these 25 isolates could be divided into nine groups containing between 1 and 9 isolates. However, genetic patterns in each group differed considerably and at an 85% similarity level, 21 PFGE subgroups were identified, with only three small clusters clearly differentiated: strains 23 and 62 (similarity >86%); strains 36, 37 and 38 (similarity >93%); and strains 50 and 51 (similarity >92%). Discussion A total of 65 STEC strains were isolated from free-ranging wild ruminants in the Extremadura region of Spain. Although non-O157 STEC strains have previously been isolated from red deer, fallow-deer and mouflon (Leotta et al., 2006), this is the first report of the isolation of this pathogen from roe-deer. Most surveys of wild ruminants, and particularly of deer, have focused on the detection of E. coli O157:H7 (Fischer et al., 2001; Renter et al., 2001; Dunn et al., 2004), so that there is limited knowledge of the prevalence of non-O157 Table 2 Serogroups and virulence genes of Shiga toxin-producing Escherichia coli strains isolated from wild ruminants Serogroup
Total number of strains tested
stx1
stx2
eae
ehxA
saa
O2 O2 O8 O15 O20 O25 O128 O128 O146 O146 O146 O146 O146 O166 O166 O171 O174 O176 ONTa ONTa ONTa ONTa
3 4 5 1 1 1 4 1 3 2 1 16 3 3 1 1 6 1 2 1 2 3
– – – – – – + + + + + – – + – + – + + + + –
+ + + + + + + – + – – + + – + – + – + + – +
– – – – – – – – – – – – – – – – – – – – – –
+ – – – – – + – + + – + – + + – – + + – + –
– – – – – – – – – – – – – – – – – – – – – –
a
ONT: O antigen non-typeable.
STEC isolates in such animals. Many previous studies used faecal samples collected from the ground and no STEC were found in such samples from red or roe deer or from chamois in Italy (Caprioli et al., 1991), although STEC were isolated from such samples from wild deer in Japan (Asakura et al., 1998; Fukuyama et al., 1999). In other studies, where faecal samples were taken directly from animals, no STEC were found in hunter-killed moose and roe deer in Sweden (Wahlstrom et al., 2003) or in red deer, roe deer, moose or reindeer in Norway (Lillehaug et al., 2005). In non-O157 STEC isolates found in wild deer in Japan (Asakura et al., 1998; Fukuyama et al., 1999), there was a lower prevalence of stx-positive isolates (10.5% and 16.3%) than in the current study. In a recent study of 65 captive non-domestic mammals, including red deer, mouflon and fallow deer from a zoological collection in Argentina, Leotta et al. (2006) isolated non-O157 STEC from 38.5% of faecal samples. Pie´rard et al. (1997) found non-O157 STEC in 16% of red deer, 21% of roe deer and in 22% of fallow deer raw venison samples. Shiga toxin-producing E. coli strains from 12 O serogroups have previously been isolated from wild and captive non-domestic ruminants and from venison (Rice et al., 1995; Asakura et al., 1998; Fukuyama et al., 1999; Leotta et al., 2006).2 The STEC strains in the present study from serogroups O20, O25, O166, O171, O174 and O176 have not been isolated from wild ruminants previously. With the exception of serogroup O176, all of the serogroups identified have been associated with human infection and in particular with causing HUS.3 Of the 65 STEC strains characterised in this study, stx2 was the predominant stx gene identified, a finding in agreement with Asakura et al. (1998) and of potential clinical significance given that most human patients developing HUS are infected with stx2 – carrying STEC strains (Caprioli et al., 1995). In contrast Fukuyama et al. (1999) and Leotta et al. (2006) identified 48% of STEC isolates with the stx1 gene only and 40% of STEC isolates with both the stx1 and stx2 genes respectively. The eae and saa genes were not detected in the STEC strains in the current study, findings similar to those of Pie´rard et al. (1997) in a study of venison and to those of Leotta et al. (2006) in captive non-domestic ruminants. The ehxA gene was detected in a higher percentage of isolates than in those reported by Leotta et al. (2006). Few studies have assessed the genetic relatedness of nonO157 STEC isolates from wild ruminants. Asakura et al. (1998) used random amplified polymorphic DNA to analyse the genetic diversity of seven STEC isolates from serogroups O111, O96 and ‘O’ antigen non-typeable (ONT) isolates obtained from wild deer, and found similarities in only three isolates. Using PFGE, Leotta et al. (2006) found 19 distinct restriction profiles within 25 STEC strains isolated from captive non-domestic mammals of serogroups
2 3
See: http://www.microbionet.com.au/vtectable.html. See: http://www.microbionet.com.au/vtectable.html.
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
387
Fig. 1. Pulsed-field gel electrophoresis (PFGE) was used to establish relatedness and diversity among Shiga toxin-producing Escherichia coli (STEC) isolates. A dendrogram was created based on the Dice coefficient of similarity indicating the relatedness of the 25 O146 STEC strains isolated from wild ruminants as determined by macrorestriction analysis of genomic DNA with XbaI.
O2, O12, O13, O146 and ONT. Based on these findings these authors suggested that inter-species transmission of STEC strains occurred within the same or within different habitats (Leotta et al., 2006). The results of the present study indicate a high degree of polymorphism among the 25 O146 STEC isolates. Leotta et al. (2006) also found extensive polymorphism among six O146:H28 and five O13:H6 STEC isolates from captive non-domestic mammals. This finding indicates the existence of different clusters of STEC isolates among the most prevalent O146 serogroup found in wild ruminants. However, further studies will be required to determine the temporal evolution of these clusters and to determine their pathogenicity.
ducing E. coli isolates of serogroups O20, O25, O166, O171, O174 and O176 have not previously been found in wild ruminants and this is the first study to implicate wild ruminants in Spain as a reservoir of STEC and thus a potential source of human infection. Further studies will be required to further elucidate the degree of zoonotic risk posed.
Conclusion
Acknowledgements
The results of this study demonstrate a high prevalence of STEC infection in wild-living ruminants. Shiga toxin-pro-
This study was partially supported by the Fondo de Investigacio´n Sanitaria (FIS G03/025-COLIRED-O157).
Conflict of interest statement None of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper.
388
S. Sa´nchez et al. / The Veterinary Journal 180 (2009) 384–388
S. Sa´nchez acknowledges the Ministerio de Educacio´n y Ciencia for his research fellowship (AP2002–3286). Thanks are also due to R. Rubio for her skilful technical assistance. References Asakura, H., Makino, S., Shirahata, T., Tsukamoto, T., Kurazono, H., Ikeda, T., Takeshi, K., 1998. Detection and genetical characterization of Shiga toxin-producing Escherichia coli from wild deer. Microbiology and Immunology 42, 815–822. Beutin, L., Geier, D., Steinruck, H., Zimmermann, S., Scheutz, F., 1993. Prevalence and some properties of verotoxin (Shiga-like toxin)producing Escherichia coli in seven different species of healthy domestic animals. Journal of Clinical Microbiology 31, 2483–2488. Blanco, J., Blanco, M., Blanco, J.E., Mora, A., Alonso, M.P., Gonza´lez, E.A., Berna´rdez, M.I., 2001. Epidemiology of verocytotoxigenic Escherichia coli (VTEC) in ruminants. In: Duffy, G., Garvey, P., McDowell, D. (Eds.), Verocytotoxigenic Escherichia coli. Food and Nutrition Press Inc., Trumbull, USA, pp. 113–148. Blanco, M., Blanco, J., Blanco, J.E., Ramos, J., 1993. Enterotoxigenic, verotoxigenic, and necrotoxigenic Escherichia coli isolated from cattle in Spain. American Journal of Veterinary Research 54, 1446–1451. Blanco, M., Blanco, J.E., Mora, A., Rey, J., Alonso, J.M., Hermoso, M., Hermoso, J., Alonso, M.P., Dahbi, G., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2003. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. Journal of Clinical Microbiology 41, 1351– 1356. Blanco, M., Blanco, J.E., Mora, A., Dahbi, G., Alonso, M.P., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2004. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae –n). Journal of Clinical Microbiology 42, 645–651. Caprioli, A., Donelli, G., Falbo, V., Passi, C., Pagano, A., Mantovani, A., 1991. Antimicrobial resistance and production of toxins in Escherichia coli strains from wild ruminants and the alpine marmot. Journal of Wildlife Diseases 27, 324–327. Caprioli, A., Luzzi, I., Gianviti, A., Russmann, H., Karch, H., 1995. Pheno-genotyping of verotoxin 2 (VT2)-producing Escherichia coli causing haemorrhagic colitis and haemolytic uraemic syndrome by direct analysis of patients’ stools. Journal of Medical Microbiology 43, 348–353. Centers for Disease Control and Prevention, 2001. Outbreaks of Escherichia coli O157:H7 infections among children associated with farm visits –Pennsylvania and Washington, 2000. Journal of the American Medical Association 285, 2320–2322. Cody, S.H., Glynn, M.K., Farrar, J.A., Cairns, K.L., Griffin, P.M., Kobayashi, J., Fyfe, M., Hoffman, R., King, A.S., Lewis, J.H., Swaminathan, B., Bryant, R.G., Vugia, D.J., 1999. An outbreak of Escherichia coli O157:H7 infection from unpasteurized commercial apple juice. Annals of Internal Medicine 130, 202–209. Dunn, J.R., Keen, J.E., Moreland, D., Alex, T., 2004. Prevalence of Escherichia coli O157:H7 in white-tailed deer from Louisiana. Journal of Wildlife Diseases 40, 361–365. Fischer, J.R., Zhao, T., Doyle, M.P., Goldberg, M.R., Brown, C.A., Sewell, C.T., Kavanagh, D.M., Bauman, C.D., 2001. Experimental and field studies of Escherichia coli O157:H7 in white-tailed deer. Applied and Environmental Microbiology 67, 1218–1224. Fukuyama, M., Yokoyama, R., Sakata, S., Furuhata, K., Oonaka, K., Hara, M., Satoh, Y., Tabuchi, K., Itoh, T., Kai, A., Matsuda, M., 1999. Study on the verotoxin-producing Escherichia coli – isolation of the bacteria from deer dung Kansenshogaku Zasshi. Journal of the Japanese Association for Infectious Diseases 73, 1140–1144 (in Japanese). Garcı´a-Sa´nchez, A., Sa´nchez, S., Rubio, R., Pereira, G., Alonso, J.M., Hermoso de Mendoza, J., Rey, J., 2007. Presence of Shiga toxin-
producing E. coli O157:H7 in a survey of wild artiodactyls. Veterinary Microbiology 121, 373–377. Guine´e, P.A.M., Jansen, W.H., Wadstro¨m, T., Sellwood, R., 1981. Escherichia coli associated with neonatal diarrhoea in piglets and calves. In: Leeww, P.W., Guine´e, P.A.M. (Eds.), Laboratory Diagnosis in Neonatal Calf and Pig Diarrhoea: Current Topics in Veterinary and Animal Science. Martinus-Nijhoff, The Hague, pp. 126–162. Kaper, J.B., Elliott, S., Sperandio, V., Perna, N.T., Mayhew, G.F., Blattner, F.R., 1998. Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In: Kaper, J.B., O’Brien, A.D. (Eds.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, DC, pp. 163–182. Keene, W.E., Sazie, E., Kok, J., Rice, D.H., Hancock, D.D., Balan, V.K., Zhao, T., Doyle, M.P., 1997. An outbreak of Escherichia coli O157:H7 infections traced to jerky made from deer meat. Journal of the American Medical Association 277, 1229–1231. Leotta, G.A., Deza, N., Origlia, J., Toma, C., Chinen, I., Miliwebsky, E., Iyoda, S., Sosa-Estani, S., Rivas, M., 2006. Detection and characterization of Shiga toxin-producing Escherichia coli in captive nondomestic mammals. Veterinary Microbiology 118, 151–157. Lillehaug, A., Bergsjo, B., Schau, J., Bruheim, T., Vikoren, T., Handeland, K., 2005. Campylobacter spp., Salmonella spp., verocytotoxic Escherichia coli, and antibiotic resistance in indicator organisms in wild cervids. Acta Veterinaria Scandinavica 46, 23–32. Nagano, H., Hirochi, T., Fujita, K., Wakamori, Y., Takeshi, K., Yano, S., 2004. Phenotypic and genotypic characterization of beta-D-glucuronidase-positive Shiga toxin-producing Escherichia coli O157:H7 isolates from deer. Journal of Medical Microbiology 53, 1037–1043. Orden, J.A., Corte´s, C., Ruiz-Santa-Quiteria, J.A., Martı´nez, S., de la Fuente, R., 2005. Detection of the saa gene in verotoxin-producing Escherichia coli from ruminants. Journal of Veterinary Diagnostic Investigation 17, 65–67. Paton, A.W., Paton, J.C., 2002. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. Journal of Clinical Microbiology 40, 271–274. Paton, J.C., Paton, A.W., 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clinical Microbiology Reviews 11, 450–479. Pie´rard, D., Van Damme, L., Moriau, L., Stevens, D., Lauwers, S., 1997. Virulence factors of verocytotoxin-producing Escherichia coli isolated from raw meats. Applied and Environmental Microbiology 63, 4585– 4587. Rabatsky–Ehr, T., Dingman, D., Marcus, R., Howard, R., Kinney, A., Mshar, P., 2002. Deer meat as the source for a sporadic case of Escherichia coli O157:H7 infection, Connecticut. Emerging Infectious Diseases 8, 525–527. Renter, D.G., Sargeant, J.M., Hygnstorm, S.E., Hoffman, J.D., Gillespie, J.R., 2001. Escherichia coli O157:H7 in free-ranging deer in Nebraska. Journal of Wildlife Diseases 37, 755–760. Rey, J., Blanco, J.E., Blanco, M., Mora, A., Dahbi, G., Alonso, J.M., Hermoso, M., Hermoso, J., Alonso, M.P., Usera, M.A., Gonza´lez, E.A., Berna´rdez, M.I., Blanco, J., 2003. Serotypes, phage types and virulence genes of Shiga-producing Escherichia coli isolated from sheep in Spain. Veterinary Microbiology 94, 47–56. Rice, D.H., Hancock, D.D., Besser, T.E., 1995. Verotoxigenic E. coli O157 colonisation of wild deer and range cattle. Veterinary Record 137, 524. Schmidt, H., Beutin, L., Karch, H., 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infection and Immunity 63, 1055–1061. Wahlstrom, H., Tysen, E., Olsson Engvall, E., Brandstrom, B., Eriksson, E., Morner, T., Vagsholm, I., 2003. Survey of Campylobacter species, VTEC O157 and Salmonella species in Swedish wildlife. Veterinary Record 153, 74–80. Zhang, W.L., Kohler, B., Oswald, E., Beutin, L., Karch, H., Morabito, S., Caprioli, A., Suerbaum, S., Schmidt, H., 2002. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. Journal of Clinical Microbiology 40, 4486–4492.