- Email: [email protected]
Detection and typing of human papillomaviruses in cervical smears by an original application of the polymerase chain reaction
Molecularand CellularProbes(1991) 5, 445-450
Detection and typing of human papillomaviruses in cervical smears by an original application of the polymerase chain reaction F. Charlotte, 1 J. L. Olivier, 1. C. Chypre, 2 T. Beuret, 3 G. Sadoul, 3 F. Chatelet, 4 J. Luboinski, 4 J. M a r c h a n d 2 and G. Bereziat 1
1Laboratoire de biologie cellulaire et mol~culaire, h6pital Saint Antoine, 184 rue du Faubourg Saint Antoine, 75012 Paris, France, 2CIS bio International BP 32 91192 Gif/Yvette C6dex, France, 3Service de Gyn6cologie, h6pital Rothschild, 33 boulevard de Picpus, 75012 Paris, France, and 4Laboratoire d'anatornie pathologique, hOpital Rothschild, 33 boulevard de Picpus, 75012 Paris, France (Received 25 February 1991, Accepted 13 May 1991) The detection and typing of human papillomaviruses on cervical smears were performed by means of a new application of the polymerase chain reaction allowing easier and faster detection of the amplification product. This application consisted of a combination of two series of amplifications and the use of primers labelled with biotin and with 125 iodine on a reporter group for the second amplification. The final amplification product was detected by counting the radioactivity after incubation of the media in avidin-coated tubes. This test was compared with conventional methods of detection by electrophoresis and Southern blot and its specificity was confirmed. The study of a series of 52 patients demonstrated a higher prevalence of type 16 in relation to types 6/11 and 18 and a correlation between the degree of dysplasia and the frequency of oncogenic types 16 and 18. This new application could facilitate studies of the prevalence of HPV in large series of cervical smears. KEYWORDS: human papillomavirus, polymerase chain reaction, cervical dysplasia, cervical
smears, oncogenesis.
INTRODUCTION are contested as the detection techniques used vary greatly in terms of their sensitivity and specificity. 6 The polymerase chain reaction (PCR) provides a greater sensitivity, but the analysis of the amplification products by hybridization according to the Southern blot method is time-consuming and prevents the application of this technique to the study of large populations. More recently, an original method, the AmpliCIS test involving the use of the PCR, has been described. 7 This test consists of two steps: primary amplification of a target sequence of DNA
More than 60 types of human papillomavirus (HPV) have been identified to date. 1 Experimental arguments suggest that certain types of HPV, including HPV 16, 18, 31 and 33, could be involved in the pathogenesis of carcinoma of the cervix. For example, the DNA of HPV 16 and 18 can immortalize primary cultures of keratinocytes z3 and the E6 and E7 genes of HPV 16 and 18 form complexes with and neutralize anti-oncogenic proteins p53 and pl05RB, respectively. 4"sHowever, epidemiological studies establishing a relationship between HPV and cervical carcinoma "Author to whom correspondenceshouldbe addressed. 0890-8508/91/060445 4-06 $03.00/0
445
(~ 1991 Academic PressLimited
446
F. Charlotte et aL
followed, after dilution of the primary products, by secondary amplification of a region part of the region previously amplified using primers with a modified 5' extremity: biotinylation for one of the two primers and labelling with ~2Slon a reporter group for the other. The secondary amplification products are then bound by their biotinyl extremity to the walls of tubes coated with an avidin matrix. The radioactivity bound to the tubes can then be measured after rinsing. As the AmpliCIS test is easy to perform and rapid, it could be used as a method of detection in prospective studies designed to establish the prevalence of HPV in large populations. In this study, we applied the AmpliCIS test to the detection of HPV 6 and 11 and HPV 16 and 18 associated with benign and malign turnouts of the cervix, in cervical smears. The objective of this study was to confirm the specificity of the AmpliCIS test by comparing the results obtained with this method with those obtained by analysis of the PCR products using the Southern blot technique and probe hybridization.
MATERIALS AND METHODS Clinical specimens
The samples were obtained from Gynaecology Outpatients Department of HOpital Rothschild, Paris. The cytological study was performed in the pathology laboratory of this ~:entre. The cervical specimens (endocervix and exocervix) were collected in 10 ml of PBS (140 mM NaCI, 20 mM KH2P4,20 mM Na2HPO4, pH 7), maintained at 4~ during transport to the biochemistry laboratory. After centrifugation of the samples at 3000g for 15 min, the cell pellets were suspended in 100 p.I of PBS buffer and were stored at - 80~
Amplifications
The reactive mixture necessary for the primary amplification comprised, in a final volume of 25 I.tl: 2.5 I~1of PCR 10 x buffer (500 mM KCI, 100 mM Tris HCI pH 8.3, 15 mM MgCI2, 0"1% gelatin), 2001J.M of each of the dATP, dCTP, dGTP and d]-I'P deoxynucleotides (Pharmacia), 0.25 p.M of each of the primary primers (CIS bio International) and 500 ng of DNA. The amplifications were performed in a Perkin-Elmer Cetus programmable apparatus. After adding 501JI of liquid paraffin (Fluka) to each tube, the DNA was denatured at 95~ for 10min, then 1.25 units of Taq DNA polymerase (Cetus) were added. The primary amplification consisted of 30 cycles according to the following programmes: 94~ 1-5min (denaturation of DNA); 55~ 1.5 min (hybridization of the primers); 72~ 2 rain (extension of the primers). A final cycle consisted of incubation at 72~ for 8 min to ensure complete extension of the amplified DNA. The reactive mixture necessary for the secondary amplification comprised, in a final volume of 25 pl: 2.5 p.I of PCR 10 x buffer, 200 IJ.Mof each of the dATP, dCTP, dGTP and dTTP deoxynucleotides, 0.1 pM of the biotinyl primer and of the detection 12Sl-labelled detection primer (10s cpm pmole -1) (CIS bio International), 2 lul of the primary amplification product diluted to 1/200 and 1.25 units of Taq polymerase. Fifteen amplification cycles were performed according to an identical programme to that of the primary amplification. Each sample was studied in duplicate and positive and negative controls were included and amplified in triplicate. The negative control consisted of calf thymus DNA (1 pg test-l). The positive controls had the following composition: HPV 16: DNA from cells of the Caski cell line, 10 ng test -~, i.e. 106 viral copies; HPV 18: DNA from cells of the HeLa cell line, 100ngtest -~, i.e. 2 x 1 0 s viral copies; HPV 6/11: 100 ng of DNA extracted from a dermoid tumour.
Preparation of the DNA
The DNA of the cervical samples was prepared after thermal lysis of the cell pellets at 100~ for 10 min. Centrifugation at 15,000g for 15 min eliminated the cellular debris, then the DNA present in the supernatant (1 volume) was precipitated with 2 volumes of 100% ethanol at -80~ for 2 h. After centrifugation at 15,000g for 30min and two rinses with 80% ethanol, the purified DNA was suspended in 120 p.I of sterile distilled water. The DNA concentration was determined by measuring the optical density at 260 nm.
Detection of the PCR products in the tube by the AmpliCIS test
The AmpliCIS tubes and the binding and rinsing buffers, described previously, 7 were supplied by the ClS bio International company. A volume, 20 t11, of the secondary amplification solution was diluted in 480 pl of binding buffer and was incubated in AmpliCIS tubes at 37~ for 1 h. Two successive rinses, one at room temperature (500 pl, 5 min) and one at 37~ (1 ml, 5min), were performed to eliminate the unbound radioactive substances. The tubes were directly counted in a Pharmacia-LKB y counter.
PCR application to human papillomaviruses Sequences and localization of the primers The sequences and localization of the primers are presented in Table 1. The sequences selected were situated in the E6 region of the viral genome for HPV 16 and 18 and at the junction of ET-E1 for HPV. 6/11 (data from Genbank).
Southern blot analysis of the primary amplification products The oligonucleotide probes (Table 1) were labelled with T4 polynucleotide kinase (BRL) (20 units) with 50 lu.Ci of 7-32P ATP (3000 Ci mmole -I, Amersham) and were then separated from ATP on a Sephadex G50 column. The primary amplification solution, 5 p.l, was submitted to electrophoresis at 80 V for 1 h on 3% agarose gel (2% Nusieve GTG, 1% Seakem) containing 0-51agml -I of ethidium bromide. The bands were visualized by u.v. transillumination of the gel and their length was evaluated by comparison with a molecular weight marker (123 pb ladder, BRL) then transferred by aspiration with a vacuum of ~ 5 0 cm H20 (Vacugene ~ 2016 pump and transfer apparatus) onto charged nylon membranes (Hybond N + , Amersham) for 30 min in the presence of 0-4 M sodium hydroxide. After prehybridization for 2 h at 42~ in SSC 5 x Denhardt 5 x , 0-5% SDS, 50% formamide in the presence of 100 pg ml -~ of herring sperm DNA (Sigma), the membranes were then hybridized at the same temperature for 6 h with
Table 1.
447
radioactive probes (10+ cpm ml-1). Two rinses were performed with SSC 2 x , 0-5% SDS, one at room temperature for 5min and the other at 42~ for 15 rain. The membranes were rinsed a third time with SSC 0-1 x , 0.5% SDS at room temperature before being autoradiographed for 24 h at - 8 0 ~ between two intensifier screens (Dupont QuantaTM).
Electrophoresis of the secondary amplification products and autoradiographic revelation of the bands A volume, 5 Ill, of the secondary amplification solution was submitted to electrophoresis at 80 V for I h on 3% agarose gel (2% Nusieve GTG, 1% Seakem) containing 0-5 p.g ml -I of ethidium bromide. Amplification bands were visualized by u.v. transillumination after the agarose gel was dried on 3 M Whatman paper. The dried agarose gel was autoradiographed for 24 h in the presence of intensifier screens.
RESULTS Comparison between the results of detection in AmpliCIS tubes and the results of Southern blot analysis of the primary amplification products A total of 54 analyses from different patients (18 for HPV 16, 18 and 6/11, respectively) were performed by the AmpliCIS test and by Southern blot and probe
Sequence and localization of the primers and the probes (data from Genbank)
Sequence 5--3'
Length
Localization
21 21 20 20 45
26-46 293-273 132-151 224-205 78-122
21 20 21 20 45
170-190 444-425 346-366 444-425 321-365
20 21 21 21 45
624-643 1034-1014 693-713 1034-1014 693-737
HPV 16 (E6 gene)
AI: AAGGGCGTAACCGAAATCGGT A2: CACATACAGCATATGGAFFCC Dtyr: GAAAGTTACCACAGI-IATG C Cbio: CACGTCGCAGTAACTGTTGC Probe: TTTTATGCACCAAAAGAGAACTGCAATG1TrCAGGACCCACAGGA
HPV 18 (E6 gene) AI: CACITCACTGCAAGACATAGA A2: GAI-rCAACGGTTTClGGCAC Dytr: AI-I-CAGACTCTGTGTATGGAG Cbio: GATTCAACGGIT[CTGGCAC Probe: TCTAGAAI-I'AGAGAATTAAGACAFI'ATTCAGACTCTGTGTATGGA
I~PV 6/11 (FIlEt genes) AI: GCTCAGAAGATGAGGTGGAC A2: 1-fAAACAATGCCTGTGC-I-fCC Dytr: TGACCTGYrGCTGTGGATGTG Cbio: A2: 1-rAAACAATGCCTGTGCTTCC Probe: GACCTGI-IGCTGTGGATGTGACAGCAACGTCCGACTGGTTGTGGA
448
F. Charlotte et al.
hybridization of the primary amplification products. On electrophoresis of the primary amplification products, amplified DNA bands corresponding to the predicted length were visualized. In addition, less intense bands were visible alongside the expected band for several specimens. Only the band with a length corresponding to the predicted length was hybridized by the labelled probe for each of the viral types. We did not observe any discrepancy between
(a )
MW +
El
--
~
the results of detection in AmpliCIS tubes and Southern blot analysis of the primary PCR products, and we did not observe any hybridization with the negative control. For HPV 16, 12 samples were negative and six were positive. For HPV 18, four samples were positive and 15 were negative. For HPV 6/11, five samples were positive and 13 negative. Typical results obtained with HPV 16 are shown in Fig. l(a, b) and Table 2.
E2
(b)
, ,
i
El ~
,
E2 ^
9
268 bp
Fig. 1. Analysis of the primary HPV 16 amplification products. (a) Electrophoresis of the primary amplification products on 2% Nusieve-1% Seakem agarose gel stained by ethidium bromide. MW, molecular weight marker (123 bp ladder from BRL); +, positive control (Caski cells); - , negative control (calf thymus); lanes E1 and E2, biological samples amplified in duplicate. (b) Autoradiography of the Southern transfer-HPV 16 probe hybridization of the agarose gel shown in (a).
Table 2. Comparison between the results of detection in AmpliCIS tubes and those of conventional Southern blots-probe hybridizations of the primary ampiification products of HPV 16 Radioactivity in AmpliClS tubes (cpm) Conlrols Positive Negative
Results of AmpliCIS test (')
Southern blot of primary amplification products
12677, 11722, 8487 400, 539, 483
+ --
+ --
1715, 1815 8638, 8916 12397, 13963 330, 336 619, 620 556, 565
+ + + ----
+ + + ----
H u m a n samples
E1 E2 E3 E4 E5 E6
All the amplificationswere performed in duplicate for the human samples,in triplicate for the controls. "Samples were considered as positive when the averagevalues of the duplicates were above the cut-off value. C~M+ 5S, where C: cut-off value; M: mean of the results for the negative control; and S: standard deviation.
PCR application to human papillomaviruses
449
Analysis of the secondary amplification products
DISCUSSION
The secondary amplification products derived from a total of 27 samples (nine in each type) were analysed by electrophoresis on agarose gel. For HPV 16 and HPV 6/11, all the samples which were studied were positive by AmpliCIS test. For HPV 18, four positive samples and five negative (all previously studied for the primary amplification products) were analysed. A single band was observed on the autoradiographs of the positive samples and the positive controls, while the non-incorporated primers were located in the migration front as illustrated in Fig. 2 in the case of the secondary PCR products of HPV 16.
The principal techniques used for the detection of HPV (Southern blot and dot-blot of genomic DNA, in situ hybridization) have the disadvantage of poor sensitivity and require the use of biopsy specimens. 8-12 Moreover, as these techniques are time-consuming, previous studies have only involved the analysis of small populations. 6 In order to improve the statistical value of studies of the prevalence of HPV, a rapid and sensitive detection test had to be developed. PCR satisfied most of these objectives, but the analysis of amplification products by Southern blot-probe hybridization was still far too laborious to be suitable as a screening test. For these reasons, the AmpliCIS test appears to be a promising detection method, allowing faster and easier detection of the amplification products. The specificity of this test can be confirmed by the excellent correlation between the results of detection in AmpliCIS tubes and those of conventional Southern blot-probe hybridization analysis of primary amplification products and by the presence of a single band of predicted length after electrophoresis of the secondary amplification products. This analysis demonstrates the absence of amplification of any non-specific primary products during this second step. The predominance of HPV 16 infections over HPV 18 infections and the increased frequency of oncogenic HPV 16 and 18 infections in relation to the degree of severity of dysplasic lesions are in agreement with the data reported in the literature in which PCR was used as the detection technique. 13'~4This study of prevalence constitutes the preliminary phase of a
Prevalence of HPV infection A total of 104 samples corresponding to a population of 52 patients (endocervix and exocervix investigation) were analysed by means of the AmpliCIS test. HPV DNA was detected in the cervical specimens of 27 patients, which represents an infection rate of 52% in the studied population. HPV 6/11 was the type most frequently represented with 17 cases, followed by type 16 with 12 cases and type 18 with four cases. Six cases displayed combinations of HPV 16 and HPV 6/11. In four of these co-infections, HPV 6/11 has the same localization as the oncogenic type. The prevalence of oncogenic HPV types 16 and 18 was higher in the cases of severe dysplasia (five out of seven cases) than in cases of mild dysplasia. In seven cases out of 27, both exocervix and endocervix was found infected.
[o )
+
-
EI
Ez
r-.--~---~~ - - ~
(b ) +
EI --
I". . . . . . I I
~
E2 r~A-.-~
i.........
[" 1
k ArnplifiCGtiOn
products
Bromophenol
blue
RQdiocctive p r i m e r s
! . .
[
..... i
Fig. 2. Autoradiography of the agarose gel of secondary HPV 16 amplification products. +, positive control (Caski cells); - , negative control (calf thymus); lanes E1 and E2, biological samples. Corresponding AmpliCIS data are shown in Table 2.
450
F. Charlotte
prospective study concerning a larger number of subjects which will be published at a later date.
REFERENCES
1. De Viller, E.M. (1989). Heterogeneity of the human papillomavirus group. Journal of Virology 63, 4898903. 2. Woodworth, C.D., Doniger, J. & Di Paolo, J.A. (1989}. Immortalization of the human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma. Journal of Virology 63, 159-64. 3. M6nger, K, Phelps, W.C., Bubb, W., H0wley, P.M. & Shlegel, R. (1989). The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of Virology 63, 159-64. 4. Vousden, K. H. & Parmjit, S. J. (1989). Functional similarity between HPV 16 E7, SV40 large T and adenovirus Ela proteins. Oncogene 4, 153-8. 5. Werness, B.A., Levine, A.J. & Howley, P. M. P. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76-9. 6. Munoz, N., Bosh, X. & Kaldor, J. M. (1988). Does human papillomavirus cause cervical cancer? The state of the epidemiological evidence. The British Journal of Cancer 57, 1-5.
7. Sauvaigo, S., Fouqu~, B., Roget, A., Livache, T., Bazin, H., Chypre, C. & Teoule, R. (1990). Fast so[id support detection of PCR amplified viral DNA sequences using
et
aL
radioiodinated or hapten labelled primers. Nucleic Acids Research 18, 3175-83. 8. Syrjanen, S.M. (1990). Basic concepts and practical applications of recombinant DNA techniques in detection of human papillomavirus (HPV) infections. Acta Pathologica, Microbiologica and Immunologica Scandinavia 98, 95--110. 9. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-17. 10. Wagner, D., Ikenberg, H., Bohem, N. & Gissman, L. (1984). Identification of human papillomavirus in cervical swabs by deoxyribonucleic acid in situ hybridization. Obstetrics and Gynecology 64, 767-72. 11. Caussy, D., Orr, W., Daya, A. D., Roth, P., Reeves, W. & Rawls, W. (1988). Evaluation of methods for detecting human papillomavirus deoxyribonucleotide sequences in clinical specimens. Journal of Clinical Microbiology 26, 236-43. 12. Beckmann, A.M., Meyerson, D., Daling, J.R., Kiviat, M. B., Feneglio, C.M. & McDougall, J. K. (1985). Detection and localization of human papillomavirus in human genital condylomas by in situ hybridization with biotinylated probes. Journal of Medical Virology 16, 265-73. 13. Melchers, W., Van den Brule A., Walboomers, J. et aL (1989). Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. Journal of Medical Virology 27, 265-73. 14. Funchs, P.G., Girardi, F. & Pfister, H. (1988). Human papillomavirus DNA in normal, metaplasic, preneoplasic and neoplasic epithelia of uteral cervix. The International Journal of Cancer 41, 41-5.
Detection and typing of human papillomaviruses in cervical smears by an original application of the polymerase chain reaction F. Charlotte, 1 J. L. Olivier, 1. C. Chypre, 2 T. Beuret, 3 G. Sadoul, 3 F. Chatelet, 4 J. Luboinski, 4 J. M a r c h a n d 2 and G. Bereziat 1
1Laboratoire de biologie cellulaire et mol~culaire, h6pital Saint Antoine, 184 rue du Faubourg Saint Antoine, 75012 Paris, France, 2CIS bio International BP 32 91192 Gif/Yvette C6dex, France, 3Service de Gyn6cologie, h6pital Rothschild, 33 boulevard de Picpus, 75012 Paris, France, and 4Laboratoire d'anatornie pathologique, hOpital Rothschild, 33 boulevard de Picpus, 75012 Paris, France (Received 25 February 1991, Accepted 13 May 1991) The detection and typing of human papillomaviruses on cervical smears were performed by means of a new application of the polymerase chain reaction allowing easier and faster detection of the amplification product. This application consisted of a combination of two series of amplifications and the use of primers labelled with biotin and with 125 iodine on a reporter group for the second amplification. The final amplification product was detected by counting the radioactivity after incubation of the media in avidin-coated tubes. This test was compared with conventional methods of detection by electrophoresis and Southern blot and its specificity was confirmed. The study of a series of 52 patients demonstrated a higher prevalence of type 16 in relation to types 6/11 and 18 and a correlation between the degree of dysplasia and the frequency of oncogenic types 16 and 18. This new application could facilitate studies of the prevalence of HPV in large series of cervical smears. KEYWORDS: human papillomavirus, polymerase chain reaction, cervical dysplasia, cervical
smears, oncogenesis.
INTRODUCTION are contested as the detection techniques used vary greatly in terms of their sensitivity and specificity. 6 The polymerase chain reaction (PCR) provides a greater sensitivity, but the analysis of the amplification products by hybridization according to the Southern blot method is time-consuming and prevents the application of this technique to the study of large populations. More recently, an original method, the AmpliCIS test involving the use of the PCR, has been described. 7 This test consists of two steps: primary amplification of a target sequence of DNA
More than 60 types of human papillomavirus (HPV) have been identified to date. 1 Experimental arguments suggest that certain types of HPV, including HPV 16, 18, 31 and 33, could be involved in the pathogenesis of carcinoma of the cervix. For example, the DNA of HPV 16 and 18 can immortalize primary cultures of keratinocytes z3 and the E6 and E7 genes of HPV 16 and 18 form complexes with and neutralize anti-oncogenic proteins p53 and pl05RB, respectively. 4"sHowever, epidemiological studies establishing a relationship between HPV and cervical carcinoma "Author to whom correspondenceshouldbe addressed. 0890-8508/91/060445 4-06 $03.00/0
445
(~ 1991 Academic PressLimited
446
F. Charlotte et aL
followed, after dilution of the primary products, by secondary amplification of a region part of the region previously amplified using primers with a modified 5' extremity: biotinylation for one of the two primers and labelling with ~2Slon a reporter group for the other. The secondary amplification products are then bound by their biotinyl extremity to the walls of tubes coated with an avidin matrix. The radioactivity bound to the tubes can then be measured after rinsing. As the AmpliCIS test is easy to perform and rapid, it could be used as a method of detection in prospective studies designed to establish the prevalence of HPV in large populations. In this study, we applied the AmpliCIS test to the detection of HPV 6 and 11 and HPV 16 and 18 associated with benign and malign turnouts of the cervix, in cervical smears. The objective of this study was to confirm the specificity of the AmpliCIS test by comparing the results obtained with this method with those obtained by analysis of the PCR products using the Southern blot technique and probe hybridization.
MATERIALS AND METHODS Clinical specimens
The samples were obtained from Gynaecology Outpatients Department of HOpital Rothschild, Paris. The cytological study was performed in the pathology laboratory of this ~:entre. The cervical specimens (endocervix and exocervix) were collected in 10 ml of PBS (140 mM NaCI, 20 mM KH2P4,20 mM Na2HPO4, pH 7), maintained at 4~ during transport to the biochemistry laboratory. After centrifugation of the samples at 3000g for 15 min, the cell pellets were suspended in 100 p.I of PBS buffer and were stored at - 80~
Amplifications
The reactive mixture necessary for the primary amplification comprised, in a final volume of 25 I.tl: 2.5 I~1of PCR 10 x buffer (500 mM KCI, 100 mM Tris HCI pH 8.3, 15 mM MgCI2, 0"1% gelatin), 2001J.M of each of the dATP, dCTP, dGTP and d]-I'P deoxynucleotides (Pharmacia), 0.25 p.M of each of the primary primers (CIS bio International) and 500 ng of DNA. The amplifications were performed in a Perkin-Elmer Cetus programmable apparatus. After adding 501JI of liquid paraffin (Fluka) to each tube, the DNA was denatured at 95~ for 10min, then 1.25 units of Taq DNA polymerase (Cetus) were added. The primary amplification consisted of 30 cycles according to the following programmes: 94~ 1-5min (denaturation of DNA); 55~ 1.5 min (hybridization of the primers); 72~ 2 rain (extension of the primers). A final cycle consisted of incubation at 72~ for 8 min to ensure complete extension of the amplified DNA. The reactive mixture necessary for the secondary amplification comprised, in a final volume of 25 pl: 2.5 p.I of PCR 10 x buffer, 200 IJ.Mof each of the dATP, dCTP, dGTP and dTTP deoxynucleotides, 0.1 pM of the biotinyl primer and of the detection 12Sl-labelled detection primer (10s cpm pmole -1) (CIS bio International), 2 lul of the primary amplification product diluted to 1/200 and 1.25 units of Taq polymerase. Fifteen amplification cycles were performed according to an identical programme to that of the primary amplification. Each sample was studied in duplicate and positive and negative controls were included and amplified in triplicate. The negative control consisted of calf thymus DNA (1 pg test-l). The positive controls had the following composition: HPV 16: DNA from cells of the Caski cell line, 10 ng test -~, i.e. 106 viral copies; HPV 18: DNA from cells of the HeLa cell line, 100ngtest -~, i.e. 2 x 1 0 s viral copies; HPV 6/11: 100 ng of DNA extracted from a dermoid tumour.
Preparation of the DNA
The DNA of the cervical samples was prepared after thermal lysis of the cell pellets at 100~ for 10 min. Centrifugation at 15,000g for 15 min eliminated the cellular debris, then the DNA present in the supernatant (1 volume) was precipitated with 2 volumes of 100% ethanol at -80~ for 2 h. After centrifugation at 15,000g for 30min and two rinses with 80% ethanol, the purified DNA was suspended in 120 p.I of sterile distilled water. The DNA concentration was determined by measuring the optical density at 260 nm.
Detection of the PCR products in the tube by the AmpliCIS test
The AmpliCIS tubes and the binding and rinsing buffers, described previously, 7 were supplied by the ClS bio International company. A volume, 20 t11, of the secondary amplification solution was diluted in 480 pl of binding buffer and was incubated in AmpliCIS tubes at 37~ for 1 h. Two successive rinses, one at room temperature (500 pl, 5 min) and one at 37~ (1 ml, 5min), were performed to eliminate the unbound radioactive substances. The tubes were directly counted in a Pharmacia-LKB y counter.
PCR application to human papillomaviruses Sequences and localization of the primers The sequences and localization of the primers are presented in Table 1. The sequences selected were situated in the E6 region of the viral genome for HPV 16 and 18 and at the junction of ET-E1 for HPV. 6/11 (data from Genbank).
Southern blot analysis of the primary amplification products The oligonucleotide probes (Table 1) were labelled with T4 polynucleotide kinase (BRL) (20 units) with 50 lu.Ci of 7-32P ATP (3000 Ci mmole -I, Amersham) and were then separated from ATP on a Sephadex G50 column. The primary amplification solution, 5 p.l, was submitted to electrophoresis at 80 V for 1 h on 3% agarose gel (2% Nusieve GTG, 1% Seakem) containing 0-51agml -I of ethidium bromide. The bands were visualized by u.v. transillumination of the gel and their length was evaluated by comparison with a molecular weight marker (123 pb ladder, BRL) then transferred by aspiration with a vacuum of ~ 5 0 cm H20 (Vacugene ~ 2016 pump and transfer apparatus) onto charged nylon membranes (Hybond N + , Amersham) for 30 min in the presence of 0-4 M sodium hydroxide. After prehybridization for 2 h at 42~ in SSC 5 x Denhardt 5 x , 0-5% SDS, 50% formamide in the presence of 100 pg ml -~ of herring sperm DNA (Sigma), the membranes were then hybridized at the same temperature for 6 h with
Table 1.
447
radioactive probes (10+ cpm ml-1). Two rinses were performed with SSC 2 x , 0-5% SDS, one at room temperature for 5min and the other at 42~ for 15 rain. The membranes were rinsed a third time with SSC 0-1 x , 0.5% SDS at room temperature before being autoradiographed for 24 h at - 8 0 ~ between two intensifier screens (Dupont QuantaTM).
Electrophoresis of the secondary amplification products and autoradiographic revelation of the bands A volume, 5 Ill, of the secondary amplification solution was submitted to electrophoresis at 80 V for I h on 3% agarose gel (2% Nusieve GTG, 1% Seakem) containing 0-5 p.g ml -I of ethidium bromide. Amplification bands were visualized by u.v. transillumination after the agarose gel was dried on 3 M Whatman paper. The dried agarose gel was autoradiographed for 24 h in the presence of intensifier screens.
RESULTS Comparison between the results of detection in AmpliCIS tubes and the results of Southern blot analysis of the primary amplification products A total of 54 analyses from different patients (18 for HPV 16, 18 and 6/11, respectively) were performed by the AmpliCIS test and by Southern blot and probe
Sequence and localization of the primers and the probes (data from Genbank)
Sequence 5--3'
Length
Localization
21 21 20 20 45
26-46 293-273 132-151 224-205 78-122
21 20 21 20 45
170-190 444-425 346-366 444-425 321-365
20 21 21 21 45
624-643 1034-1014 693-713 1034-1014 693-737
HPV 16 (E6 gene)
AI: AAGGGCGTAACCGAAATCGGT A2: CACATACAGCATATGGAFFCC Dtyr: GAAAGTTACCACAGI-IATG C Cbio: CACGTCGCAGTAACTGTTGC Probe: TTTTATGCACCAAAAGAGAACTGCAATG1TrCAGGACCCACAGGA
HPV 18 (E6 gene) AI: CACITCACTGCAAGACATAGA A2: GAI-rCAACGGTTTClGGCAC Dytr: AI-I-CAGACTCTGTGTATGGAG Cbio: GATTCAACGGIT[CTGGCAC Probe: TCTAGAAI-I'AGAGAATTAAGACAFI'ATTCAGACTCTGTGTATGGA
I~PV 6/11 (FIlEt genes) AI: GCTCAGAAGATGAGGTGGAC A2: 1-fAAACAATGCCTGTGC-I-fCC Dytr: TGACCTGYrGCTGTGGATGTG Cbio: A2: 1-rAAACAATGCCTGTGCTTCC Probe: GACCTGI-IGCTGTGGATGTGACAGCAACGTCCGACTGGTTGTGGA
448
F. Charlotte et al.
hybridization of the primary amplification products. On electrophoresis of the primary amplification products, amplified DNA bands corresponding to the predicted length were visualized. In addition, less intense bands were visible alongside the expected band for several specimens. Only the band with a length corresponding to the predicted length was hybridized by the labelled probe for each of the viral types. We did not observe any discrepancy between
(a )
MW +
El
--
~
the results of detection in AmpliCIS tubes and Southern blot analysis of the primary PCR products, and we did not observe any hybridization with the negative control. For HPV 16, 12 samples were negative and six were positive. For HPV 18, four samples were positive and 15 were negative. For HPV 6/11, five samples were positive and 13 negative. Typical results obtained with HPV 16 are shown in Fig. l(a, b) and Table 2.
E2
(b)
, ,
i
El ~
,
E2 ^
9
268 bp
Fig. 1. Analysis of the primary HPV 16 amplification products. (a) Electrophoresis of the primary amplification products on 2% Nusieve-1% Seakem agarose gel stained by ethidium bromide. MW, molecular weight marker (123 bp ladder from BRL); +, positive control (Caski cells); - , negative control (calf thymus); lanes E1 and E2, biological samples amplified in duplicate. (b) Autoradiography of the Southern transfer-HPV 16 probe hybridization of the agarose gel shown in (a).
Table 2. Comparison between the results of detection in AmpliCIS tubes and those of conventional Southern blots-probe hybridizations of the primary ampiification products of HPV 16 Radioactivity in AmpliClS tubes (cpm) Conlrols Positive Negative
Results of AmpliCIS test (')
Southern blot of primary amplification products
12677, 11722, 8487 400, 539, 483
+ --
+ --
1715, 1815 8638, 8916 12397, 13963 330, 336 619, 620 556, 565
+ + + ----
+ + + ----
H u m a n samples
E1 E2 E3 E4 E5 E6
All the amplificationswere performed in duplicate for the human samples,in triplicate for the controls. "Samples were considered as positive when the averagevalues of the duplicates were above the cut-off value. C~M+ 5S, where C: cut-off value; M: mean of the results for the negative control; and S: standard deviation.
PCR application to human papillomaviruses
449
Analysis of the secondary amplification products
DISCUSSION
The secondary amplification products derived from a total of 27 samples (nine in each type) were analysed by electrophoresis on agarose gel. For HPV 16 and HPV 6/11, all the samples which were studied were positive by AmpliCIS test. For HPV 18, four positive samples and five negative (all previously studied for the primary amplification products) were analysed. A single band was observed on the autoradiographs of the positive samples and the positive controls, while the non-incorporated primers were located in the migration front as illustrated in Fig. 2 in the case of the secondary PCR products of HPV 16.
The principal techniques used for the detection of HPV (Southern blot and dot-blot of genomic DNA, in situ hybridization) have the disadvantage of poor sensitivity and require the use of biopsy specimens. 8-12 Moreover, as these techniques are time-consuming, previous studies have only involved the analysis of small populations. 6 In order to improve the statistical value of studies of the prevalence of HPV, a rapid and sensitive detection test had to be developed. PCR satisfied most of these objectives, but the analysis of amplification products by Southern blot-probe hybridization was still far too laborious to be suitable as a screening test. For these reasons, the AmpliCIS test appears to be a promising detection method, allowing faster and easier detection of the amplification products. The specificity of this test can be confirmed by the excellent correlation between the results of detection in AmpliCIS tubes and those of conventional Southern blot-probe hybridization analysis of primary amplification products and by the presence of a single band of predicted length after electrophoresis of the secondary amplification products. This analysis demonstrates the absence of amplification of any non-specific primary products during this second step. The predominance of HPV 16 infections over HPV 18 infections and the increased frequency of oncogenic HPV 16 and 18 infections in relation to the degree of severity of dysplasic lesions are in agreement with the data reported in the literature in which PCR was used as the detection technique. 13'~4This study of prevalence constitutes the preliminary phase of a
Prevalence of HPV infection A total of 104 samples corresponding to a population of 52 patients (endocervix and exocervix investigation) were analysed by means of the AmpliCIS test. HPV DNA was detected in the cervical specimens of 27 patients, which represents an infection rate of 52% in the studied population. HPV 6/11 was the type most frequently represented with 17 cases, followed by type 16 with 12 cases and type 18 with four cases. Six cases displayed combinations of HPV 16 and HPV 6/11. In four of these co-infections, HPV 6/11 has the same localization as the oncogenic type. The prevalence of oncogenic HPV types 16 and 18 was higher in the cases of severe dysplasia (five out of seven cases) than in cases of mild dysplasia. In seven cases out of 27, both exocervix and endocervix was found infected.
[o )
+
-
EI
Ez
r-.--~---~~ - - ~
(b ) +
EI --
I". . . . . . I I
~
E2 r~A-.-~
i.........
[" 1
k ArnplifiCGtiOn
products
Bromophenol
blue
RQdiocctive p r i m e r s
! . .
[
..... i
Fig. 2. Autoradiography of the agarose gel of secondary HPV 16 amplification products. +, positive control (Caski cells); - , negative control (calf thymus); lanes E1 and E2, biological samples. Corresponding AmpliCIS data are shown in Table 2.
450
F. Charlotte
prospective study concerning a larger number of subjects which will be published at a later date.
REFERENCES
1. De Viller, E.M. (1989). Heterogeneity of the human papillomavirus group. Journal of Virology 63, 4898903. 2. Woodworth, C.D., Doniger, J. & Di Paolo, J.A. (1989}. Immortalization of the human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma. Journal of Virology 63, 159-64. 3. M6nger, K, Phelps, W.C., Bubb, W., H0wley, P.M. & Shlegel, R. (1989). The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of Virology 63, 159-64. 4. Vousden, K. H. & Parmjit, S. J. (1989). Functional similarity between HPV 16 E7, SV40 large T and adenovirus Ela proteins. Oncogene 4, 153-8. 5. Werness, B.A., Levine, A.J. & Howley, P. M. P. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76-9. 6. Munoz, N., Bosh, X. & Kaldor, J. M. (1988). Does human papillomavirus cause cervical cancer? The state of the epidemiological evidence. The British Journal of Cancer 57, 1-5.
7. Sauvaigo, S., Fouqu~, B., Roget, A., Livache, T., Bazin, H., Chypre, C. & Teoule, R. (1990). Fast so[id support detection of PCR amplified viral DNA sequences using
et
aL
radioiodinated or hapten labelled primers. Nucleic Acids Research 18, 3175-83. 8. Syrjanen, S.M. (1990). Basic concepts and practical applications of recombinant DNA techniques in detection of human papillomavirus (HPV) infections. Acta Pathologica, Microbiologica and Immunologica Scandinavia 98, 95--110. 9. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-17. 10. Wagner, D., Ikenberg, H., Bohem, N. & Gissman, L. (1984). Identification of human papillomavirus in cervical swabs by deoxyribonucleic acid in situ hybridization. Obstetrics and Gynecology 64, 767-72. 11. Caussy, D., Orr, W., Daya, A. D., Roth, P., Reeves, W. & Rawls, W. (1988). Evaluation of methods for detecting human papillomavirus deoxyribonucleotide sequences in clinical specimens. Journal of Clinical Microbiology 26, 236-43. 12. Beckmann, A.M., Meyerson, D., Daling, J.R., Kiviat, M. B., Feneglio, C.M. & McDougall, J. K. (1985). Detection and localization of human papillomavirus in human genital condylomas by in situ hybridization with biotinylated probes. Journal of Medical Virology 16, 265-73. 13. Melchers, W., Van den Brule A., Walboomers, J. et aL (1989). Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern blot analysis. Journal of Medical Virology 27, 265-73. 14. Funchs, P.G., Girardi, F. & Pfister, H. (1988). Human papillomavirus DNA in normal, metaplasic, preneoplasic and neoplasic epithelia of uteral cervix. The International Journal of Cancer 41, 41-5.